The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	139154	212858	3694837	transposase	Planktothrix_phage(12.5%)	54	NA	NA
WP_043052461.1|139154_140675_-|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_035183920.1|140947_141451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183918.1|143410_143875_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080966404.1|144020_145358_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_035185124.1|145734_146550_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_035185129.1|146558_147041_-	DUF2243 domain-containing protein	NA	NA	NA	NA	NA
WP_061466630.1|147394_147928_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.0	2.6e-21
WP_014097040.1|148230_149646_-|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_155375936.1|149688_149865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035183915.1|149871_152118_-	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
WP_080738167.1|152226_152361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035183913.1|152839_154066_-	MFS transporter	NA	NA	NA	NA	NA
WP_035183911.1|154187_155573_-	MFS transporter	NA	NA	NA	NA	NA
WP_061577275.1|155919_156192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550135.1|156320_157205_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017550136.1|157615_158743_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_017550137.1|159329_160349_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017551383.1|168017_168890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035183901.1|169028_169388_+	YgzB family protein	NA	NA	NA	NA	NA
WP_017551385.1|169499_170249_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_035183899.1|170334_172023_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_014097391.1|172216_173104_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	2.5e-08
WP_014097390.1|173298_173748_-	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_017551388.1|173959_174514_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014097387.1|174823_175228_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_017551390.1|175371_176664_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_026684815.1|177349_178375_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014097384.1|178371_179154_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014097383.1|179170_179959_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	38.3	2.0e-33
WP_014097382.1|180473_181115_+	YitT family protein	NA	NA	NA	NA	NA
WP_035183895.1|181219_182488_-	MFS transporter	NA	NA	NA	NA	NA
WP_035183893.1|182621_183002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097379.1|183252_183531_-	YqhV family protein	NA	NA	NA	NA	NA
WP_035183891.1|185003_185873_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014097376.1|185872_187342_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_035183889.1|187359_188247_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_035183885.1|188237_189317_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_014097373.1|189648_191397_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.2	1.2e-54
WP_014097372.1|191497_192028_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_014097371.1|192182_192437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097370.1|192583_192814_-	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_014097369.1|192909_193659_-	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_014097368.1|193941_194856_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	4.8e-07
WP_035183882.1|194980_199543_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014097366.1|199821_201279_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_035183880.1|201408_201693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043052472.1|202560_203922_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035183873.1|203884_204757_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	1.4e-19
WP_014097362.1|205087_205246_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_014097361.1|205332_206313_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_026684724.1|206491_207610_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017551449.1|209197_210373_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_035183866.1|210906_211224_-	YfhH family protein	NA	NA	NA	NA	NA
WP_014095555.1|211634_212858_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	1.1e-78
>prophage 2
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	448927	521775	3694837	transposase	Staphylococcus_phage(16.67%)	56	NA	NA
WP_014096930.1|448927_450613_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_035183569.1|450948_451908_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_052042153.1|452255_453086_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_035183565.1|453471_453942_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_035183561.1|453982_454660_+	fructose-6-phosphate aldolase	NA	M4SIN4	Cyanophage	47.9	1.3e-49
WP_043052475.1|455078_456068_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_035183558.1|456173_457385_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.3	2.0e-29
WP_043052474.1|457547_458894_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_043052473.1|459798_461280_+	amino acid permease	NA	NA	NA	NA	NA
WP_035183538.1|462446_463115_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183536.1|463128_464352_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035183531.1|464449_465175_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.4	6.0e-29
WP_035183529.1|465402_465819_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_035183526.1|465831_466134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183524.1|466151_466421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183521.1|466413_470088_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_026684106.1|470084_471590_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.3	4.7e-20
