The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	7559	45684	4794316	transposase,protease	Ralstonia_phage(12.5%)	31	NA	NA
WP_024711641.1|7559_8396_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014501262.1|8582_9389_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501263.1|9665_10859_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_048482871.1|11012_11681_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11765_12527_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12573_12996_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|12999_13413_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014501266.1|13708_14476_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14486_14756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501267.1|14830_16291_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_048482872.1|16695_17664_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_048482873.1|18159_19116_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	1.1e-41
WP_048482874.1|20521_21580_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_014501292.1|21889_22963_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_041182980.1|23716_24769_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_014501295.1|25554_26685_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_041182981.1|27211_27562_+	peptidase	NA	NA	NA	NA	NA
WP_048482875.1|27709_29521_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_041182982.1|29687_30344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182983.1|30503_31739_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_048482876.1|31843_33373_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.9	2.2e-25
WP_014501302.1|33539_34532_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	30.1	1.1e-09
WP_008572943.1|34531_34852_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_010364746.1|34968_35661_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014501304.1|35879_37229_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_154235674.1|37562_38357_+	2OG-Fe(II) oxygenase	NA	A0A0E3ESN0	Synechococcus_phage	42.9	8.6e-13
WP_014501306.1|38373_39501_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_048482877.1|39631_41008_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	9.2e-79
WP_144406577.1|41210_42530_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014501309.1|42751_43567_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	2.8e-19
WP_154235675.1|44885_45684_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	117775	204878	4794316	transposase,tRNA	Acidithiobacillus_phage(50.0%)	60	NA	NA
WP_048483489.1|117775_119152_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_048482896.1|119521_120580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047340300.1|120806_122225_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_041183541.1|122265_123243_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_154235676.1|124603_126085_-	MFS transporter	NA	NA	NA	NA	NA
WP_154235758.1|126426_129300_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041183539.1|129398_130862_+	MFS transporter	NA	NA	NA	NA	NA
WP_048482899.1|130917_131952_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_014505267.1|132436_132970_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_041183537.1|133053_133407_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_048482900.1|133514_134477_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014505263.1|134963_136802_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_076342458.1|136976_137243_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_014505260.1|137268_137814_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_014505259.1|138285_139596_+	MFS transporter	NA	NA	NA	NA	NA
WP_041183535.1|139734_140994_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_024711692.1|141426_141957_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014505254.1|143157_143925_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014505253.1|143956_145438_+	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014505252.1|145978_146866_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024711693.1|146963_148154_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
WP_014505249.1|148565_149078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014505244.1|150660_151644_-	oxidoreductase	NA	NA	NA	NA	NA
WP_024711697.1|151744_152821_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_014505242.1|153072_153936_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_014505241.1|153932_154721_+	CoA-transferase subunit beta	NA	NA	NA	NA	NA
WP_014505240.1|154717_155926_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_014505239.1|156004_156742_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_014505238.1|156746_157310_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_041183533.1|157809_159162_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_014505236.1|159172_159955_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_014505235.1|159980_160385_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014505234.1|161864_162725_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024711704.1|162872_163733_+	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_014505232.1|164009_164978_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048482903.1|165076_165301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041183840.1|167775_168156_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_048482904.1|168195_171888_+	avirulence protein	NA	NA	NA	NA	NA
WP_048482905.1|172603_173980_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_014502919.1|174074_175031_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_048482906.1|175112_176075_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_047340288.1|177216_179121_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_082350308.1|179381_179561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711823.1|179694_180162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048482907.1|180319_181279_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_014505215.1|181263_181881_+	YdcF family protein	NA	NA	NA	NA	NA
WP_014505214.1|181923_182343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482908.1|182595_183501_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.1	7.5e-37
WP_048482909.1|183749_184634_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_024711827.1|184697_185480_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041183838.1|185524_186286_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_048481624.1|186449_186824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505207.1|187015_188221_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_014505206.1|188312_189347_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_024711830.1|189390_190122_+	ComF family protein	NA	NA	NA	NA	NA
WP_048482910.1|190378_191284_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048482911.1|194848_198706_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_048482912.1|198702_200484_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_048482913.1|200659_203419_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.5	6.6e-145
WP_048482914.1|203501_204878_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
>prophage 3
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	306391	328421	4794316	transposase	Staphylococcus_prophage(50.0%)	11	NA	NA
WP_082350310.1|306391_307408_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	1.2e-48
WP_154235677.1|307666_308986_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|309122_310091_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144415683.1|310205_310733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502919.1|310813_311770_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_041183463.1|313227_313473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235724.1|313709_315029_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144415694.1|316339_316702_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_048482928.1|316760_320354_+	avirulence protein	NA	NA	NA	NA	NA
