The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	144373	277751	1704859	transposase,protease,tRNA	Bacillus_phage(25.0%)	113	NA	NA
WP_060459077.1|144373_145735_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_054681703.1|145991_146978_+	ribose-phosphate diphosphokinase	NA	A0A2H4UV84	Bodo_saltans_virus	28.9	3.3e-30
WP_060459078.1|147127_147811_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060459079.1|147823_148654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459080.1|148717_150205_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_060459081.1|150197_150935_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	6.1e-29
WP_056970186.1|150990_152214_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_060459082.1|152362_153448_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060459083.1|153472_154177_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_060459084.1|154247_155366_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_060459085.1|155362_156133_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_060459086.1|156119_156938_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060459087.1|157052_160601_+	SNF2 helicase associated domain-containing protein	NA	A0A0K0N6W5	Gordonia_phage	29.1	4.0e-41
WP_056970178.1|160675_160951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459088.1|161057_164069_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_054681704.1|164242_165403_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_060459089.1|165484_165961_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	66.2	6.9e-58
WP_060459090.1|166090_166573_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_060459091.1|166577_167378_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_060459092.1|167524_168004_+	universal stress protein	NA	NA	NA	NA	NA
WP_056970174.1|168342_169269_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056970173.1|169407_170337_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056970172.1|170362_171136_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	1.1e-23
WP_151443540.1|171128_171923_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_060459093.1|171922_172735_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_060459094.1|173108_173789_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	73.9	3.9e-22
WP_054681701.1|174009_174279_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056970170.1|174307_174616_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_056970543.1|175070_175646_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_054682013.1|175819_176305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459095.1|176359_177757_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_060459096.1|177884_179834_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	32.1	2.9e-30
WP_060459877.1|179854_181153_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_060459097.1|181274_182492_+	MFS transporter	NA	NA	NA	NA	NA
WP_060459098.1|182585_184538_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	2.3e-67
WP_156171264.1|185490_186717_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.3	5.2e-57
WP_060459099.1|188223_188670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459100.1|188758_189664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054682021.1|189953_190175_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_054682023.1|190230_190488_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_060459101.1|190984_192838_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060459102.1|193107_193965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459103.1|195208_195700_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_060459104.1|195858_197064_+	SLAP domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	35.7	8.5e-12
WP_060459105.1|197104_198271_+	SLAP domain-containing protein	NA	A0A1B1P7Q1	Bacillus_phage	36.4	1.3e-20
WP_060459106.1|198369_199644_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.7	6.7e-07
WP_060459107.1|201411_202122_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	1.3e-23
WP_013437298.1|202139_202511_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_013855373.1|202507_203092_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_060459108.1|203107_204103_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_060459109.1|205902_206844_+	SHOCT domain-containing protein	NA	O48432	Lactobacillus_phage	35.0	2.3e-36
WP_060459110.1|207202_208393_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.9	2.1e-07
WP_060459111.1|208480_208903_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_060459112.1|208945_209635_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_060459113.1|210149_211469_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	39.1	2.9e-66
WP_060459114.1|211896_212862_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_060459115.1|212875_213670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054681643.1|213829_214522_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_060459116.1|214675_214963_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_060459117.1|215095_216370_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.8	6.9e-12
WP_082137213.1|216637_217948_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	9.7e-54
WP_056970133.1|218173_218740_+	aldose epimerase	NA	NA	NA	NA	NA
WP_060459118.1|218844_219951_+	LCP family protein	NA	NA	NA	NA	NA
WP_060459119.1|219950_220535_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_060459120.1|220606_223579_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_060459121.1|223842_225105_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	6.0e-85
WP_082137214.1|225350_225839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056970138.1|225923_226577_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_060459122.1|226663_227806_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	32.3	9.1e-56
WP_060459123.1|228036_228273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459124.1|228259_228607_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q708N9	Streptococcus_phage	56.1	2.3e-10
WP_060459125.1|228765_230082_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	9.1e-60
WP_060459126.1|230227_230656_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_056970141.1|230893_231355_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_060459127.1|231471_232824_+	MFS transporter	NA	NA	NA	NA	NA
WP_056971015.1|233002_234364_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_060459128.1|234631_235945_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.1	1.3e-82