WP_035183518.1|471582_472164_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_035183516.1|472177_472876_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_035183511.1|474216_475110_+	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	28.4	1.4e-11
WP_128890974.1|475380_475824_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_035183509.1|476266_476584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183506.1|476944_478015_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_035183504.1|478001_480416_-	EVE domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	27.6	2.4e-18
WP_035183502.1|480463_483547_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.6	3.8e-24
WP_035183500.1|483562_484813_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_035183497.1|484812_487377_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.4	4.5e-111
WP_017551160.1|488089_488500_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_026104589.1|488737_489151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183541.1|489684_490041_+	DUF600 family protein	NA	NA	NA	NA	NA
WP_017550355.1|490219_491533_-|transposase	IS1380-like element ISBco1 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	48.8	7.1e-113
WP_043052461.1|491723_493244_-|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_017551163.1|493776_494226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551165.1|494645_494843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551166.1|495052_496054_-	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	40.6	2.0e-54
WP_043052461.1|496127_497648_-|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_100183701.1|498030_498984_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183483.1|499130_499685_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_035183480.1|499699_500266_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017551170.1|500262_501063_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017551171.1|501078_501876_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026104591.1|501890_502610_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_035183477.1|502622_503330_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_035183474.1|503326_504082_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	1.7e-34
WP_035183472.1|504097_505129_+	MsnO8 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_035183470.1|505130_505415_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_035183467.1|505404_506736_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017551179.1|508066_508540_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_017551180.1|508812_509301_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_043052472.1|509506_510868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035183458.1|511296_512622_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_035183457.1|512644_514252_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_035183455.1|514649_515393_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183453.1|517011_518658_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_035183461.1|518913_519810_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017551449.1|520599_521775_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
>prophage 3
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	597077	664431	3694837	transposase	Bacillus_virus(28.57%)	59	NA	NA
WP_043052472.1|597077_598439_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_088775945.1|598620_600165_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014096990.1|600655_600835_+	YezD family protein	NA	NA	NA	NA	NA
WP_014096989.1|600923_601463_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_014096988.1|601483_602242_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.1	9.7e-30
WP_035183398.1|602256_603015_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_035183396.1|603028_604162_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_014096985.1|604176_605163_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014096984.1|605571_606555_+	GMP reductase	NA	G3MBI2	Bacillus_virus	81.3	6.2e-154
WP_017552292.1|606671_606926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096983.1|607220_607607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110134316.1|607517_607754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096982.1|607698_608169_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_048339782.1|609122_611420_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_026683898.1|611749_612142_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_014096979.1|612212_612860_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_035183390.1|612886_614188_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.1	2.2e-135
WP_035183389.1|614206_615400_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_017552285.1|615854_616808_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014096975.1|617135_617837_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_035183388.1|618160_619360_+	nucleoside permease	NA	NA	NA	NA	NA
WP_043052467.1|619696_621019_+	NCS2 family permease	NA	NA	NA	NA	NA
WP_035183387.1|621349_621997_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_026683892.1|622087_623041_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_026683891.1|623037_623727_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_035183386.1|624272_625040_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_035183385.1|625026_626028_-	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_035183384.1|626024_626732_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_014096966.1|627486_628692_+	MFS transporter	NA	NA	NA	NA	NA
WP_035183382.1|628707_629157_+	OsmC family protein	NA	NA	NA	NA	NA
WP_035183381.1|629360_630083_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	2.0e-32
