The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	7559	45687	4796527	transposase,protease	Ralstonia_phage(12.5%)	31	NA	NA
WP_024711641.1|7559_8396_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014501262.1|8582_9389_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501263.1|9665_10859_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044749548.1|11012_11684_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11768_12530_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12576_12999_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13002_13416_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014501266.1|13711_14479_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14489_14759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501267.1|14833_16294_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_048482872.1|16698_17667_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_048482873.1|18162_19119_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	1.1e-41
WP_048482874.1|20524_21583_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_014501292.1|21892_22966_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_041182980.1|23719_24772_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_014501295.1|25557_26688_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_041182981.1|27214_27565_+	peptidase	NA	NA	NA	NA	NA
WP_048482875.1|27712_29524_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_041182982.1|29690_30347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182983.1|30506_31742_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_048482876.1|31846_33376_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.9	2.2e-25
WP_014501302.1|33542_34535_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	30.1	1.1e-09
WP_008572943.1|34534_34855_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_010364746.1|34971_35664_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014501304.1|35882_37232_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_154235674.1|37565_38360_+	2OG-Fe(II) oxygenase	NA	A0A0E3ESN0	Synechococcus_phage	42.9	8.6e-13
WP_014501306.1|38376_39504_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_048482877.1|39634_41011_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	9.2e-79
WP_144406577.1|41213_42533_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014501309.1|42754_43570_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	2.8e-19
WP_154235675.1|44888_45687_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	117778	204882	4796527	transposase,tRNA	Acidithiobacillus_phage(50.0%)	60	NA	NA
WP_048483489.1|117778_119155_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_048482896.1|119524_120583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047340300.1|120809_122228_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_041183541.1|122268_123246_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_154235676.1|124606_126088_-	MFS transporter	NA	NA	NA	NA	NA
WP_154235758.1|126429_129303_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041183539.1|129401_130865_+	MFS transporter	NA	NA	NA	NA	NA
WP_048482899.1|130920_131955_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_014505267.1|132439_132973_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_041183537.1|133056_133410_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_048482900.1|133517_134480_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014505263.1|134966_136805_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_076342458.1|136979_137246_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_014505260.1|137271_137817_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_014505259.1|138288_139599_+	MFS transporter	NA	NA	NA	NA	NA
WP_041183535.1|139737_140997_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_024711692.1|141429_141960_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014505254.1|143160_143928_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014505253.1|143959_145441_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014505252.1|145981_146869_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024711693.1|146966_148157_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
WP_014505249.1|148568_149081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014505244.1|150663_151647_-	oxidoreductase	NA	NA	NA	NA	NA
WP_024711697.1|151747_152824_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_014505242.1|153075_153939_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_014505241.1|153935_154724_+	CoA-transferase subunit beta	NA	NA	NA	NA	NA
WP_014505240.1|154720_155929_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_014505239.1|156007_156745_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_014505238.1|156749_157313_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_041183533.1|157812_159165_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_014505236.1|159175_159958_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_014505235.1|159983_160388_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014505234.1|161867_162728_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024711704.1|162875_163736_+	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_014505232.1|164012_164981_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048482903.1|165079_165304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041183840.1|167778_168159_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_048482904.1|168198_171891_+	avirulence protein	NA	NA	NA	NA	NA
WP_048482905.1|172606_173983_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_014502919.1|174077_175034_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_048482906.1|175115_176078_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_047340288.1|177219_179124_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_082350308.1|179384_179564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711823.1|179697_180165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048482907.1|180322_181282_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_014505215.1|181266_181884_+	YdcF family protein	NA	NA	NA	NA	NA
WP_014505214.1|181926_182346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482908.1|182598_183504_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.1	7.5e-37
WP_048482909.1|183752_184637_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_024711827.1|184700_185483_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041183838.1|185527_186289_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_048481624.1|186452_186827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505207.1|187018_188224_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_014505206.1|188315_189350_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_024711830.1|189393_190125_+	ComF family protein	NA	NA	NA	NA	NA
WP_048482910.1|190381_191287_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048482911.1|194852_198710_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_048482912.1|198706_200488_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_048482913.1|200663_203423_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.5	6.6e-145
WP_048482914.1|203505_204882_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
>prophage 3
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	306395	328425	4796527	transposase	Staphylococcus_prophage(50.0%)	11	NA	NA
WP_082350310.1|306395_307412_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	1.2e-48
WP_154235677.1|307670_308990_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|309126_310095_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144415683.1|310209_310737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502919.1|310817_311774_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_041183463.1|313231_313477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235724.1|313713_315033_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144415694.1|316343_316706_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_048482928.1|316764_320358_+	avirulence protein	NA	NA	NA	NA	NA
WP_014505110.1|322271_325766_+	TAL effector protein Tal11b	NA	NA	NA	NA	NA
WP_014505107.1|327468_328425_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	4.8e-42
>prophage 4
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	546896	735439	4796527	transposase,protease,tRNA	Staphylococcus_prophage(11.11%)	112	NA	NA
WP_014504888.1|546896_547460_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_048482970.1|547470_549963_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.5	1.3e-115