WP_172644287.1|235937_236300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056970842.1|236381_237044_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_156171226.1|237191_237524_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_156171264.1|237655_238882_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.3	5.2e-57
WP_082137154.1|238891_239872_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_056970846.1|240034_240640_-	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_060459130.1|240771_241791_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_056970849.1|241796_242276_+	competence protein ComE	NA	A7KUY9	Bacillus_phage	60.5	4.7e-38
WP_172644301.1|242316_242862_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_060459132.1|243166_245857_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	24.1	7.9e-42
WP_060459133.1|247195_249172_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.8	1.0e-91
WP_056970808.1|249171_249939_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_060459134.1|249984_250497_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_054682175.1|250489_251377_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_060459135.1|251459_251717_+	Veg family protein	NA	NA	NA	NA	NA
WP_056970805.1|251830_252664_+	pur operon repressor	NA	NA	NA	NA	NA
WP_060459136.1|252718_254104_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.0	5.5e-31
WP_060459137.1|254287_255934_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_056970700.1|256056_256833_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060459138.1|256930_257470_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082137156.1|257583_257817_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_156171227.1|257738_258335_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.0	9.0e-31
WP_060459880.1|258413_259424_-	serine hydrolase	NA	NA	NA	NA	NA
WP_060459139.1|259843_260641_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060459141.1|261027_262068_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_156171264.1|262279_263506_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.3	5.2e-57
WP_060459142.1|263674_264538_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060459143.1|264675_266670_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_060459144.1|266676_267573_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_060459145.1|267740_268712_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	2.0e-43
WP_060459146.1|268779_270210_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_060459147.1|270334_271063_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054682087.1|272718_273600_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_060459148.1|273690_274611_+	ROK family protein	NA	NA	NA	NA	NA
WP_060459149.1|274876_276262_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_082137216.1|276464_277751_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	9.6e-54
>prophage 2
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	496308	504076	1704859	integrase	Lactobacillus_phage(28.57%)	10	478282:478341	501166:501243
478282:478341	attL	TATGGAGGATTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGGAGGTCACAGGTCCG	NA	NA	NA	NA
WP_082137163.1|496308_496941_-|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	61.4	8.2e-67
WP_060459276.1|497047_498163_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	39.6	1.5e-63
WP_060459277.1|498310_498676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459278.1|499156_499501_-	helix-turn-helix transcriptional regulator	NA	A0A141DZM2	Streptococcus_phage	43.2	1.6e-11
WP_060459279.1|499776_499968_+	antirepressor	NA	Q9T1I7	Lactobacillus_phage	59.7	5.4e-14
WP_060459280.1|499982_500189_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	42.0	5.0e-05
WP_060459281.1|500185_500470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459282.1|500529_500715_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_056970167.1|501396_502596_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.1e-136
501166:501243	attR	TATGGAGGATTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGGAGGTCACAGGTCCGAGCCCTGTATCCTCCATC	NA	NA	NA	NA
WP_060459283.1|502612_504076_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.8	2.3e-27
>prophage 3
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	672945	681622	1704859		Streptococcus_phi-m46.1-like_phage(33.33%)	10	NA	NA
WP_056969709.1|672945_673713_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	48.4	3.7e-37
WP_056969707.1|673732_674497_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	44.7	9.1e-36
WP_156171240.1|674985_675144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056969703.1|675290_675944_+	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	41.4	1.6e-09
WP_060459361.1|675945_676644_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_054681303.1|676692_677316_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	58.2	8.0e-14
WP_056969699.1|677465_677714_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_054681302.1|677782_677998_+	YneF family protein	NA	NA	NA	NA	NA
WP_060459362.1|678078_679827_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.4	3.7e-48
WP_060459363.1|679834_681622_+	ABC transporter ATP-binding protein	NA	W8CYT2	Bacillus_phage	53.6	7.1e-07
>prophage 4
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	691283	743688	1704859	transposase,protease,tRNA	Streptococcus_phage(23.08%)	40	NA	NA
WP_060459370.1|691283_692540_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_060459371.1|692563_694264_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060459372.1|694269_698577_+	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	35.4	7.5e-18
WP_060459373.1|698683_699160_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_082137167.1|699178_700522_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_056970104.1|700557_700833_+	YlxR family protein	NA	NA	NA	NA	NA
WP_060459374.1|700835_701147_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_060459375.1|701151_703785_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.4e-22
WP_054681583.1|703803_704169_+	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_060459376.1|704216_705110_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_172644290.1|705115_706066_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_060459378.1|706223_707273_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_056970108.1|707285_707870_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_060459379.1|707887_709723_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.4	1.2e-137