WP_014505110.1|322267_325762_+	TAL effector protein Tal11b	NA	NA	NA	NA	NA
WP_014505107.1|327464_328421_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	4.8e-42
>prophage 4
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	546885	735428	4794316	transposase,protease,tRNA	Staphylococcus_prophage(11.11%)	113	NA	NA
WP_014504888.1|546885_547449_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_048482970.1|547459_549952_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.5	1.3e-115
WP_048482971.1|551435_552146_-	PilA	NA	NA	NA	NA	NA
WP_003484452.1|552234_552708_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_048482972.1|552750_553893_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_024711281.1|553964_555101_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_014504882.1|555233_555746_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_014504881.1|556139_557063_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_014504880.1|557062_558376_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_014504879.1|558426_560148_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_014504878.1|560312_561590_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_014504877.1|561787_562612_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024711286.1|562612_563671_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_014504875.1|563836_565342_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044751426.1|565338_565848_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_048482973.1|565959_567093_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	1.0e-27
WP_014504872.1|567339_567861_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_041183493.1|568060_568975_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|569075_569516_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|569625_571500_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024711291.1|571692_572013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350453.1|572848_573031_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	48.4	1.9e-08
WP_048482975.1|575618_577856_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_014504865.1|578279_578969_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_144415692.1|581070_581238_+	SapC family protein	NA	NA	NA	NA	NA
WP_048482976.1|581227_582241_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014504858.1|583957_584968_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014504857.1|585366_586560_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014504856.1|586556_587303_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	4.0e-20
WP_014504855.1|587334_588936_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|588996_589197_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041183817.1|589193_589781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|590267_590540_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_014504852.1|590605_591595_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082356812.1|591678_592440_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_014504850.1|592542_593538_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	1.1e-25
WP_014504849.1|593555_594347_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053070536.1|594349_595099_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.0	3.6e-53
WP_048482978.1|595217_596156_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_154235682.1|598575_599895_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_048483912.1|600044_601028_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.0e-95
WP_048482981.1|601230_601572_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024712744.1|601722_602019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712639.1|602060_602372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235683.1|602445_603687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482983.1|603683_604565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350320.1|604539_605334_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048483914.1|605346_606654_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014504839.1|606650_607898_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014504831.1|609704_610982_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_014501268.1|611243_612200_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_012444053.1|612624_612909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350321.1|613423_614800_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_082350322.1|615620_616460_-	3'-5' exonuclease	NA	O64348	Escherichia_phage	31.2	2.1e-09
WP_011258802.1|617804_618773_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_048482986.1|618999_620376_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	1.1e-79
WP_154292311.1|620512_621832_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041183807.1|625085_626828_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_082350323.1|626849_639566_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.8	1.3e-38
WP_082350324.1|639570_640074_+	DUF1436 family protein	NA	NA	NA	NA	NA
WP_053070538.1|640490_644909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482991.1|644910_645243_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_048482992.1|645386_645650_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082350455.1|646105_652324_+	filamentous hemagglutinin	NA	NA	NA	NA	NA
WP_149621897.1|652467_652932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501268.1|653208_654165_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_041183485.1|658094_658391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482995.1|658626_659529_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	1.4e-38
WP_082350325.1|659635_661012_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	2.4e-79
WP_154235684.1|661481_662582_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.1e-39
WP_041183606.1|662782_663379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501792.1|663725_665309_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_014501793.1|665700_665892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048482998.1|668408_670733_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_014501802.1|672663_673755_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041183607.1|674716_675595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501804.1|675783_676668_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014501805.1|676943_678716_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_048483000.1|680748_681711_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014501811.1|683728_685105_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_048483003.1|685191_686187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483004.1|686432_687344_+	magnesium transporter	NA	NA	NA	NA	NA
WP_154235685.1|687471_688269_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014501818.1|688731_689016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501819.1|689346_689799_+	autotransporter	NA	NA	NA	NA	NA
WP_014501821.1|690344_692018_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_041183061.1|692271_693057_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_041183062.1|694300_695296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501826.1|695334_696264_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_014501827.1|696821_699701_-	insulinase family protein	NA	NA	NA	NA	NA
WP_048483006.1|699956_702539_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	2.5e-08
WP_014501832.1|705075_705306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501836.1|707254_708742_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	3.2e-125