WP_035183380.1|630075_630735_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014096962.1|630800_631568_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035183379.1|631685_632867_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_017552271.1|633171_635049_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.5	3.3e-95
WP_035183378.1|635415_636843_+	terpenoid cyclase	NA	NA	NA	NA	NA
WP_014096958.1|636849_637605_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_014096957.1|637616_638180_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_142743394.1|638645_638924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043052472.1|639056_640418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_128890978.1|640786_640969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013858128.1|641716_643027_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_048339784.1|643367_644783_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_048339785.1|645152_645521_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052042185.1|645526_646333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035185348.1|646316_647180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013858128.1|647507_648818_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_035183366.1|649382_649988_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035183364.1|650031_651153_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_035183363.1|652079_653102_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	23.9	6.3e-24
WP_017551575.1|653301_653667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017551572.1|654950_655736_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	2.5e-20
WP_017551571.1|656413_656788_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_017551570.1|656965_657868_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183368.1|658036_659200_+	MFS transporter	NA	NA	NA	NA	NA
WP_014096948.1|659562_660336_+	acetoin reductase	NA	NA	NA	NA	NA
WP_014096947.1|660857_661688_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_014096946.1|661958_662663_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_014096945.1|662745_664431_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	712327	720640	3694837		Synechococcus_phage(33.33%)	8	NA	NA
WP_026684446.1|712327_712921_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.3	6.4e-29
WP_026684445.1|712913_713957_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	8.6e-61
WP_026684444.1|713976_715401_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	4.6e-49
WP_026684443.1|715385_717635_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.1	7.8e-168
WP_026684442.1|717618_718302_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_026684441.1|718298_718553_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_026684440.1|718545_719256_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	42.8	7.4e-48
WP_017550741.1|719344_720640_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.8	6.5e-18
>prophage 5
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	965433	1040256	3694837	holin,transposase,tRNA	Planktothrix_phage(20.0%)	56	NA	NA
WP_035183165.1|965433_965913_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_164931356.1|966020_966167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026684575.1|966236_966920_-	LrgB family protein	NA	NA	NA	NA	NA
WP_035183163.1|966909_967287_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_014096689.1|967389_968331_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183161.1|968479_970327_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	27.0	1.3e-30
WP_035183159.1|970680_971694_+	DUF1646 family protein	NA	NA	NA	NA	NA
WP_014096684.1|974678_975125_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014096683.1|975200_975950_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014096682.1|976403_977477_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_035183153.1|977816_979619_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_035183151.1|979749_980466_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035183149.1|980440_982222_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	32.0	7.2e-68
WP_014096678.1|982457_983300_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014096677.1|983361_984024_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014096676.1|984013_985054_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	3.1e-34
WP_035183148.1|985316_986096_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.3	4.6e-11
WP_014096674.1|986157_986730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035183146.1|986741_987920_-	ParM/StbA family protein	NA	A0A1B1P792	Bacillus_phage	35.3	5.5e-56
WP_035183145.1|988336_989686_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_035183143.1|989879_990674_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_035183142.1|990736_991969_+	peptidase T	NA	NA	NA	NA	NA
WP_014096667.1|992489_993992_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_014096666.1|995113_996394_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	3.9e-63
WP_017552045.1|996601_998326_-	ubiquinone-dependent pyruvate dehydrogenase	NA	G8DDL3	Micromonas_pusilla_virus	23.4	1.1e-36
WP_172653422.1|998752_999457_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_043052461.1|999601_1001122_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_035183138.1|1001273_1003019_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.2	1.6e-88
WP_014096662.1|1003538_1004195_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	32.4	1.3e-19
WP_014096661.1|1004206_1004707_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	65.2	6.3e-46
WP_035183137.1|1004985_1007190_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_035183135.1|1007478_1008942_+	alpha-amylase	NA	NA	NA	NA	NA