WP_048482971.1|551446_552157_-	PilA	NA	NA	NA	NA	NA
WP_003484452.1|552245_552719_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_048482972.1|552761_553904_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_024711281.1|553975_555112_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_014504882.1|555244_555757_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_014504881.1|556150_557074_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_014504880.1|557073_558387_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_014504879.1|558437_560159_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_014504878.1|560323_561601_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_014504877.1|561798_562623_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024711286.1|562623_563682_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_014504875.1|563847_565353_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044751426.1|565349_565859_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_048482973.1|565970_567104_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	1.0e-27
WP_014504872.1|567350_567872_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_041183493.1|568071_568986_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|569086_569527_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|569636_571511_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024711291.1|571703_572024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350453.1|572859_573042_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	48.4	1.9e-08
WP_048482975.1|575629_577867_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_014504865.1|578290_578980_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_144415692.1|581081_581249_+	SapC family protein	NA	NA	NA	NA	NA
WP_048482976.1|581238_582252_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014504858.1|583968_584979_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014504857.1|585377_586571_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014504856.1|586567_587314_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	4.0e-20
WP_014504855.1|587345_588947_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|589007_589208_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041183817.1|589204_589792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|590278_590551_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_014504852.1|590616_591606_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082356812.1|591689_592451_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_014504850.1|592553_593549_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	1.1e-25
WP_014504849.1|593566_594358_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053070536.1|594360_595110_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.0	3.6e-53
WP_048482978.1|595228_596167_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_154235682.1|598586_599906_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_048483912.1|600055_601039_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.0e-95
WP_048482981.1|601241_601583_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024712744.1|601733_602030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712639.1|602071_602383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235683.1|602456_603698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482983.1|603694_604576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350320.1|604550_605345_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048483914.1|605357_606665_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014504839.1|606661_607909_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014504831.1|609715_610993_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_014501268.1|611254_612211_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_012444053.1|612635_612920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350321.1|613434_614811_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_082350322.1|615631_616471_-	3'-5' exonuclease	NA	O64348	Escherichia_phage	31.2	2.1e-09
WP_011258802.1|617815_618784_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_048482986.1|619010_620387_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	1.1e-79
WP_154292311.1|620523_621843_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041183807.1|625095_626838_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_082350474.1|626859_639576_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.8	1.3e-38
WP_082350324.1|639580_640084_+	DUF1436 family protein	NA	NA	NA	NA	NA
WP_053070538.1|640500_644919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482991.1|644920_645253_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_048482992.1|645396_645660_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082350455.1|646115_652334_+	filamentous hemagglutinin	NA	NA	NA	NA	NA
WP_149621897.1|652477_652942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501268.1|653218_654175_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_041183485.1|658104_658401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482995.1|658636_659539_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	1.4e-38
WP_082350325.1|659645_661022_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	2.4e-79
WP_154235684.1|661491_662592_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.1e-39
WP_041183606.1|662792_663389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501792.1|663735_665319_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_014501793.1|665710_665902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048482998.1|668418_670743_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_014501802.1|672673_673765_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041183607.1|674726_675605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501804.1|675793_676678_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014501805.1|676953_678726_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_048483000.1|680758_681721_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014501811.1|683738_685115_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_048483003.1|685201_686197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483004.1|686442_687354_+	magnesium transporter	NA	NA	NA	NA	NA
WP_154235685.1|687481_688279_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014501818.1|688741_689026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501819.1|689356_689809_+	autotransporter	NA	NA	NA	NA	NA
WP_014501821.1|690354_692028_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_041183061.1|692281_693067_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_041183062.1|694310_695306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501826.1|695344_696274_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_014501827.1|696831_699711_-	insulinase family protein	NA	NA	NA	NA	NA
WP_048484489.1|699966_702549_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.0	5.5e-08
WP_014501836.1|707264_708752_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	3.2e-125
WP_024711090.1|710146_711796_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_014501840.1|712798_714736_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_014501841.1|714887_715556_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024711087.1|715560_716613_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_014501843.1|716643_717381_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024711085.1|717411_718326_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024711084.1|718876_719677_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_014501846.1|720239_721205_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024711083.1|721555_722125_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_014501848.1|722510_722822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501849.1|722889_724983_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024711081.1|725791_726991_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_044751800.1|727100_729236_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.0	1.6e-29
WP_047340434.1|729579_729978_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
WP_014501855.1|730035_730278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711078.1|730267_731122_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082348173.1|731109_731790_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024711077.1|731983_732901_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	2.2e-12
WP_014501859.1|733416_733968_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014501860.1|734071_735439_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.0	6.2e-43