WP_041183063.1|710136_711786_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_014501840.1|712788_714726_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_014501841.1|714877_715546_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024711087.1|715550_716603_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_014501843.1|716633_717371_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014501844.1|717401_718316_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014501845.1|718865_719666_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_048483007.1|720228_721194_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024711083.1|721544_722114_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_014501848.1|722499_722811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501849.1|722878_724972_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_048483008.1|725780_726980_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014501853.1|727089_729225_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.0	1.6e-29
WP_041183608.1|729568_729967_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
WP_014501855.1|730024_730267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183064.1|730256_731111_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082352795.1|731098_731779_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024711077.1|731972_732890_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	2.2e-12
WP_014501859.1|733405_733957_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014501860.1|734060_735428_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.0	6.2e-43
>prophage 5
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	1323747	1378561	4794316	transposase,plate	uncultured_Caudovirales_phage(40.0%)	41	NA	NA
WP_048483955.1|1323747_1324284_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048483118.1|1324564_1325296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502380.1|1325495_1326374_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	5.1e-06
WP_014502381.1|1326484_1326745_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014502382.1|1326804_1328286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502383.1|1328301_1332039_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011259979.1|1332035_1333019_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_033004820.1|1333015_1333810_+	OmpA family protein	NA	NA	NA	NA	NA
WP_041183119.1|1333862_1334936_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_041183120.1|1335438_1335759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483119.1|1335880_1338703_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.8	3.2e-54
WP_048483120.1|1338757_1339618_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_080496263.1|1339578_1340265_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_048483121.1|1340254_1341667_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082350348.1|1341748_1344097_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	6.7e-37
WP_048483123.1|1344096_1344993_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011259972.1|1344989_1345454_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_048483957.1|1345477_1345957_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_113255714.1|1345953_1346277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076342639.1|1346273_1346738_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082350456.1|1346761_1347241_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_133260575.1|1349625_1350228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053070543.1|1350224_1352393_-	M23 family metallopeptidase	NA	Q5ZGC9	Flavobacterium_phage	38.6	2.1e-16
WP_094187774.1|1353825_1354928_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_153296765.1|1355018_1355747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483125.1|1355743_1358785_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_048483126.1|1358809_1361347_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_041183650.1|1361357_1362146_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_048483127.1|1363130_1364210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082350349.1|1364206_1365694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235764.1|1365753_1368483_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_041183650.1|1368589_1369378_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1369377_1370712_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014502418.1|1370863_1371472_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033005590.1|1371857_1372346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1372392_1372893_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_014502419.1|1372896_1374393_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1374534_1375032_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259942.1|1375179_1375668_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014502420.1|1375670_1377506_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014502421.1|1377469_1378561_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	1611811	1692767	4794316	transposase,protease,tRNA	Bacillus_phage(25.0%)	60	NA	NA
WP_014501268.1|1611811_1612768_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_048483193.1|1613095_1615477_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_048483973.1|1615866_1617939_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014502643.1|1618101_1618512_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_014502644.1|1618811_1618994_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_014502645.1|1619136_1620177_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024712477.1|1620249_1621695_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	6.4e-14
WP_041183157.1|1623349_1623895_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	50.6	1.6e-13
WP_108744420.1|1625562_1625868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483194.1|1625944_1626187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483195.1|1626601_1627135_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|1627160_1627562_+	membrane protein	NA	NA	NA	NA	NA
WP_048483975.1|1627928_1628159_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_048483196.1|1629526_1631431_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.3e-59
WP_048483976.1|1631693_1634099_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	5.6e-15
WP_048483197.1|1634241_1634964_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_024710714.1|1635151_1636099_-	DMT family transporter	NA	NA	NA	NA	NA
WP_041183665.1|1636495_1637329_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_048483198.1|1637901_1638402_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_048483977.1|1638454_1640020_+	serine hydrolase	NA	NA	NA	NA	NA
WP_014502666.1|1640166_1641423_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1641490_1642684_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_048483199.1|1642680_1643370_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_048483200.1|1643475_1644945_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1644964_1645801_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_041183161.1|1645826_1646930_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014502669.1|1646926_1649983_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014502670.1|1650048_1650645_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_048483201.1|1650812_1652645_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	1.9e-31
WP_048483202.1|1652965_1654771_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_014502673.1|1655003_1655360_+	aldehyde-activating protein	NA	NA	NA	NA	NA
WP_014502674.1|1655356_1656121_+	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_014502675.1|1656130_1657147_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.5	5.6e-49
WP_041183163.1|1657438_1657732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082348501.1|1657810_1658224_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_044750620.1|1658955_1659969_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1660002_1660236_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_041183164.1|1660710_1661004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502687.1|1661979_1662837_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_019301039.1|1663041_1663653_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_014502689.1|1663725_1666368_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	5.5e-173