WP_014096658.1|1008980_1009241_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_035183131.1|1009267_1009993_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088775931.1|1010132_1012517_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_035183129.1|1012761_1013586_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_035183127.1|1013745_1014534_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035183125.1|1014558_1015221_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_088775932.1|1015246_1015975_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.1e-33
WP_014096654.1|1016475_1017675_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014096653.1|1017674_1018802_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_014096652.1|1019077_1020154_+	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_014096651.1|1020153_1021314_+	alanine/ornithine racemase family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014096650.1|1021348_1022191_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014096649.1|1022218_1022956_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	3.5e-32
WP_014096648.1|1022948_1023638_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_026683527.1|1023618_1024278_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013858393.1|1024688_1025912_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
WP_035183112.1|1026657_1028160_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_035183110.1|1028405_1031654_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.8	3.7e-62
WP_035183109.1|1031694_1033005_-	restriction endonuclease subunit S	NA	A0A1V0S9X7	Catovirus	35.8	2.1e-16
WP_043052509.1|1034623_1035934_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_174719646.1|1036107_1036230_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_035185248.1|1036249_1036843_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048339784.1|1037492_1038908_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_043052491.1|1039032_1040256_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	1073248	1081311	3694837	protease	Staphylococcus_phage(66.67%)	10	NA	NA
WP_014096622.1|1073248_1073743_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	67.7	2.8e-54
WP_014096621.1|1073804_1074092_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_014096620.1|1074345_1074816_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.9	2.2e-40
WP_035183084.1|1074828_1076022_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.8	2.1e-111
WP_035183081.1|1076039_1076687_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.8	2.6e-39
WP_142010213.1|1076667_1077789_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.0	2.9e-54
WP_014096616.1|1078110_1079211_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_013860891.1|1079371_1079572_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_014096615.1|1079561_1080473_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017550665.1|1080687_1081311_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.5	3.6e-22
>prophage 7
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	1285544	1347415	3694837	tail,terminase,integrase,transposase	Bacillus_phage(17.14%)	73	1285411:1285459	1323933:1323981
1285411:1285459	attL	AACACCTTCCCAAGGTGTGGGTCGCGGGTTCGAGTCCCGTCTTCCGCTT	NA	NA	NA	NA
WP_029142701.1|1285544_1286771_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	47.6	1.0e-92
WP_080738156.1|1286875_1288117_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	73.5	5.6e-67
WP_035182903.1|1288134_1288467_-	membrane protein	NA	S5MNN8	Brevibacillus_phage	66.0	4.2e-14
WP_035182902.1|1288531_1288879_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_052042130.1|1288981_1289395_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	78.1	3.2e-59
WP_035182898.1|1289407_1289836_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	66.0	1.8e-41
WP_035182893.1|1289997_1290225_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035182890.1|1290225_1291011_+	phage antirepressor	NA	R9VWW9	Paenibacillus_phage	45.8	9.3e-52
WP_035182888.1|1291011_1291197_+	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	61.8	6.0e-10
WP_035182887.1|1291260_1291779_+	hypothetical protein	NA	A0A290FZK9	Caldibacillus_phage	36.7	1.5e-21
WP_035182885.1|1291778_1292063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155375947.1|1292132_1292273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182881.1|1292947_1293184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052042129.1|1293180_1293387_+	hypothetical protein	NA	A0A290GDU5	Caldibacillus_phage	42.0	5.0e-05
WP_088775933.1|1293484_1294432_+	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	63.3	6.9e-110
WP_035182880.1|1294431_1295328_+	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	70.6	1.3e-94
WP_052042127.1|1295385_1296222_+	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	33.8	4.5e-12
WP_043052535.1|1296218_1296539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052042126.1|1296495_1297812_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	45.0	1.1e-94
WP_155375946.1|1297808_1297985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182878.1|1298149_1298347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182875.1|1298343_1298976_+	dUTP diphosphatase	NA	A0A290GJJ6	Caldibacillus_phage	47.2	1.7e-43
WP_043052534.1|1298985_1299447_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	79.3	8.7e-58
WP_052498234.1|1299901_1300600_+	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	40.5	2.1e-18
WP_071646876.1|1300699_1300858_+	DUF3954 domain-containing protein	NA	A0A2P1JTX5	Anoxybacillus_phage	61.5	5.5e-12
WP_035182866.1|1301091_1301547_+	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	69.3	1.4e-60
WP_155375945.1|1301586_1301748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155375944.1|1301785_1301944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182863.1|1302073_1302280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182861.1|1302276_1302708_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	34.6	2.6e-16