WP_056970110.1|709804_710953_+	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	24.5	2.3e-19
WP_060459380.1|711074_712913_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_060459381.1|712955_715226_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.9	1.9e-76
WP_060459382.1|715336_715864_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_060459383.1|716016_716538_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060459384.1|716594_718079_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_060459385.1|718178_720452_-	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.1	1.2e-43
WP_060459138.1|720626_721166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156171241.1|721090_722029_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.6	1.4e-38
WP_056970114.1|722102_723389_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	50.7	1.1e-105
WP_056970116.1|723539_724118_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_056970115.1|724267_725269_+	hypothetical protein	NA	A0A223G0T1	Staphylococcus_phage	31.5	5.2e-23
WP_054682323.1|725372_726779_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_056970725.1|727370_728177_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056970726.1|728247_729012_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_060459387.1|729011_729653_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	31.3	2.9e-19
WP_060459388.1|731961_732819_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060459389.1|732881_733286_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054682122.1|733433_734123_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_060459390.1|734333_734735_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_060459391.1|734828_735725_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	33.3	4.5e-10
WP_056971015.1|736231_737593_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_056970746.1|737812_738280_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	50.3	1.3e-40
WP_056970741.1|740230_741148_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_060459392.1|741235_741814_-	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_056971015.1|742326_743688_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	755541	823699	1704859	transposase,integrase	Bacillus_virus(15.38%)	41	822054:822069	824416:824431
WP_060459395.1|755541_756891_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060459396.1|757105_757315_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_060459397.1|757436_763919_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060459398.1|766435_767287_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	22.0	4.0e-08
WP_060459399.1|767455_769705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172644291.1|769781_769943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082137169.1|771293_771644_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	42.6	4.5e-14
WP_060459400.1|771841_772267_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_060459401.1|772443_773769_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.6	3.2e-89
WP_060459230.1|773954_775316_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_060459402.1|775649_778055_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.1	2.1e-126
WP_056969971.1|778285_779278_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	3.1e-20
WP_060459403.1|779330_781019_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_060459404.1|783123_783747_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_060459163.1|783834_785217_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	2.9e-56
WP_060459405.1|787048_788554_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_060459406.1|788572_790393_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_060459885.1|790407_791127_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	33.3	2.9e-28
WP_056969966.1|791274_792177_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_056969965.1|792192_793635_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_156171243.1|793721_793943_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_082137171.1|794042_794951_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082137172.1|795026_795716_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_082137173.1|795706_795976_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_056969961.1|795969_796428_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_056969960.1|796440_796764_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_060459410.1|800615_800855_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_056969958.1|801142_801994_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_060459411.1|801986_802430_+	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
WP_060459886.1|802588_803938_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_056969954.1|805228_807046_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	39.5	3.3e-07
WP_056969953.1|807067_808483_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_056969952.1|808582_808996_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_060459412.1|808988_811004_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.4	2.5e-64
WP_060459413.1|811136_811694_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	45.3	2.8e-34
WP_060459314.1|811919_813098_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060459388.1|813356_814214_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060459415.1|818573_819740_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_060459416.1|819894_821508_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	46.6	2.3e-113
WP_172644292.1|821508_822699_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	29.9	2.4e-14
822054:822069	attL	CCTTCAGAAACGAAAA	NA	NA	NA	NA
WP_060459417.1|822763_823699_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	50.6	1.3e-79
WP_060459417.1|822763_823699_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	50.6	1.3e-79
824416:824431	attR	TTTTCGTTTCTGAAGG	NA	NA	NA	NA
>prophage 6
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	1212818	1255424	1704859	transposase,holin,protease,tRNA	Bacillus_phage(20.0%)	37	NA	NA
WP_060459230.1|1212818_1214180_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_054681534.1|1214383_1215043_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_056970059.1|1215043_1215979_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060459633.1|1215993_1216626_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_082137187.1|1216625_1217825_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	31.9	7.1e-19