>prophage 5
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	1321589	1376867	4796527	transposase,plate	uncultured_Caudovirales_phage(40.0%)	41	NA	NA
WP_048483955.1|1321589_1322126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048483118.1|1322406_1323138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502380.1|1323337_1324216_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	5.1e-06
WP_014502381.1|1324326_1324587_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014502382.1|1324646_1326128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502383.1|1326143_1329881_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011259979.1|1329877_1330861_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_033004820.1|1330857_1331652_+	OmpA family protein	NA	NA	NA	NA	NA
WP_041183119.1|1331704_1332778_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_041183120.1|1333280_1333601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483119.1|1333722_1336545_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.8	3.2e-54
WP_048483120.1|1336599_1337460_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080496263.1|1337420_1338107_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_048483121.1|1338096_1339509_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082350348.1|1339590_1341939_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	6.7e-37
WP_048483123.1|1341938_1342835_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011259972.1|1342831_1343296_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_048483957.1|1343319_1343799_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_113255714.1|1343795_1344119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076342639.1|1344115_1344580_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082350456.1|1344603_1345083_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_133260575.1|1347467_1348070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048484507.1|1348549_1349926_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_053070568.1|1350041_1351754_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_094187774.1|1353186_1354289_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_153296765.1|1354379_1355108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483125.1|1355104_1358146_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_048483126.1|1358170_1360708_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_041183650.1|1360718_1361507_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_048483127.1|1362491_1363571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082350349.1|1363567_1365055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235764.1|1365114_1367844_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_041183650.1|1367950_1368739_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1368738_1370073_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014502418.1|1370224_1370833_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033005590.1|1371218_1371707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1371753_1372254_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_014502419.1|1372257_1373754_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1373895_1374393_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259942.1|1374540_1375029_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014502420.1|1375031_1376867_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 6
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	1610969	1691932	4796527	transposase,protease,tRNA	Bacillus_phage(25.0%)	60	NA	NA
WP_014501268.1|1610969_1611926_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_048483193.1|1612253_1614635_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_048483973.1|1615024_1617097_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014502643.1|1617259_1617670_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_014502644.1|1617969_1618152_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_014502645.1|1618294_1619335_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024712477.1|1619407_1620853_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	6.4e-14
WP_041183157.1|1622507_1623053_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	50.6	1.6e-13
WP_108744420.1|1624720_1625026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483194.1|1625102_1625345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483195.1|1625759_1626293_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|1626318_1626720_+	membrane protein	NA	NA	NA	NA	NA
WP_048483975.1|1627086_1627317_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_048483196.1|1628684_1630589_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.3e-59
WP_048483976.1|1630851_1633257_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	5.6e-15
WP_048483197.1|1633399_1634122_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_024710714.1|1634309_1635257_-	DMT family transporter	NA	NA	NA	NA	NA
WP_041183665.1|1635653_1636487_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_048483198.1|1637059_1637560_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_048483977.1|1637612_1639178_+	serine hydrolase	NA	NA	NA	NA	NA
WP_014502666.1|1639324_1640581_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1640648_1641842_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_048483199.1|1641838_1642528_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_048483200.1|1642633_1644103_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1644122_1644959_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_041183161.1|1644984_1646088_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014502669.1|1646084_1649141_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014502670.1|1649206_1649803_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_048483201.1|1649970_1651803_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	1.9e-31
WP_048483202.1|1652123_1653929_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_014502673.1|1654161_1654518_+	aldehyde-activating protein	NA	NA	NA	NA	NA
WP_014502674.1|1654514_1655279_+	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_014502675.1|1655288_1656305_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.5	5.6e-49
WP_041183163.1|1656596_1656890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082348501.1|1656968_1657382_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_044750620.1|1658120_1659134_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1659167_1659401_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_041183164.1|1659875_1660169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502687.1|1661144_1662002_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_019301039.1|1662206_1662818_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_014502689.1|1662890_1665533_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	5.5e-173
WP_041183165.1|1666047_1666683_+	lipoprotein	NA	NA	NA	NA	NA
WP_014502691.1|1666705_1667734_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_048483203.1|1667730_1668630_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1668686_1669103_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_014502694.1|1669114_1670230_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011409102.1|1671104_1671575_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_048483205.1|1672011_1672695_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_048483206.1|1673005_1676119_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014502697.1|1676585_1677320_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_014502698.1|1677458_1678031_+	Maf-like protein	NA	NA	NA	NA	NA
WP_014502699.1|1678030_1679530_+	ribonuclease G	NA	NA	NA	NA	NA
WP_048483207.1|1679670_1683591_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_041183668.1|1683596_1684349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483208.1|1684447_1685893_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_014502703.1|1686149_1686731_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_014502704.1|1686876_1688244_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_154235697.1|1688240_1688669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482877.1|1688989_1690366_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	9.2e-79
WP_014502709.1|1690834_1691932_-|protease	protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	1746154	1753753	4796527	transposase	Acidithiobacillus_phage(16.67%)	6	NA	NA
WP_154235700.1|1746154_1747696_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.4	6.7e-78