WP_041183165.1|1666882_1667518_+	lipoprotein	NA	NA	NA	NA	NA
WP_014502691.1|1667540_1668569_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_048483203.1|1668565_1669465_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1669521_1669938_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_014502694.1|1669949_1671065_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011409102.1|1671939_1672410_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_048483205.1|1672846_1673530_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_048483206.1|1673840_1676954_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014502697.1|1677420_1678155_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_014502698.1|1678293_1678866_+	Maf-like protein	NA	NA	NA	NA	NA
WP_014502699.1|1678865_1680365_+	ribonuclease G	NA	NA	NA	NA	NA
WP_048483207.1|1680505_1684426_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_041183668.1|1684431_1685184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483208.1|1685282_1686728_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_014502703.1|1686984_1687566_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_014502704.1|1687711_1689079_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_154235697.1|1689075_1689504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048482877.1|1689824_1691201_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	9.2e-79
WP_014502709.1|1691669_1692767_-|protease	protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	1746989	1754588	4794316	transposase	Acidithiobacillus_phage(16.67%)	6	NA	NA
WP_154235700.1|1746989_1748531_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.4	6.7e-78
WP_048483223.1|1748585_1749485_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	9.5e-08
WP_024711757.1|1749726_1751496_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	4.0e-58
WP_154235701.1|1751492_1752086_-	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	1.4e-15
WP_048483225.1|1752352_1752946_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.7e-11
WP_014502759.1|1753151_1754588_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
>prophage 8
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	1836499	1865475	4794316	transposase,tRNA	Acidithiobacillus_phage(40.0%)	23	NA	NA
WP_048483240.1|1836499_1837894_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	3.4e-81
WP_012444809.1|1838098_1838437_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_014502841.1|1838790_1839222_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005991243.1|1839233_1839464_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014502842.1|1839725_1840175_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_014502843.1|1840384_1843888_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_014502844.1|1843944_1844676_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_048483982.1|1845532_1848058_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	39.5	9.8e-119
WP_024712508.1|1848054_1849017_+	EF-P lysine aminoacylase GenX	NA	A0A1V0SAC0	Catovirus	26.5	3.0e-20
WP_014502847.1|1849126_1849813_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_014502848.1|1850015_1851080_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_048483241.1|1851289_1853986_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.2	5.7e-109
WP_082350358.1|1854320_1855697_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_154235702.1|1855662_1856001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235703.1|1856118_1856721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483243.1|1856717_1857083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483244.1|1857201_1858158_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	9.6e-43
WP_082348294.1|1858195_1859029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483245.1|1859195_1860572_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_048484507.1|1860714_1862091_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_048483983.1|1862116_1862596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1862802_1863771_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_048483247.1|1864098_1865475_+|transposase	IS5-like element ISXo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	1.2e-78
>prophage 9
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	1951753	1960666	4794316	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_041183723.1|1951753_1953430_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.5	2.5e-38
WP_010365714.1|1953518_1954160_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_014503651.1|1954332_1955367_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	3.6e-112
WP_014503650.1|1955668_1956157_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_014503649.1|1956258_1958907_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	9.7e-85
WP_003481884.1|1959046_1959259_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_108744361.1|1959694_1960666_+	hypothetical protein	NA	O80281	Escherichia_phage	40.3	8.3e-26
>prophage 10
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	2082275	2175038	4794316	transposase	Acidithiobacillus_phage(16.67%)	57	NA	NA
WP_048484507.1|2082275_2083652_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_014501268.1|2083842_2084799_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_053070547.1|2084873_2085569_-	hypothetical protein	NA	A0A1B1P9F9	Acinetobacter_phage	45.2	2.2e-44
WP_014503517.1|2087344_2087806_-	cytochrome c	NA	NA	NA	NA	NA
WP_041183307.1|2087814_2088207_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_154235768.1|2088429_2089545_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041183306.1|2089541_2093054_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.2	6.8e-110
WP_048483286.1|2093050_2096119_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_082350366.1|2096185_2097202_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	4.7e-48
WP_048483287.1|2098486_2099146_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_014503510.1|2099198_2101115_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_014503509.1|2101217_2101937_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_014503508.1|2101933_2102941_-	glucokinase	NA	NA	NA	NA	NA
WP_014503507.1|2102937_2104368_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	33.9	2.4e-66
WP_014503506.1|2104790_2105888_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	1.3e-22
WP_014503505.1|2106016_2106889_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_080344391.1|2106832_2107099_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_014503504.1|2107158_2107554_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_014503503.1|2107550_2107937_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_014503502.1|2107970_2109761_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_014503501.1|2109764_2109974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007963513.1|2109990_2110773_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2110883_2111132_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_048483288.1|2111082_2111535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712197.1|2111558_2112800_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048483289.1|2112792_2113527_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_014503498.1|2113551_2113749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483290.1|2115112_2117521_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_014503494.1|2117549_2118212_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_014503493.1|2118215_2118680_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014503492.1|2118676_2120446_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	7.2e-52