WP_060459117.1|1218066_1219341_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.8	6.9e-12
WP_060459634.1|1219501_1221088_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_060459635.1|1221263_1222103_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.2	1.9e-47
WP_054681715.1|1222130_1222691_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_056970209.1|1222739_1223798_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054681712.1|1223856_1224585_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_156171264.1|1225024_1226251_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.3	5.2e-57
WP_060459636.1|1226511_1228008_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	24.2	7.5e-26
WP_060459138.1|1228089_1228629_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156171250.1|1228553_1229492_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.2	4.1e-38
WP_060459637.1|1229552_1232018_-	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	46.4	7.9e-81
WP_054681710.1|1232037_1232430_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_056970206.1|1232429_1232990_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_060459638.1|1233044_1234256_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_060459639.1|1234269_1234650_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_060459640.1|1234724_1237490_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.8	7.8e-77
WP_060459641.1|1237663_1238692_+	lactonase family protein	NA	NA	NA	NA	NA
WP_060459642.1|1238720_1239548_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_056970200.1|1239635_1240328_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_060459643.1|1240357_1242640_-	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_060459644.1|1242762_1244538_-	oleate hydratase	NA	NA	NA	NA	NA
WP_060459645.1|1244651_1245545_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.5	1.9e-08
WP_060459646.1|1245531_1246335_-	NAD kinase	NA	NA	NA	NA	NA
WP_056970195.1|1246331_1246964_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_056970194.1|1247038_1247665_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_060459647.1|1247742_1248363_+	DsbA family protein	NA	NA	NA	NA	NA
WP_060459648.1|1249280_1250012_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_060459649.1|1250110_1250509_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_060459650.1|1250723_1252457_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_054681722.1|1252456_1252723_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_056970212.1|1252828_1253011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459651.1|1253204_1255424_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.9	8.9e-124
>prophage 7
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	1258957	1349023	1704859	transposase,holin,tRNA,bacteriocin	Catovirus(16.67%)	81	NA	NA
WP_060459395.1|1258957_1260307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_056970217.1|1260455_1260935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056970218.1|1260946_1261762_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_060459655.1|1261886_1263266_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	30.2	1.1e-58
WP_082137189.1|1263663_1264554_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060459657.1|1264697_1264982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459658.1|1265018_1266182_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_060459659.1|1266181_1267393_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_056970225.1|1268701_1269601_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.5	6.9e-75
WP_060459660.1|1269669_1270587_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_060459661.1|1270595_1271423_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_060459662.1|1271560_1272007_+	flavodoxin	NA	NA	NA	NA	NA
WP_060459663.1|1271999_1272512_+	GtrA family protein	NA	NA	NA	NA	NA
WP_056970229.1|1272562_1273705_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	1.3e-22
WP_054681730.1|1273806_1273995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459664.1|1274170_1275499_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056970231.1|1275495_1276728_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.1	1.9e-38
WP_060459665.1|1276727_1277435_-	lysozyme	NA	NA	NA	NA	NA
WP_060459666.1|1277594_1278164_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	28.5	4.0e-12
WP_060459667.1|1278266_1279637_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_060459668.1|1279738_1280395_-	nitroreductase	NA	NA	NA	NA	NA
WP_060459388.1|1280586_1281444_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060459669.1|1281908_1282934_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	4.8e-40
WP_060459670.1|1283031_1285431_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_054682277.1|1285727_1286504_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_082137190.1|1286496_1286868_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_060459671.1|1286990_1293422_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_151443646.1|1293883_1294030_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_056970487.1|1294273_1294999_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056970485.1|1295008_1295932_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_056970483.1|1295931_1296627_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_060459672.1|1296628_1297552_-	ribokinase	NA	NA	NA	NA	NA
WP_056970479.1|1297683_1297944_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_054681839.1|1298110_1298218_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_054681841.1|1298265_1298736_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	30.8	5.8e-17
WP_060459673.1|1298832_1299486_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060459674.1|1299497_1300136_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_056970476.1|1300136_1300952_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172644295.1|1300962_1301712_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	6.4e-34
WP_060459675.1|1301720_1302665_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_056970472.1|1302764_1304165_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_056970470.1|1304182_1306369_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_056970468.1|1306365_1307895_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_060459676.1|1308091_1308733_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.0	8.2e-38
WP_056970414.1|1308896_1309475_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_060459677.1|1309691_1310924_-	MFS transporter	NA	NA	NA	NA	NA