WP_048483223.1|1747750_1748650_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	9.5e-08
WP_024711757.1|1748891_1750661_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	4.0e-58
WP_154235701.1|1750657_1751251_-	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	1.4e-15
WP_048483225.1|1751517_1752111_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.7e-11
WP_014502759.1|1752316_1753753_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
>prophage 8
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	1835663	1868386	4796527	transposase,tRNA	Ralstonia_phage(27.27%)	27	NA	NA
WP_044750215.1|1835663_1837058_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	2.0e-81
WP_012444809.1|1837262_1837601_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_014502841.1|1837955_1838387_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005991243.1|1838398_1838629_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014502842.1|1838890_1839340_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_048484513.1|1839549_1843053_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_048484514.1|1843109_1843841_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_048483982.1|1844696_1847222_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	39.5	9.8e-119
WP_024712508.1|1847218_1848181_+	EF-P lysine aminoacylase GenX	NA	A0A1V0SAC0	Catovirus	26.5	3.0e-20
WP_014502847.1|1848290_1848977_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_014502848.1|1849179_1850244_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_048483241.1|1850453_1853150_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.2	5.7e-109
WP_082350358.1|1853484_1854861_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_154235702.1|1854826_1855165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235703.1|1855282_1855885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483243.1|1855881_1856247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483244.1|1856365_1857322_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	9.6e-43
WP_082348294.1|1857359_1858193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483245.1|1858359_1859736_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_048483983.1|1859761_1860241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1860447_1861416_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_048483247.1|1861743_1863120_+|transposase	IS5-like element ISXo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	1.2e-78
WP_041183337.1|1863568_1864585_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503740.1|1865190_1865538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483249.1|1865547_1866396_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	32.6	3.2e-05
WP_108744427.1|1866832_1867090_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_014501421.1|1867417_1868386_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 9
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	1949398	1958311	4796527	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_041183723.1|1949398_1951075_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.5	2.5e-38
WP_010365714.1|1951163_1951805_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_014503651.1|1951977_1953012_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	3.6e-112
WP_014503650.1|1953313_1953802_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_014503649.1|1953903_1956552_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	9.7e-85
WP_003481884.1|1956691_1956904_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_108744361.1|1957339_1958311_+	hypothetical protein	NA	O80281	Escherichia_phage	40.3	8.3e-26
>prophage 10
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	2079921	2172684	4796527	transposase	Acidithiobacillus_phage(16.67%)	57	NA	NA
WP_048484507.1|2079921_2081298_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_014501268.1|2081488_2082445_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_053070547.1|2082519_2083215_-	hypothetical protein	NA	A0A1B1P9F9	Acinetobacter_phage	45.2	2.2e-44
WP_014503517.1|2084990_2085452_-	cytochrome c	NA	NA	NA	NA	NA
WP_041183307.1|2085460_2085853_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_154235768.1|2086075_2087191_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041183306.1|2087187_2090700_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.2	6.8e-110
WP_048483286.1|2090696_2093765_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_082350366.1|2093831_2094848_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	4.7e-48
WP_048483287.1|2096132_2096792_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_014503510.1|2096844_2098761_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_014503509.1|2098863_2099583_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_014503508.1|2099579_2100587_-	glucokinase	NA	NA	NA	NA	NA
WP_014503507.1|2100583_2102014_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	33.9	2.4e-66
WP_014503506.1|2102436_2103534_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	1.3e-22
WP_014503505.1|2103662_2104535_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_080344391.1|2104478_2104745_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_014503504.1|2104804_2105200_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_014503503.1|2105196_2105583_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_014503502.1|2105616_2107407_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_014503501.1|2107410_2107620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007963513.1|2107636_2108419_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2108529_2108778_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_048483288.1|2108728_2109181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712197.1|2109204_2110446_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048483289.1|2110438_2111173_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_014503498.1|2111197_2111395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483290.1|2112758_2115167_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_014503494.1|2115195_2115858_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_014503493.1|2115861_2116326_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014503492.1|2116322_2118092_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	7.2e-52
WP_048483291.1|2118088_2119129_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_048483292.1|2119420_2120200_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014503489.1|2120196_2120661_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_082352843.1|2120603_2122103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503487.1|2122099_2123956_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_014503486.1|2123955_2124588_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_154235709.1|2127371_2128691_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296772.1|2129352_2129496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483294.1|2129509_2130472_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_048484521.1|2130773_2140358_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.7	6.9e-56
WP_082350369.1|2140354_2151979_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.3	1.1e-151
WP_041183711.1|2152188_2152959_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_014503478.1|2153328_2154621_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_014503477.1|2154604_2155867_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_014503476.1|2155878_2156310_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014503475.1|2156368_2156734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503474.1|2156833_2157595_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_014503473.1|2157816_2158464_+	response regulator	NA	NA	NA	NA	NA
WP_048483296.1|2159058_2162769_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014503471.1|2163179_2164166_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_048483999.1|2164198_2165995_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_014503468.1|2166866_2167289_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_014503467.1|2167285_2167642_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|2167730_2168330_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_048483297.1|2168343_2170167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483298.1|2171307_2172684_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.4	6.0e-78
>prophage 11
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	2184936	2272832	4796527	plate,transposase	Xanthomonas_phage(35.29%)	52	NA	NA