WP_048483291.1|2120442_2121483_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_048483292.1|2121774_2122554_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014503489.1|2122550_2123015_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_082352843.1|2122957_2124457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503487.1|2124453_2126310_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_014503486.1|2126309_2126942_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_154235709.1|2129725_2131045_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296772.1|2131706_2131850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483294.1|2131863_2132826_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_048483295.1|2133127_2142712_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.7	6.9e-56
WP_082350369.1|2142708_2154333_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.3	1.1e-151
WP_041183711.1|2154542_2155313_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_014503478.1|2155682_2156975_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_014503477.1|2156958_2158221_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_014503476.1|2158232_2158664_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014503475.1|2158722_2159088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503474.1|2159187_2159949_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_014503473.1|2160170_2160818_+	response regulator	NA	NA	NA	NA	NA
WP_048483296.1|2161412_2165123_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014503471.1|2165533_2166520_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_048483999.1|2166552_2168349_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_014503468.1|2169220_2169643_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_014503467.1|2169639_2169996_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|2170084_2170684_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_048483297.1|2170697_2172521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483298.1|2173661_2175038_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.4	6.0e-78
>prophage 11
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	2187290	2275192	4794316	transposase,plate	Xanthomonas_phage(35.29%)	51	NA	NA
WP_011259603.1|2187290_2187794_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_048483304.1|2187797_2189675_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014503449.1|2189638_2190649_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_048483305.1|2190681_2193387_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.7	3.3e-80
WP_048484000.1|2193886_2194072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235710.1|2194137_2194632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183297.1|2195033_2195492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183296.1|2195755_2197693_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	2.6e-39
WP_048483307.1|2197701_2198241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483308.1|2198237_2199680_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_014503442.1|2199676_2201014_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_048483309.1|2201015_2202332_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_048483310.1|2202335_2205794_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_048483311.1|2205790_2206438_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_014503438.1|2206434_2207157_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_048483312.1|2207153_2210057_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_014503436.1|2210053_2210380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183293.1|2210552_2211581_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_014503435.1|2211589_2212570_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047339868.1|2212683_2215143_-	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_014503433.1|2215139_2216132_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_033004902.1|2216128_2216836_-	response regulator	NA	NA	NA	NA	NA
WP_014503426.1|2219733_2222814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483313.1|2223220_2224312_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048483314.1|2224687_2226775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503422.1|2228270_2228849_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048483316.1|2228973_2230086_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014503420.1|2230137_2233263_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_047339861.1|2236170_2236356_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	98.4	5.4e-27
WP_047339860.1|2236355_2236592_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	93.2	1.4e-27
WP_047340495.1|2236639_2237746_+	replication protein	NA	S0F3I3	Stenotrophomonas_phage	74.3	1.1e-159
WP_047339859.1|2237742_2238036_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	53.1	9.2e-21
WP_011408495.1|2238276_2238516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047339857.1|2238652_2240116_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.6	1.9e-50
WP_047339856.1|2240117_2240438_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_047339855.1|2240434_2241619_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.6	6.1e-55
WP_080344434.1|2241673_2241844_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	5.5e-10
WP_075240058.1|2241907_2242309_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
WP_075240059.1|2242952_2243213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503417.1|2243796_2244483_+	hypothetical protein	NA	A0A2K9R7I4	Dishui_lake_phycodnavirus	28.0	8.8e-06
WP_108744471.1|2245753_2246818_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011258802.1|2248897_2249866_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082350366.1|2250156_2251173_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	4.7e-48
WP_048483320.1|2252386_2253763_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.2e-78
WP_082350461.1|2255648_2256386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483321.1|2256403_2259244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483322.1|2259974_2263463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501268.1|2264983_2265940_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_048483324.1|2267026_2271133_-	avirulence protein	NA	NA	NA	NA	NA
WP_144406543.1|2271893_2273213_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2274223_2275192_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 12
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	2933449	3022056	4794316	portal,tRNA,capsid,head,plate,terminase,holin,transposase,tail,integrase	Stenotrophomonas_phage(40.0%)	85	2977385:2977431	3022133:3022179
WP_014502854.1|2933449_2935828_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_048483430.1|2935943_2936939_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	8.0e-32
WP_003484828.1|2937193_2937553_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002811096.1|2937563_2937761_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080098376.1|2938008_2938551_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_024712035.1|2938599_2940504_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	3.4e-124
WP_048483431.1|2941595_2942972_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_154235722.1|2943228_2943687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483432.1|2943827_2945204_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_024712336.1|2945889_2947170_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	1.3e-98
WP_024712337.1|2948301_2948769_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014503746.1|2949266_2950580_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_014503747.1|2950701_2951910_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_014503748.1|2951992_2953078_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.0	3.7e-75
