The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP012331	Bifidobacterium scardovii JCM 12489 = DSM 13734 strain JCM 12489	3158347	73619	149307	3158347	integrase,protease,tRNA,capsid,transposase	Paenibacillus_phage(16.67%)	60	94889:94908	156378:156397
WP_046726132.1|73619_74432_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_033517665.1|76862_77321_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_033517664.1|77420_78209_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_081892993.1|78274_79435_+	class E sortase	NA	NA	NA	NA	NA
WP_033517662.1|79747_80392_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	40.4	1.0e-35
WP_033517660.1|80600_82766_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8JE84	Murine_leukemia_virus	31.4	9.2e-17
WP_033517658.1|83778_85242_-	serine hydrolase	NA	NA	NA	NA	NA
WP_033517746.1|85238_86633_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_033517656.1|86629_88303_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_033517654.1|88310_88847_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_033517651.1|88872_89574_-	DUF3662 domain-containing protein	NA	NA	NA	NA	NA
WP_033517744.1|89853_92367_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_161787641.1|93802_94789_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	30.6	7.6e-27
94889:94908	attL	CCTCAGCGAGGGGAGCCAGA	NA	NA	NA	NA
WP_033517649.1|95453_96839_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_033517648.1|96970_97912_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_033517647.1|97911_98889_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_033517645.1|99152_100034_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_033517643.1|100346_103079_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_033517641.1|103075_105400_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_033517639.1|106801_107257_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_033517637.1|107633_108002_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_081892985.1|108206_109523_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_033517635.1|109668_110745_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033517633.1|111098_111968_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033517631.1|112055_112736_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_171818088.1|112732_113848_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.2	2.6e-31
WP_033517629.1|113938_115105_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_046726129.1|115101_115656_-	membrane protein	NA	NA	NA	NA	NA
WP_081892984.1|116002_116380_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033517627.1|116445_117411_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_046726128.1|117407_118076_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_033517625.1|118152_119073_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_171818090.1|119076_122295_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	27.6	1.9e-18
WP_033517732.1|122359_122773_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_033517623.1|122976_123309_+	putative heavy metal-binding protein	NA	NA	NA	NA	NA
WP_033517621.1|123734_124103_+	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_033517619.1|124217_124667_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033517617.1|124727_125576_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_033517615.1|125931_126720_+	aminoglycoside 3'-phosphotransferase	NA	Q75ZG1	Hepacivirus	28.8	7.5e-17
WP_033517613.1|127366_127630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033517611.1|127733_127919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051923215.1|128068_129220_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_033517609.1|129583_129964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033517607.1|130218_130521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033517606.1|130522_130717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033517604.1|130942_132307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033517602.1|132303_132537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033517600.1|132717_132945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033517599.1|132941_133157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144414379.1|133299_133908_+	helix-turn-helix transcriptional regulator	NA	A0A2H4PE70	Mycobacterium_phage	51.0	2.4e-15
WP_033517596.1|133911_135003_+|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	42.0	3.3e-71