WP_011259603.1|2184936_2185440_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_048483304.1|2185443_2187321_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014503449.1|2187284_2188295_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_048483305.1|2188327_2191033_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.7	3.3e-80
WP_048484000.1|2191532_2191718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235710.1|2191783_2192278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183297.1|2192679_2193138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183296.1|2193401_2195339_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	2.6e-39
WP_048483307.1|2195347_2195887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484523.1|2195883_2197320_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_014503442.1|2197316_2198654_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_048483309.1|2198655_2199972_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_048483310.1|2199975_2203434_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_048483311.1|2203430_2204078_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_014503438.1|2204074_2204797_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_048483312.1|2204793_2207697_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_014503436.1|2207693_2208020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183293.1|2208192_2209221_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_014503435.1|2209229_2210210_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047339868.1|2210323_2212783_-	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_014503433.1|2212779_2213772_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_033004902.1|2213768_2214476_-	response regulator	NA	NA	NA	NA	NA
WP_014503426.1|2217373_2220454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483313.1|2220860_2221952_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048483314.1|2222327_2224415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503422.1|2225910_2226489_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048483316.1|2226613_2227726_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014503420.1|2227777_2230903_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_047339861.1|2233810_2233996_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	98.4	5.4e-27
WP_047339860.1|2233995_2234232_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	93.2	1.4e-27
WP_047340495.1|2234279_2235386_+	replication protein	NA	S0F3I3	Stenotrophomonas_phage	74.3	1.1e-159
WP_047339859.1|2235382_2235676_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	53.1	9.2e-21
WP_011408495.1|2235916_2236156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047339857.1|2236292_2237756_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.6	1.9e-50
WP_047339856.1|2237757_2238078_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_047339855.1|2238074_2239259_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.6	6.1e-55
WP_080344434.1|2239313_2239484_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	5.5e-10
WP_075240058.1|2239547_2239949_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
WP_075240059.1|2240592_2240853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503417.1|2241436_2242123_+	hypothetical protein	NA	A0A2K9R7I4	Dishui_lake_phycodnavirus	28.0	8.8e-06
WP_108744471.1|2243393_2244458_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011258802.1|2246537_2247506_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082350371.1|2247568_2247751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082350366.1|2247796_2248813_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	4.7e-48
WP_048483320.1|2250026_2251403_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.2e-78
WP_082350461.1|2253288_2254026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483321.1|2254043_2256884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483322.1|2257614_2261103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501268.1|2262623_2263580_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_048483324.1|2264666_2268773_-	avirulence protein	NA	NA	NA	NA	NA
WP_144406543.1|2269533_2270853_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2271863_2272832_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 12
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	2935309	3044637	4796527	tRNA,head,terminase,plate,integrase,transposase,capsid,tail,portal,holin	Stenotrophomonas_phage(46.67%)	104	2979246:2979292	3021342:3021388
WP_014502854.1|2935309_2937688_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_048483430.1|2937803_2938799_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	8.0e-32
WP_003484828.1|2939053_2939413_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002811096.1|2939423_2939621_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080098376.1|2939868_2940411_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_024712035.1|2940459_2942364_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	3.4e-124
WP_048483431.1|2943455_2944832_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_154235722.1|2945088_2945547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483432.1|2945687_2947064_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_024712336.1|2947749_2949030_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	1.3e-98
WP_082348452.1|2949049_2949802_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024712337.1|2950162_2950630_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014503746.1|2951127_2952441_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_014503747.1|2952562_2953771_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_014503748.1|2953853_2954939_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.0	3.7e-75
WP_014503749.1|2955113_2956082_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_041183338.1|2956381_2957038_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_048484050.1|2956979_2957792_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_014503751.1|2958022_2958298_+	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_014503752.1|2958459_2959023_+	phasin family protein	NA	NA	NA	NA	NA
WP_048483433.1|2959589_2960600_+	membrane protein	NA	NA	NA	NA	NA
WP_014503754.1|2960756_2961494_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_048483434.1|2961818_2963189_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_041183340.1|2963249_2964455_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_014503757.1|2964468_2966010_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.9	3.5e-79
WP_014503758.1|2966194_2967052_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_014503759.1|2967068_2968736_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_048483435.1|2969095_2970190_+	acyltransferase	NA	NA	NA	NA	NA
WP_014503761.1|2970319_2971048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483436.1|2971407_2974902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154292365.1|2974974_2976076_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	2.6e-39
WP_014503764.1|2976496_2978518_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_041183342.1|2978656_2979199_+	fimbrial protein	NA	NA	NA	NA	NA
2979246:2979292	attL	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_080496013.1|2980272_2980572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048484628.1|2981140_2982124_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	8.2e-98
WP_048484534.1|2982197_2985032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048484535.1|2985028_2985958_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011409850.1|2987012_2987414_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_053070570.1|2987362_2987920_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
WP_041182345.1|2987900_2988242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350485.1|2988255_2988963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350486.1|2988959_2989706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484536.1|2989772_2990483_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.0	1.8e-107
WP_053503138.1|2990400_2990646_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_041182703.1|2990671_2991694_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	1.5e-139
WP_048484537.1|2991693_2993478_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.5	3.1e-268
WP_048484538.1|2993599_2994442_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	5.8e-68
WP_011258476.1|2994488_2995505_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	5.5e-137