WP_014503749.1|2953252_2954221_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_041183338.1|2954520_2955177_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_048484050.1|2955118_2955931_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_014503751.1|2956161_2956437_+	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_014503752.1|2956598_2957162_+	phasin family protein	NA	NA	NA	NA	NA
WP_048483433.1|2957728_2958739_+	membrane protein	NA	NA	NA	NA	NA
WP_014503754.1|2958895_2959633_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_048483434.1|2959957_2961328_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_041183340.1|2961388_2962594_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_014503757.1|2962607_2964149_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.9	3.5e-79
WP_014503758.1|2964333_2965191_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_014503759.1|2965207_2966875_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_048483435.1|2967234_2968329_+	acyltransferase	NA	NA	NA	NA	NA
WP_014503761.1|2968458_2969187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483436.1|2969546_2973041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235723.1|2973113_2974215_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.5e-39
WP_014503764.1|2974635_2976657_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_041183342.1|2976795_2977338_+	fimbrial protein	NA	NA	NA	NA	NA
2977385:2977431	attL	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_027704080.1|2978095_2978827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483438.1|2978854_2981689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483439.1|2981685_2982612_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011408160.1|2983666_2984068_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_052285781.1|2984016_2984574_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
WP_011408158.1|2984554_2984896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483441.1|2985487_2986702_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.2	5.3e-54
WP_053070556.1|2986973_2987726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258480.1|2987792_2988494_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.6	1.4e-104
WP_082350393.1|2988411_2988657_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	50.0	1.5e-13
WP_048483443.1|2988682_2989705_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	2.4e-140
WP_048483444.1|2989704_2991489_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.3	2.6e-267
WP_048483445.1|2991610_2992453_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	2.6e-68
WP_048483446.1|2992499_2993516_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.8	2.5e-137
WP_011258475.1|2993519_2994239_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_041182058.1|2994338_2994806_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_048483447.1|2994805_2995015_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	2.0e-14
WP_024745971.1|2995019_2995376_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_041182057.1|2995368_2995644_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.9e-21
WP_011258470.1|2995640_2996282_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_011258469.1|2996281_2996770_+	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	3.2e-26
WP_011408144.1|2996766_2997186_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	1.4e-38
WP_048483448.1|2997173_2997671_+	phage virion morphogenesis protein	NA	E5FFH6	Burkholderia_phage	53.6	1.7e-35
WP_146035096.1|2997856_2998498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082350394.1|2999141_3000518_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	8.3e-80
WP_048483451.1|3000649_3001540_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	54.1	2.5e-85
WP_011408141.1|3001532_3002078_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	2.1e-50
WP_048483452.1|3002087_3003593_+|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.8	8.6e-54
WP_041182056.1|3003600_3004179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258461.1|3004239_3004803_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	2.4e-25
WP_011258460.1|3004799_3005159_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	1.2e-35
WP_011258459.1|3005170_3006337_+|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_011258458.1|3006367_3006877_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258457.1|3006922_3007225_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258456.1|3007233_3007347_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_048483453.1|3007379_3010250_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.1	8.3e-207
WP_048483454.1|3010262_3010664_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.9	1.0e-38
WP_048483455.1|3010660_3011647_+	phage late control D family protein	NA	E5E3U4	Burkholderia_phage	53.1	2.1e-93
WP_048483456.1|3012238_3013261_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.2	2.7e-51
WP_048483457.1|3013607_3014039_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	35.1	1.7e-10
WP_075247086.1|3014111_3014372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483458.1|3014374_3014692_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	59.8	3.9e-25
WP_048483459.1|3014705_3014984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154292327.1|3015225_3017886_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	70.2	0.0e+00
WP_012445510.1|3018209_3018428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483461.1|3018424_3018703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483462.1|3018692_3018965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132718872.1|3019155_3019464_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.6	1.2e-15
WP_048483464.1|3019456_3019639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483465.1|3019631_3019904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|3019900_3020125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143701885.1|3020190_3020394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483467.1|3020814_3022056_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.7	3.1e-118
3022133:3022179	attR	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
>prophage 13
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	3113513	3123308	4794316	transposase	Ralstonia_phage(16.67%)	7	NA	NA
WP_048483031.1|3113513_3114482_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041183353.1|3115798_3116107_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014503846.1|3116282_3117008_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_082352856.1|3117424_3118879_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.3	6.8e-48
WP_014503850.1|3118945_3120376_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_014503851.1|3120596_3121151_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	39.0	2.8e-18
WP_014503852.1|3121367_3123308_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	2.0e-26
>prophage 14
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	3130181	3205837	4794316	transposase,protease,coat,tRNA	Bacillus_phage(22.22%)	59	NA	NA
WP_048483472.1|3130181_3131012_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_014503860.1|3131084_3131513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503861.1|3131644_3132124_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_014503862.1|3132373_3132589_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_014503863.1|3132816_3133302_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_048483473.1|3134959_3136093_+	phospholipase A	NA	NA	NA	NA	NA
WP_048484055.1|3136525_3136978_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024711419.1|3137296_3138814_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_014503871.1|3139153_3141034_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.5	8.0e-25