WP_035182859.1|1302900_1303485_+	hypothetical protein	NA	A0A1S5SAK3	Streptococcus_phage	53.7	3.6e-48
WP_048339823.1|1303474_1304926_+|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	60.3	3.1e-162
WP_052042124.1|1304931_1307214_+	hypothetical protein	NA	M4R217	Salicola_phage	38.5	2.0e-09
WP_035182854.1|1307214_1308405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182852.1|1308404_1308791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182850.1|1308806_1309889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155375943.1|1309901_1310072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182849.1|1310073_1310484_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_035182847.1|1310480_1310837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052042122.1|1310838_1311243_+	HK97 gp10 family phage protein	NA	A0A1B1P7D0	Bacillus_phage	33.3	5.9e-10
WP_035182846.1|1311255_1311615_+	hypothetical protein	NA	A0A1B1P7D3	Bacillus_phage	40.7	5.1e-21
WP_035182843.1|1311626_1312442_+	hypothetical protein	NA	A0A1B1P7D9	Bacillus_phage	41.2	5.9e-49
WP_035182840.1|1312455_1312860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182837.1|1312913_1313216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052042120.1|1313251_1316359_+	transglycosylase SLT domain-containing protein	NA	A0A182BQ85	Lactococcus_phage	51.9	8.5e-72
WP_043052531.1|1316355_1317201_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	44.6	1.5e-55
WP_052042118.1|1317210_1318317_+|tail	phage tail protein	tail	A6M966	Geobacillus_virus	32.2	8.0e-41
WP_035182834.1|1318309_1318663_+	hypothetical protein	NA	A0A142KA97	Gordonia_phage	61.2	1.4e-07
WP_035182831.1|1318662_1320168_+	hypothetical protein	NA	M4M9L1	Vibrio_phage	30.7	3.4e-34
WP_035182828.1|1320179_1320443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182826.1|1320537_1321362_+	SGNH/GDSL hydrolase family protein	NA	A0A2H4J9Z4	uncultured_Caudovirales_phage	33.5	3.0e-24
WP_080738157.1|1321574_1321781_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_035182820.1|1321796_1322186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048339792.1|1322198_1323485_+	LysM peptidoglycan-binding domain-containing protein	NA	V5UQT2	Oenococcus_phage	29.8	1.4e-28
WP_014096460.1|1324300_1325200_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	2.1e-23
1323933:1323981	attR	AACACCTTCCCAAGGTGTGGGTCGCGGGTTCGAGTCCCGTCTTCCGCTT	NA	NA	NA	NA
WP_014096459.1|1325304_1325478_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_014096458.1|1325653_1326217_+	RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
WP_014096457.1|1326229_1326844_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_014096456.1|1326990_1327818_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_014096455.1|1327810_1329061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096454.1|1329097_1330450_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_035182814.1|1330914_1332717_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.6	3.2e-108
WP_026683805.1|1333922_1334348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026683804.1|1334440_1334956_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_035182811.1|1335151_1335904_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_035182809.1|1336098_1336962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182807.1|1336958_1337885_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013858307.1|1338714_1340400_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_048339793.1|1340428_1341643_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014096450.1|1342182_1343394_-	MFS transporter	NA	NA	NA	NA	NA
WP_035182800.1|1343486_1343771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048339794.1|1345396_1345801_-	glycine-rich domain-containing protein-like	NA	A0A2I2L429	Orpheovirus	34.7	9.4e-08
WP_043052509.1|1346104_1347415_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	1373508	1419402	3694837	protease,transposase	Streptococcus_phage(42.86%)	34	NA	NA
WP_043052509.1|1373508_1374819_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017550280.1|1375977_1376598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096424.1|1376810_1378079_+	MFS transporter	NA	NA	NA	NA	NA
WP_014096423.1|1378276_1378717_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014096422.1|1378929_1379721_+	DUF2837 family protein	NA	NA	NA	NA	NA
WP_014096421.1|1379916_1380657_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014096420.1|1380727_1380964_-	hypothetical protein	NA	A0A2I6QQV7	Streptococcus_phage	69.0	6.1e-07
WP_014096930.1|1381519_1383205_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014095994.1|1383602_1385018_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014096418.1|1385395_1386685_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_017552042.1|1387395_1388805_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	4.4e-36
WP_017552043.1|1388872_1390057_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_048339795.1|1390200_1391616_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014096414.1|1392063_1393242_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_014096413.1|1393478_1393817_-	DsrE family protein	NA	NA	NA	NA	NA
WP_035182763.1|1393946_1394405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182760.1|1394567_1395545_+	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.2	2.6e-19
WP_048339796.1|1396611_1398027_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014096409.1|1398861_1399818_+	osmoprotectant update ABC transporter ATP-binding subunit OpuFA	NA	G3M9Y6	Bacillus_virus	33.6	2.4e-25
WP_014096408.1|1399810_1401340_+	osmoprotectant update ABC transporter permease/substrate-binding subunit OpuFB	NA	NA	NA	NA	NA
WP_014096407.1|1401872_1402355_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_035182749.1|1402385_1403804_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_014096405.1|1403932_1405609_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_014096404.1|1405649_1406369_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014096403.1|1406462_1407791_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