WP_011258475.1|2995508_2996228_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_011408149.1|2996327_2996795_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	2.0e-30
WP_011258473.1|2996794_2997004_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
WP_048484539.1|2997008_2997365_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	53.5	1.5e-20
WP_041182057.1|2997357_2997633_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.9e-21
WP_132718347.1|2997629_2998271_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	61.5	9.3e-50
WP_048484541.1|2998270_2998759_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.4	7.1e-26
WP_011408144.1|2998755_2999175_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	1.4e-38
WP_048484542.1|2999162_2999609_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	58.8	2.3e-39
WP_082350487.1|2999860_3001114_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_048484543.1|3001218_3002109_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	2.6e-82
WP_048484544.1|3002101_3002647_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.1	3.2e-51
WP_048484545.1|3002656_3004162_+|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.2	2.3e-54
WP_048484546.1|3004169_3004748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484547.1|3004808_3005372_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.3	6.3e-26
WP_011258460.1|3005368_3005728_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	1.2e-35
WP_011258459.1|3005739_3006906_+|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_011258458.1|3006936_3007446_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_048484548.1|3007491_3007794_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	65.2	2.2e-25
WP_011258456.1|3007802_3007916_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_048484549.1|3007948_3010819_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	48.9	4.6e-205
WP_047339969.1|3010831_3011233_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.9	1.0e-38
WP_047339970.1|3011229_3012216_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.5	1.4e-92
WP_047339971.1|3012824_3013256_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	36.4	4.4e-11
WP_080344395.1|3013327_3013588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182927.1|3013590_3013908_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	59.8	3.9e-25
WP_047339972.1|3013920_3014199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113279671.1|3014440_3017101_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	70.5	0.0e+00
WP_048484550.1|3017424_3017643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484551.1|3017639_3017918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047339974.1|3017907_3018180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143703407.1|3018370_3018679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484553.1|3018840_3019113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|3019109_3019334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057781.1|3019399_3019603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484554.1|3020023_3021265_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.9	4.8e-119
WP_014503765.1|3021471_3021927_-	type IV pilin protein	NA	NA	NA	NA	NA
3021342:3021388	attR	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_048483469.1|3021933_3025917_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_014503767.1|3025873_3026383_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_041183344.1|3026386_3027553_-	PilW family protein	NA	NA	NA	NA	NA
WP_024710847.1|3027549_3028026_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_014503769.1|3028022_3028538_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	43.8	3.9e-06
WP_014503770.1|3028707_3030093_-	LOG family protein	NA	NA	NA	NA	NA
WP_024710846.1|3030199_3033394_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014503772.1|3034164_3034764_-	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_014503773.1|3034760_3035504_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259726.1|3035500_3035821_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_014503774.1|3035959_3036538_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	1.4e-33
WP_014503775.1|3036679_3037825_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_014503776.1|3037821_3038325_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	6.2e-17
WP_014503777.1|3038383_3038653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024710844.1|3038649_3039537_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024710843.1|3039600_3040641_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_014503780.1|3041012_3043127_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_014503782.1|3043293_3043554_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_014503783.1|3043710_3044637_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	3082098	3152820	4796527	transposase,protease,tRNA	Bacillus_phage(16.67%)	60	NA	NA
WP_014503812.1|3082098_3082872_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_154292367.1|3083447_3085493_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3086059_3087085_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024710824.1|3087169_3088243_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	24.1	9.5e-15
WP_044750596.1|3088235_3089339_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	41.0	5.5e-74
WP_014503818.1|3089349_3090276_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014503819.1|3090356_3091007_+	SCO family protein	NA	NA	NA	NA	NA
WP_014503820.1|3091003_3091852_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041183350.1|3092394_3093978_-	transglycosylase SLT domain-containing protein	NA	I1VXB7	Halocynthia_phage	31.2	4.7e-10
WP_014503823.1|3094272_3095778_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.4	7.2e-85
WP_154292368.1|3098702_3099805_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.7	4.4e-39
WP_082350489.1|3099704_3101111_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_076342653.1|3101161_3101734_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_153296773.1|3101730_3101904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484565.1|3101956_3102913_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	2.8e-42
WP_082350490.1|3102896_3103091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154292370.1|3103485_3104452_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	2.5e-99
WP_154292372.1|3104454_3104637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503833.1|3104633_3105998_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_014503834.1|3106179_3106842_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_048484566.1|3106838_3107273_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3107300_3107468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711437.1|3108039_3108225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3108259_3108829_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_044750158.1|3108924_3109776_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_014503839.1|3110368_3110617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711434.1|3110815_3112471_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	4.6e-16
WP_024711433.1|3112667_3112901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711432.1|3113067_3114042_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.4	2.9e-18
WP_082348227.1|3115442_3115829_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014503846.1|3115926_3116652_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_154292374.1|3117068_3118523_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	2.3e-48
WP_014503850.1|3118589_3120020_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_047339990.1|3120240_3120795_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.7	4.3e-19
WP_014503852.1|3121011_3122952_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	2.0e-26
WP_044750152.1|3123127_3123766_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033004953.1|3126517_3127681_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_014503857.1|3127838_3128630_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444391.1|3128775_3128991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503858.1|3128990_3129758_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_044750150.1|3129819_3130650_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_014503860.1|3130722_3131151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503861.1|3131282_3131762_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_014503862.1|3132011_3132227_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_048484569.1|3132454_3132940_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_041183354.1|3134597_3135731_+	phospholipase A	NA	NA	NA	NA	NA