WP_024711417.1|3141236_3142016_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|3142165_3142651_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_024711415.1|3145106_3145346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483474.1|3145596_3146310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048484056.1|3146412_3147513_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_154235725.1|3147930_3148728_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048484058.1|3149343_3149922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183355.1|3150013_3150514_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503883.1|3150580_3151414_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_048484059.1|3151464_3151779_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|3151962_3152151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3152565_3153174_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_048483476.1|3154375_3156154_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_041183736.1|3156282_3158472_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_014503890.1|3159049_3159712_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_014503892.1|3161423_3163001_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_044750143.1|3163007_3164201_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_048483477.1|3164211_3165729_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024710314.1|3165725_3166166_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048483478.1|3166288_3167140_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014503897.1|3167200_3169444_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.6	5.5e-81
WP_024710311.1|3169927_3170464_-	bacterioferritin	NA	NA	NA	NA	NA
WP_014503899.1|3170559_3172980_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_048483479.1|3173528_3175196_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082348224.1|3175572_3176679_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_014503903.1|3176747_3178442_-	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.6e-88
WP_041183358.1|3178736_3179867_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_082350466.1|3179871_3180234_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	40.0	1.9e-15
WP_014503906.1|3180373_3180730_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_024710308.1|3180726_3181197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483480.1|3181193_3182390_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_041183360.1|3182406_3185016_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_014503910.1|3185012_3185789_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_014503911.1|3186107_3186632_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_024710305.1|3186640_3187411_+	molecular chaperone	NA	NA	NA	NA	NA
WP_014503913.1|3187427_3189779_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014503914.1|3189775_3190810_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_048483481.1|3190856_3191189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483482.1|3191191_3191917_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258701.1|3192308_3193112_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_014503916.1|3193281_3194160_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_024710301.1|3194435_3195959_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.0	5.3e-19
WP_014503919.1|3196065_3196788_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|3196968_3197526_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_154235726.1|3197528_3198305_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	1.1e-15
WP_014503921.1|3198301_3199129_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014503922.1|3199131_3200322_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_014503923.1|3200348_3201695_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_082348220.1|3201691_3204145_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_014503925.1|3204844_3205837_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	56.7	8.3e-98
>prophage 15
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	3675935	3701020	4794316	transposase	Ralstonia_phage(25.0%)	14	NA	NA
WP_154235735.1|3675935_3676919_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.4	2.8e-77
WP_154235776.1|3677776_3681586_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_014502675.1|3682200_3683217_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.5	5.6e-49
WP_044749647.1|3683486_3684863_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_154235736.1|3685176_3686278_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	8.8e-40
WP_014504332.1|3688330_3688726_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082353004.1|3688824_3689982_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003490678.1|3690151_3690829_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_048484089.1|3690906_3691296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712565.1|3691508_3692396_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	31.7	6.6e-30
WP_014504336.1|3692900_3695033_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011409118.1|3697463_3697856_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_048483031.1|3698425_3699394_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_014501268.1|3700063_3701020_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
>prophage 16
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	4026664	4033036	4794316		Enterobacteria_phage(50.0%)	6	NA	NA
WP_014504627.1|4026664_4028011_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.0e-33
WP_014504628.1|4028058_4029462_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.8	3.8e-48
WP_014504629.1|4029578_4030487_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	1.8e-27
WP_048483657.1|4030483_4031041_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	6.6e-44
WP_014504631.1|4031037_4031925_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	2.0e-95
WP_014504632.1|4031980_4033036_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.7	1.2e-83
>prophage 17
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	4327346	4416517	4794316	transposase,tRNA	Ralstonia_phage(21.43%)	60	NA	NA
WP_014501701.1|4327346_4328558_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014501700.1|4328728_4330147_+	M23 family metallopeptidase	NA	A0A222ZJ66	Rhodococcus_phage	32.9	2.2e-11
WP_014501699.1|4330398_4330557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712514.1|4330517_4331651_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_014501697.1|4331688_4331916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082352926.1|4331974_4333195_-	MFS transporter	NA	NA	NA	NA	NA
WP_014501695.1|4333588_4334389_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	5.2e-26
WP_048483738.1|4338576_4340172_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501690.1|4340271_4340757_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_048483739.1|4341302_4344131_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_014501687.1|4344130_4344505_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_014501686.1|4344501_4346046_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_014501685.1|4346042_4346549_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_014501684.1|4346545_4346830_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_048483741.1|4346826_4347180_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_082350429.1|4347576_4347966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501682.1|4348391_4349717_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_082348398.1|4351491_4352562_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_019301451.1|4352729_4353218_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014501678.1|4353573_4354164_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014501677.1|4354175_4355684_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.7	1.2e-63
WP_014501676.1|4356126_4357020_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_024712412.1|4359112_4360201_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_082352925.1|4360280_4361264_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_048483743.1|4361265_4361649_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_014501671.1|4361645_4363157_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_014501670.1|4363210_4363453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041183049.1|4363394_4363718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501668.1|4364212_4365154_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.7	6.3e-87