WP_035182746.1|1408192_1409749_-	gluconokinase	NA	NA	NA	NA	NA
WP_017550602.1|1409899_1410592_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035182744.1|1410652_1411561_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M1T2E7	Synechococcus_phage	36.1	6.7e-54
WP_014096398.1|1412327_1412789_+	flavodoxin	NA	NA	NA	NA	NA
WP_052042116.1|1412785_1413871_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_035182739.1|1414115_1414868_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_035182737.1|1415070_1417014_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.8	1.9e-109
WP_014096394.1|1417035_1417257_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_017551449.1|1418226_1419402_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
>prophage 9
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	2029023	2104692	3694837	holin,transposase	Planktothrix_phage(21.43%)	59	NA	NA
WP_043052461.1|2029023_2030544_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_080966409.1|2030587_2031448_+	amino acid permease	NA	NA	NA	NA	NA
WP_035182240.1|2031825_2034246_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_043052472.1|2034534_2035896_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035182237.1|2036141_2036387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182234.1|2037082_2037664_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_017551656.1|2037863_2038115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551657.1|2038383_2038752_+	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_026684155.1|2038764_2040876_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_014095877.1|2040894_2041299_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_026104639.1|2041295_2041643_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_164931359.1|2041894_2042455_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_172653416.1|2043094_2044705_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_026684157.1|2045237_2047754_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_100183734.1|2047844_2048945_+	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	36.2	2.2e-06
WP_017551667.1|2049083_2049947_+	YitT family protein	NA	NA	NA	NA	NA
WP_017551668.1|2050040_2050361_+	cytochrome c	NA	NA	NA	NA	NA
WP_026684159.1|2051592_2052279_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.5	1.5e-26
WP_014095867.1|2052268_2053153_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017551671.1|2053297_2054641_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	45.1	1.4e-15
WP_048339805.1|2054818_2056234_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014095865.1|2056701_2058147_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_026684160.1|2058457_2059756_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.0	1.6e-16
WP_035182209.1|2060010_2060994_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_017551675.1|2061388_2062825_+	peptidoglycan-binding protein	NA	A0A0R6PIZ1	Moraxella_phage	28.3	1.6e-17
WP_074964141.1|2063074_2063323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017551449.1|2064037_2065213_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_017551676.1|2066017_2067205_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_035182202.1|2067517_2068468_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	48.5	3.8e-84
WP_035182199.1|2068460_2069411_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_014095858.1|2069404_2070163_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	2.2e-18
WP_035182195.1|2070177_2071116_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026104642.1|2071172_2071409_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_013858648.1|2072107_2072800_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.4	3.9e-46
WP_035182192.1|2072817_2074605_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	6.8e-42
WP_035182189.1|2076210_2077623_-	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_035182186.1|2077843_2078731_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_017551685.1|2079352_2080306_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014095849.1|2080302_2081187_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_035182183.1|2081183_2081549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182180.1|2081520_2082354_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.3e-16
WP_035182176.1|2082381_2083167_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.7e-16
WP_017551687.1|2083469_2084417_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_035182173.1|2084404_2086219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182170.1|2086211_2086565_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017551713.1|2086554_2086884_+	EamA family transporter	NA	NA	NA	NA	NA
WP_014095824.1|2087094_2088405_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_035182157.1|2088716_2089361_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014095840.1|2089447_2089693_+	CsbA family protein	NA	NA	NA	NA	NA
WP_035182154.1|2089689_2089953_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_013858672.1|2090134_2092135_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_035182151.1|2092121_2094986_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.8	0.0e+00
WP_013858674.1|2095343_2095742_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.7	5.3e-19
WP_035182148.1|2095734_2096925_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014095835.1|2097061_2098249_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014095834.1|2098245_2099052_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014095833.1|2099181_2102778_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_035182145.1|2103077_2104223_+	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_035182163.1|2104347_2104692_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 10