WP_033004945.1|3136163_3136616_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_048484572.1|3136934_3138452_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024711418.1|3138791_3140672_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.5	8.0e-25
WP_048484573.1|3140874_3141654_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024711416.1|3141804_3142290_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	3.6e-14
WP_024711415.1|3144747_3144987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048484632.1|3146058_3147159_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_154292376.1|3147576_3148374_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048484633.1|3148989_3149568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183355.1|3149659_3150160_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503883.1|3150226_3151060_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_048481690.1|3151110_3151425_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|3151608_3151797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3152211_3152820_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 14
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	3677074	3702161	4796527	transposase	Ralstonia_phage(25.0%)	13	NA	NA
WP_154235735.1|3677074_3678058_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.4	2.8e-77
WP_014502675.1|3683341_3684358_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.5	5.6e-49
WP_044749647.1|3684627_3686004_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_154235736.1|3686317_3687419_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	8.8e-40
WP_014504332.1|3689471_3689867_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082353004.1|3689965_3691123_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003490678.1|3691292_3691970_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_048484089.1|3692047_3692437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712565.1|3692649_3693537_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	31.7	6.6e-30
WP_014504336.1|3694041_3696174_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011409118.1|3698604_3698997_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_048483031.1|3699566_3700535_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_014501268.1|3701204_3702161_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
>prophage 15
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	4027805	4034177	4796527		Enterobacteria_phage(50.0%)	6	NA	NA
WP_014504627.1|4027805_4029152_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.0e-33
WP_014504628.1|4029199_4030603_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.8	3.8e-48
WP_014504629.1|4030719_4031628_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	1.8e-27
WP_048483657.1|4031624_4032182_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	6.6e-44
WP_014504631.1|4032178_4033066_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	2.0e-95
WP_014504632.1|4033121_4034177_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.7	1.2e-83
>prophage 16
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	4328492	4417663	4796527	transposase,tRNA	Ralstonia_phage(21.43%)	60	NA	NA
WP_014501701.1|4328492_4329704_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014501700.1|4329874_4331293_+	M23 family metallopeptidase	NA	A0A222ZJ66	Rhodococcus_phage	32.9	2.2e-11
WP_014501699.1|4331544_4331703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712514.1|4331663_4332797_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_014501697.1|4332834_4333062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082352926.1|4333120_4334341_-	MFS transporter	NA	NA	NA	NA	NA
WP_014501695.1|4334734_4335535_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	5.2e-26
WP_048483738.1|4339722_4341318_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501690.1|4341417_4341903_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_048483739.1|4342448_4345277_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_014501687.1|4345276_4345651_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_014501686.1|4345647_4347192_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_014501685.1|4347188_4347695_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_014501684.1|4347691_4347976_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_048483741.1|4347972_4348326_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_082350429.1|4348722_4349112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501682.1|4349537_4350863_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_082348398.1|4352637_4353708_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_019301451.1|4353875_4354364_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014501678.1|4354719_4355310_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014501677.1|4355321_4356830_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.7	1.2e-63
WP_014501676.1|4357272_4358166_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_024712412.1|4360258_4361347_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_082352925.1|4361426_4362410_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_048483743.1|4362411_4362795_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_014501671.1|4362791_4364303_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_014501670.1|4364356_4364599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041183049.1|4364540_4364864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501668.1|4365358_4366300_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.7	6.3e-87
WP_048482872.1|4366581_4367550_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_048483748.1|4368298_4369588_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.3e-39
WP_014501665.1|4370027_4370363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501664.1|4370637_4371069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483750.1|4371237_4372194_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.3e-42
WP_041183047.1|4372475_4373885_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_048483758.1|4377403_4380388_+	avirulence protein	NA	NA	NA	NA	NA
WP_014501656.1|4380521_4383809_+	TAL effector protein Tal1c	NA	NA	NA	NA	NA
WP_144415627.1|4383901_4385003_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.7e-38
WP_011257407.1|4385279_4385606_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_041183041.1|4385577_4386072_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	4.7e-17
WP_041183040.1|4386091_4387075_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_014501653.1|4387120_4388164_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.7	5.6e-153
WP_014501652.1|4388341_4390840_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	8.3e-304
WP_024712256.1|4391453_4392497_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	2.2e-80
WP_014501648.1|4392603_4395312_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014501647.1|4395598_4396213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4396284_4397652_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014501646.1|4398333_4400157_+	potassium transporter	NA	NA	NA	NA	NA
WP_041183038.1|4400918_4401575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082350431.1|4402102_4402732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483760.1|4403126_4404095_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_154235749.1|4404227_4406171_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_014501640.1|4407883_4408213_-	phosphatase	NA	NA	NA	NA	NA
WP_041183036.1|4408239_4411560_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_041183594.1|4411552_4411813_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_048483764.1|4412031_4413231_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_014501636.1|4413230_4414004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483766.1|4414000_4414822_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024712380.1|4414818_4416441_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_048483768.1|4416700_4417663_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	4500132	4548694	4796527	transposase,tRNA,holin	Ralstonia_phage(33.33%)	44	NA	NA
WP_144415626.1|4500132_4501452_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041183585.1|4501548_4502025_-|transposase	IS200/IS605 family transposase	transposase	A0A1L2BWN1	Bacteriophage	31.1	1.7e-08