WP_046726127.1|135811_136207_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	34.2	1.4e-08
WP_162180140.1|136239_136560_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	6.3e-15
WP_033519971.1|136915_138550_-	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_033519973.1|138652_139954_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.2	1.1e-54
WP_081892982.1|140385_142407_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	7.3e-16
WP_033519975.1|142795_145153_+	heavy metal translocating P-type ATPase	NA	NA	NA	NA	NA
WP_033519972.1|145391_146843_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081892981.1|147143_148283_+	serine hydrolase	NA	NA	NA	NA	NA
WP_046726269.1|148359_149307_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
156378:156397	attR	TCTGGCTCCCCTCGCTGAGG	NA	NA	NA	NA
>prophage 2
NZ_AP012331	Bifidobacterium scardovii JCM 12489 = DSM 13734 strain JCM 12489	3158347	505660	512377	3158347	capsid,terminase,portal	Propionibacterium_phage(33.33%)	7	NA	NA
WP_033519555.1|505660_507097_+|terminase	terminase	terminase	A0A1D8EU80	Propionibacterium_phage	41.2	2.4e-98
WP_033519556.1|507096_508629_+|portal	phage portal protein	portal	A0A2H4J2P6	uncultured_Caudovirales_phage	33.2	7.1e-56
WP_046726116.1|508564_509881_+	EndoU domain-containing protein	NA	A0A1D8ETG0	Propionibacterium_phage	44.8	1.6e-19
WP_033519557.1|509871_510177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051923282.1|510340_510850_+	hypothetical protein	NA	A0A1X9SHB3	Mycobacterium_phage	33.3	5.0e-06
WP_081893092.1|510899_511799_+|capsid	phage major capsid protein	capsid	A0A222ZID2	Rhodococcus_phage	31.7	2.2e-28
WP_081893091.1|511810_512377_+	hypothetical protein	NA	I3NL98	Bifidobacterium_phage	45.1	5.2e-12
>prophage 3
NZ_AP012331	Bifidobacterium scardovii JCM 12489 = DSM 13734 strain JCM 12489	3158347	2391546	2406418	3158347	capsid,tail,terminase,portal	Bifidobacterium_phage(100.0%)	18	NA	NA
WP_081892906.1|2391546_2392053_+	bifunctional DNA primase/polymerase	NA	I3NLA6	Bifidobacterium_phage	66.7	1.9e-58
WP_033519147.1|2392071_2392470_+	hypothetical protein	NA	I3NLA5	Bifidobacterium_phage	71.0	1.9e-45
WP_033519148.1|2392469_2394266_+|terminase	terminase	terminase	I3NLA4	Bifidobacterium_phage	86.8	0.0e+00
WP_144414466.1|2394259_2395660_+|portal	phage portal protein	portal	I3NLA3	Bifidobacterium_phage	70.3	2.2e-197
WP_051923172.1|2395643_2397074_+	hypothetical protein	NA	I3NLA2	Bifidobacterium_phage	67.0	2.3e-109
WP_033519149.1|2397070_2397340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033519150.1|2397426_2397978_+	hypothetical protein	NA	I3NLA0	Bifidobacterium_phage	46.4	5.6e-35
WP_033519151.1|2397988_2398936_+|capsid	phage major capsid protein	capsid	I3NL99	Bifidobacterium_phage	80.3	3.4e-141
WP_033519152.1|2398935_2399505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033519153.1|2399524_2400019_+	hypothetical protein	NA	I3NL97	Bifidobacterium_phage	62.2	7.6e-52
WP_033519154.1|2400015_2400450_+	hypothetical protein	NA	I3NL96	Bifidobacterium_phage	53.6	9.1e-17
WP_051923171.1|2400449_2400830_+	hypothetical protein	NA	I3NL95	Bifidobacterium_phage	37.9	6.3e-14
WP_033519155.1|2400826_2401207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033519156.1|2401263_2401794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161787657.1|2401799_2402063_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_033519158.1|2402158_2402680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051923170.1|2402742_2403063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051923169.1|2403079_2406418_+|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	61.5	2.5e-194
>prophage 4
NZ_AP012331	Bifidobacterium scardovii JCM 12489 = DSM 13734 strain JCM 12489	3158347	2611963	2621433	3158347	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_033518863.1|2611963_2612692_+	ribonuclease III	NA	A0A1V0SDK0	Indivirus	32.1	1.0e-15
WP_033518861.1|2612911_2614828_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	2.5e-58
WP_033518860.1|2614858_2615413_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_033518858.1|2615672_2617850_-	ATP-binding cassette domain-containing protein	NA	M1HXU1	Acanthocystis_turfacea_Chlorella_virus	23.5	9.0e-20
WP_033518857.1|2617909_2618638_-	type 1 glutamine amidotransferase	NA	A0A2K9L2L9	Tupanvirus	28.8	2.7e-05
WP_033518855.1|2618751_2620392_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L4N2	Tupanvirus	30.5	3.3e-35
WP_033518854.1|2620527_2621433_-	cation transporter	NA	M1Q1N9	Streptococcus_phage	38.3	1.6e-47