WP_060459678.1|1311029_1312112_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_156171251.1|1312209_1312404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054681902.1|1312725_1313256_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_060459679.1|1313275_1314589_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	35.4	2.2e-61
WP_056970424.1|1314666_1315665_-	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	33.6	3.6e-40
WP_056970426.1|1315748_1316168_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056970428.1|1316320_1317802_-	MFS transporter	NA	NA	NA	NA	NA
WP_056970429.1|1317927_1318299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082137192.1|1318472_1319246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459681.1|1319215_1319827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056970434.1|1320846_1321230_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082137193.1|1321348_1321930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459682.1|1322110_1323385_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	24.3	1.9e-06
WP_003671718.1|1323910_1324405_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_060459683.1|1325012_1326335_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_060459685.1|1326898_1327786_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_056970436.1|1329349_1329637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060459388.1|1329705_1330563_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054681529.1|1330705_1331575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169790071.1|1331567_1331726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056969977.1|1333040_1334186_+	beta-glucanase	NA	NA	NA	NA	NA
WP_054681526.1|1334777_1334978_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	68.3	1.2e-19
WP_060459686.1|1335277_1336513_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	2.9e-47
WP_060459687.1|1336616_1338140_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003686704.1|1338207_1338564_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	43.8	4.4e-09
WP_003686706.1|1338553_1338748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054681524.1|1338842_1340126_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	2.2e-50
WP_162258097.1|1340180_1340489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459688.1|1340891_1342244_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	47.2	1.1e-111
WP_056969981.1|1342604_1343984_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_060459689.1|1344060_1344771_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_054681520.1|1344890_1345814_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.6	3.3e-16
WP_060459690.1|1345843_1347274_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_056969983.1|1347278_1348721_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_054681517.1|1348720_1349023_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	1433918	1503577	1704859	transposase,protease	Bacillus_phage(30.0%)	61	NA	NA
WP_060459741.1|1433918_1435193_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	27.1	1.4e-12
WP_082137198.1|1435225_1435609_-	DUF3290 family protein	NA	NA	NA	NA	NA
WP_056970516.1|1436606_1437521_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_056970515.1|1437580_1438156_-	elongation factor P	NA	NA	NA	NA	NA
WP_056970513.1|1438280_1439195_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.8	1.8e-30
WP_054681967.1|1439247_1439817_+	arylesterase	NA	NA	NA	NA	NA
WP_060459901.1|1439830_1440241_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056970511.1|1440285_1441107_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060459742.1|1441109_1441730_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.8e-26
WP_060459743.1|1441741_1442389_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060459744.1|1442823_1445118_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_060459902.1|1445269_1445962_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_060459745.1|1445988_1446636_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_060459746.1|1446723_1448724_-	transketolase	NA	NA	NA	NA	NA
WP_060459747.1|1448750_1449404_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	48.8	3.0e-48
WP_060459748.1|1450487_1451345_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060459749.1|1451447_1451816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459750.1|1453303_1454353_+	hypothetical protein	NA	Q6SEA5	Lactobacillus_prophage	56.0	3.2e-31
WP_060459751.1|1454366_1454825_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_056971015.1|1454939_1456301_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_060459752.1|1456410_1457040_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_060459578.1|1457405_1458584_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_156171254.1|1458632_1458776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054682202.1|1458995_1460279_+	GTPase HflX	NA	NA	NA	NA	NA
WP_060459753.1|1460295_1461387_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_082137199.1|1462657_1463572_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	46.3	4.2e-19
WP_060459755.1|1463755_1464490_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	45.5	1.7e-18
WP_060459756.1|1464712_1465210_-	C40 family peptidase	NA	A0A0A7DMV4	Lactobacillus_phage	45.7	1.6e-17
WP_060459757.1|1465400_1465940_-	AAA family ATPase	NA	A0A0K2FM14	Brevibacillus_phage	29.6	2.1e-10
WP_060459758.1|1466033_1466408_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_060459759.1|1466522_1468046_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_054682135.1|1468088_1468715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056970763.1|1468798_1469392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459760.1|1471437_1472148_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_056970756.1|1472341_1472824_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_056970754.1|1472827_1473601_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_054682136.1|1473619_1475164_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.7	2.4e-43
WP_056970752.1|1475200_1475572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459761.1|1475593_1476286_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_060459762.1|1476355_1477594_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	28.9	1.1e-11
WP_060459763.1|1477754_1479551_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_060459764.1|1481147_1481405_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_056970869.1|1482135_1482933_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_060459903.1|1482932_1483553_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.0	1.5e-12