WP_048483797.1|4502581_4504744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483798.1|4504864_4507033_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_153296761.1|4507438_4507639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501549.1|4507668_4508298_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|4508300_4508732_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_047339459.1|4508788_4509367_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_048483802.1|4509462_4510215_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_014501544.1|4510912_4511302_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014501543.1|4511416_4513090_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A9YVW0	Ostreococcus_tauri_virus	29.6	6.2e-29
WP_014501542.1|4513086_4513731_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_014501540.1|4513965_4515069_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003468167.1|4515669_4515828_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_014501538.1|4515893_4516904_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	9.9e-14
WP_014501537.1|4517132_4518803_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_010370556.1|4519131_4519515_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_014501536.1|4519736_4520639_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014501535.1|4520779_4521898_-	Fic family protein	NA	NA	NA	NA	NA
WP_014501534.1|4522069_4523086_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|4523187_4523508_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_014501533.1|4523892_4524342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501532.1|4524368_4524845_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014501531.1|4525186_4526410_-	MFS transporter	NA	NA	NA	NA	NA
WP_014501530.1|4526514_4527126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501529.1|4527346_4528096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501528.1|4528286_4529633_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_014501527.1|4529617_4531060_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014501526.1|4531109_4532837_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_024712156.1|4533195_4533792_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_024712157.1|4534114_4535140_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014501523.1|4535155_4535668_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_014501522.1|4535777_4536212_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014501521.1|4536287_4536710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712159.1|4536738_4537209_-	thioesterase	NA	NA	NA	NA	NA
WP_014501519.1|4537479_4538289_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_082350436.1|4538464_4539268_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014501517.1|4539371_4540349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501516.1|4540345_4541611_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_014501512.1|4542651_4543947_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_082352787.1|4544015_4544921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501421.1|4545419_4546388_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_014504829.1|4546579_4547548_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082350366.1|4547677_4548694_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	4.7e-48
>prophage 18
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	4612158	4661791	4796527	transposase,protease	Acidithiobacillus_phage(25.0%)	35	NA	NA
WP_048483823.1|4612158_4613535_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_048483825.1|4614072_4615449_-|transposase	IS5-like element ISXo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_048483826.1|4615634_4616603_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_154235752.1|4616748_4617057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264755.1|4617090_4617477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501450.1|4617606_4617885_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_014501448.1|4626604_4628509_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	2.3e-19
WP_014501447.1|4628505_4629108_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_014501446.1|4629208_4630474_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_014501445.1|4631021_4633184_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_014501443.1|4633477_4633684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076342453.1|4633891_4634281_-	YchJ family protein	NA	NA	NA	NA	NA
WP_154235779.1|4634344_4635202_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_048483830.1|4635314_4636496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501439.1|4636593_4640022_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014501438.1|4640169_4640868_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_014501437.1|4640851_4642324_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_014501436.1|4642320_4642908_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_014501434.1|4643302_4643932_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	1.9e-47
WP_048481578.1|4644032_4644524_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053070560.1|4644875_4645403_+	TolC family protein	NA	NA	NA	NA	NA
WP_014501428.1|4646243_4647605_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	6.4e-32
WP_048484122.1|4649082_4649589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501423.1|4649862_4650069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501422.1|4650055_4651168_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014501268.1|4651705_4652662_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_014502919.1|4653394_4654351_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_014501419.1|4654571_4655021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082352784.1|4655145_4655403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501416.1|4656044_4656233_-	CsbD family protein	NA	NA	NA	NA	NA
WP_048484125.1|4656474_4657644_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_154235780.1|4657939_4658422_+	ATPase	NA	NA	NA	NA	NA
WP_014501410.1|4658982_4660056_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501408.1|4660458_4660929_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_033005488.1|4661299_4661791_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 19
NZ_CP011960	Xanthomonas oryzae pv. oryzicola strain L8, complete genome	4796527	4667853	4713593	4796527	transposase	Staphylococcus_prophage(22.22%)	27	NA	NA
WP_154292385.1|4667853_4668955_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	9.1e-37
WP_014501397.1|4669301_4670324_+	sugar kinase	NA	NA	NA	NA	NA
WP_048483835.1|4670954_4672163_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_048483836.1|4672583_4673540_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	1.1e-41
WP_048483839.1|4675582_4676149_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_014501387.1|4676295_4677462_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_014501668.1|4677509_4678451_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.7	6.3e-87
WP_048483840.1|4678475_4679072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235754.1|4679761_4681957_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	41.2	6.4e-66
WP_014501384.1|4682055_4683258_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_014501382.1|4683528_4684539_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	1.0e-47
WP_048483843.1|4684674_4685640_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014501379.1|4686429_4686660_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014501378.1|4686726_4687389_-	hemolysin III	NA	NA	NA	NA	NA
WP_082352916.1|4687652_4690061_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.1e-07
WP_048484613.1|4690057_4691902_+	exonuclease	NA	NA	NA	NA	NA
WP_048483845.1|4692376_4694521_-	avirulence protein	NA	NA	NA	NA	NA
WP_014501372.1|4694711_4695869_-	ROK family protein	NA	NA	NA	NA	NA
WP_014501371.1|4696041_4698630_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014501370.1|4698640_4699426_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_041182996.1|4702035_4702341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182995.1|4702558_4703818_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	7.0e-41
WP_011257161.1|4703875_4704256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501364.1|4704457_4708930_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_048483846.1|4709124_4710606_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_048483847.1|4711041_4711998_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.3e-42
WP_048483849.1|4712216_4713593_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	6.6e-77