WP_048482872.1|4365435_4366404_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_048483748.1|4367152_4368442_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.3e-39
WP_014501665.1|4368881_4369217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501664.1|4369491_4369923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048483750.1|4370091_4371048_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.3e-42
WP_041183047.1|4371329_4372739_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_048483758.1|4376257_4379242_+	avirulence protein	NA	NA	NA	NA	NA
WP_014501656.1|4379375_4382663_+	TAL effector protein Tal1c	NA	NA	NA	NA	NA
WP_144415627.1|4382755_4383857_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.7e-38
WP_011257407.1|4384133_4384460_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_041183041.1|4384431_4384926_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	4.7e-17
WP_041183040.1|4384945_4385929_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_014501653.1|4385974_4387018_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.7	5.6e-153
WP_014501652.1|4387195_4389694_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	8.3e-304
WP_024712256.1|4390307_4391351_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	2.2e-80
WP_014501648.1|4391457_4394166_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014501647.1|4394452_4395067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4395138_4396506_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014501646.1|4397187_4399011_+	potassium transporter	NA	NA	NA	NA	NA
WP_041183038.1|4399772_4400429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082350431.1|4400956_4401586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483760.1|4401980_4402949_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_154235749.1|4403081_4405025_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_014501640.1|4406737_4407067_-	phosphatase	NA	NA	NA	NA	NA
WP_041183036.1|4407093_4410414_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_041183594.1|4410406_4410667_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_048483764.1|4410885_4412085_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_014501636.1|4412084_4412858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483766.1|4412854_4413676_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024712380.1|4413672_4415295_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_048483768.1|4415554_4416517_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	4609923	4659570	4794316	transposase,protease	Acidithiobacillus_phage(25.0%)	35	NA	NA
WP_048483823.1|4609923_4611300_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_048483825.1|4611837_4613214_-|transposase	IS5-like element ISXo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_048483826.1|4613399_4614368_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_154235752.1|4614513_4614822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264755.1|4614855_4615242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501450.1|4615371_4615650_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_014501448.1|4624369_4626274_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	2.3e-19
WP_014501447.1|4626270_4626873_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_014501446.1|4626973_4628239_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_014501445.1|4628786_4630949_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_014501443.1|4631242_4631449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076342453.1|4631656_4632046_-	YchJ family protein	NA	NA	NA	NA	NA
WP_154235779.1|4632123_4632981_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_048483830.1|4633093_4634275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501439.1|4634372_4637801_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014501438.1|4637948_4638647_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_014501437.1|4638630_4640103_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_014501436.1|4640099_4640687_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_014501434.1|4641081_4641711_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	1.9e-47
WP_048481578.1|4641811_4642303_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053070560.1|4642654_4643182_+	TolC family protein	NA	NA	NA	NA	NA
WP_014501428.1|4644022_4645384_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	6.4e-32
WP_048484122.1|4646861_4647368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501423.1|4647641_4647848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501422.1|4647834_4648947_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014501268.1|4649484_4650441_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_014502919.1|4651173_4652130_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_014501419.1|4652350_4652800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082352784.1|4652924_4653182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501416.1|4653823_4654012_-	CsbD family protein	NA	NA	NA	NA	NA
WP_048484125.1|4654253_4655423_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_154235780.1|4655718_4656201_+	ATPase	NA	NA	NA	NA	NA
WP_014501410.1|4656761_4657835_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501408.1|4658237_4658708_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_033005488.1|4659078_4659570_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 19
NZ_CP011955	Xanthomonas oryzae pv. oryzicola strain B8-12, complete genome	4794316	4665648	4711382	4794316	transposase	Staphylococcus_prophage(22.22%)	27	NA	NA
WP_154235753.1|4665648_4666750_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	2.4e-37
WP_014501397.1|4667096_4668119_+	sugar kinase	NA	NA	NA	NA	NA
WP_048483835.1|4668749_4669958_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_048483836.1|4670378_4671335_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	1.1e-41
WP_048483839.1|4673377_4673944_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_014501387.1|4674090_4675257_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_014501668.1|4675304_4676246_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.7	6.3e-87
WP_048483840.1|4676270_4676867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235754.1|4677556_4679752_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	41.2	6.4e-66
WP_014501384.1|4679850_4681053_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_014501382.1|4681323_4682334_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	1.0e-47
WP_048483843.1|4682469_4683435_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014501379.1|4684224_4684455_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014501378.1|4684521_4685184_-	hemolysin III	NA	NA	NA	NA	NA
WP_082352916.1|4685447_4687856_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.1e-07
WP_048483844.1|4687852_4689691_+	exonuclease	NA	NA	NA	NA	NA
WP_048483845.1|4690165_4692310_-	avirulence protein	NA	NA	NA	NA	NA
WP_014501372.1|4692500_4693658_-	ROK family protein	NA	NA	NA	NA	NA
WP_014501371.1|4693830_4696419_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014501370.1|4696429_4697215_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_041182996.1|4699824_4700130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182995.1|4700347_4701607_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	7.0e-41
WP_011257161.1|4701664_4702045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501364.1|4702246_4706719_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_048483846.1|4706913_4708395_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_048483847.1|4708830_4709787_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.3e-42
WP_048483849.1|4710005_4711382_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	6.6e-77