WP_060459766.1|1483624_1484515_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060459767.1|1484635_1486615_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_054682198.1|1486638_1487553_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_056970877.1|1487549_1488308_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_082137200.1|1488618_1488717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459768.1|1489033_1490425_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_060459769.1|1490430_1491153_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	4.7e-26
WP_054682247.1|1491186_1491381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459163.1|1491546_1492929_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	2.9e-56
WP_056970951.1|1492981_1493734_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_060459770.1|1493749_1495321_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_056970949.1|1495371_1496526_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.1	4.6e-31
WP_060459771.1|1496530_1497217_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	4.3e-37
WP_060459772.1|1497439_1498465_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.1	8.7e-42
WP_060459904.1|1498630_1500460_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	1.9e-47
WP_060459773.1|1500502_1502227_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	1.2e-35
WP_156171264.1|1502350_1503577_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.3	5.2e-57
>prophage 9
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	1579140	1640903	1704859	transposase,protease	Burkholderia_virus(16.67%)	46	NA	NA
WP_060459812.1|1579140_1580415_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	9.6e-06
WP_082137205.1|1580475_1580865_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_056969919.1|1580893_1581652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056969920.1|1581651_1582107_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060459813.1|1582286_1583297_+	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_060459814.1|1583345_1584641_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	5.9e-19
WP_060459815.1|1584644_1585934_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.7	2.8e-69
WP_060459816.1|1586129_1587122_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.8	7.5e-131
WP_056969924.1|1587845_1588859_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	44.9	4.0e-63
WP_170073552.1|1588902_1589556_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_060459817.1|1589734_1591138_-	APC family permease	NA	NA	NA	NA	NA
WP_172644293.1|1591596_1592988_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_056969927.1|1593555_1594932_-	amino acid permease	NA	NA	NA	NA	NA
WP_056969928.1|1595013_1595763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056969929.1|1595879_1597994_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.4	5.9e-117
WP_060459818.1|1598212_1600744_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.1	1.0e-136
WP_060459819.1|1600740_1601631_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060459820.1|1601614_1602940_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_054681424.1|1603086_1603320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459821.1|1603383_1604058_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_060459822.1|1604352_1605297_-	serine hydrolase	NA	NA	NA	NA	NA
WP_060459823.1|1605296_1606601_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_056969933.1|1606593_1606833_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_056969934.1|1606879_1608118_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_056969935.1|1608117_1609632_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.6	3.4e-34
WP_054681432.1|1609647_1609800_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_054681434.1|1609916_1610231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056969936.1|1610243_1611380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054681436.1|1612008_1612500_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_060459824.1|1612609_1614478_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	3.5e-65
WP_060459825.1|1614621_1615773_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_082137206.1|1616026_1616680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060459826.1|1618346_1618898_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060459117.1|1621173_1622448_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.8	6.9e-12
WP_060459827.1|1622610_1623570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459828.1|1623766_1625233_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_056969948.1|1626026_1626701_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060459830.1|1626787_1627888_+	YdcF family protein	NA	NA	NA	NA	NA
WP_156171256.1|1628000_1628144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156171257.1|1628095_1629481_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.8	1.1e-28
WP_005691109.1|1629791_1630343_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_014571628.1|1630355_1630574_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_156171258.1|1630777_1631434_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_060459831.1|1632877_1633960_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	31.2	2.4e-18
WP_082137208.1|1634756_1639304_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_172644284.1|1639511_1640903_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_AP014808	Lactobacillus acetotolerans strain NBRC 13120	1704859	1670866	1678309	1704859		Erysipelothrix_phage(33.33%)	9	NA	NA
WP_005691113.1|1670866_1671187_+	thioredoxin family protein	NA	A0A1J0GW78	Streptomyces_phage	36.3	6.1e-10
WP_046811166.1|1671204_1671474_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_060459854.1|1671733_1671952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056969851.1|1672077_1672299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060459855.1|1672391_1673399_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	32.5	2.4e-20
WP_060459856.1|1673471_1673951_-	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	34.8	4.7e-14
WP_060459857.1|1674398_1675490_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	44.0	9.5e-79
WP_060459858.1|1675614_1676697_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	43.8	2.3e-77
WP_056969860.1|1676770_1678309_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	7.2e-16