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	2110229	2116411	3694837		Streptococcus_phage(33.33%)	7	NA	NA
WP_017551707.1|2110229_2111177_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.1	4.1e-86
WP_014095823.1|2111963_2112422_+	8-oxo-dGTP diphosphatase	NA	K4F7D9	Cronobacter_phage	33.3	6.9e-07
WP_017551709.1|2112458_2113349_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	4.3e-05
WP_017551710.1|2113345_2114326_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	44.6	1.2e-67
WP_013858691.1|2114406_2115360_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	9.2e-54
WP_014095819.1|2115470_2115740_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_035182139.1|2115826_2116411_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	1.3e-53
>prophage 11
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	2224594	2278517	3694837	coat,integrase,transposase	Paenibacillus_phage(15.38%)	51	2249412:2249431	2283317:2283336
WP_017551449.1|2224594_2225770_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_035182043.1|2226529_2227324_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	67.7	1.0e-26
WP_035182041.1|2227320_2227905_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_035182039.1|2228041_2228425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172653432.1|2228447_2229083_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_017551790.1|2229119_2229914_+	NAD kinase	NA	NA	NA	NA	NA
WP_035182036.1|2229922_2230795_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_035182034.1|2231911_2232649_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	S4TNS0	Salmonella_phage	25.1	1.8e-09
WP_035182031.1|2232860_2233640_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_035182029.1|2233770_2234469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182027.1|2234737_2235442_+|coat	spore coat CotO family protein	coat	NA	NA	NA	NA
WP_014095709.1|2235490_2235931_-|coat	Spore coat protein Z/Y	coat	NA	NA	NA	NA
WP_014095708.1|2236079_2236436_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_014095706.1|2236762_2237227_+	sporulation protein	NA	NA	NA	NA	NA
WP_014095705.1|2237243_2237720_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_014095704.1|2237719_2238730_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_014095703.1|2238908_2239265_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_017551778.1|2239349_2239481_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_017551449.1|2240121_2241297_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_014095701.1|2242469_2242727_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_014095700.1|2242828_2243083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014095699.1|2243259_2243688_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014095698.1|2243693_2244206_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_014095697.1|2244273_2245005_-	esterase family protein	NA	NA	NA	NA	NA
WP_014095695.1|2245802_2246006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043052472.1|2246070_2247432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164931345.1|2247842_2248013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019721857.1|2248972_2249131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182016.1|2249143_2249341_-	hypothetical protein	NA	NA	NA	NA	NA
2249412:2249431	attL	AGCCGGCAACAAAGTAGCAA	NA	NA	NA	NA
WP_014095692.1|2249620_2249776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164931346.1|2249772_2249916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048339807.1|2250505_2251381_+	ROK family protein	NA	NA	NA	NA	NA
WP_026684067.1|2252248_2253010_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.7	9.4e-17
WP_014095687.1|2253417_2254317_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	2.0e-13
WP_035182015.1|2254309_2255560_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013858831.1|2256092_2256278_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	79.3	9.9e-21
WP_035182013.1|2256509_2257850_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.2	1.3e-77
WP_035182012.1|2258031_2259843_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_014095682.1|2260171_2260414_+	YkuS family protein	NA	NA	NA	NA	NA
WP_035182010.1|2261514_2263713_-	nucleoside triphosphatase	NA	A0A2H4JB92	uncultured_Caudovirales_phage	30.5	5.2e-92
WP_012103576.1|2264350_2264590_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	58.8	1.5e-16
WP_035182004.1|2264582_2266526_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	36.0	1.3e-110
WP_035182002.1|2266540_2269501_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	34.6	4.9e-138
WP_035182000.1|2269523_2271143_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_019721868.1|2271269_2271479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035181998.1|2271776_2273768_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_043052507.1|2274212_2275637_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	1.2e-36
WP_014095679.1|2275737_2276277_-	chromate transporter	NA	NA	NA	NA	NA
WP_164931360.1|2276273_2276837_-	chromate transporter	NA	NA	NA	NA	NA
WP_035181990.1|2276885_2277362_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_052042101.1|2278010_2278517_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
2283317:2283336	attR	AGCCGGCAACAAAGTAGCAA	NA	NA	NA	NA
>prophage 12
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	2917459	2983934	3694837	holin,integrase,tRNA,tail,capsid,head,protease,portal,terminase	Bacillus_phage(29.41%)	77	2919452:2919511	2955260:2955358
WP_014098215.1|2917459_2918113_-	recombinase family protein	NA	D7RWL2	Brochothrix_phage	25.3	3.2e-05
WP_014098214.1|2918109_2918448_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014098213.1|2918654_2919275_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
2919452:2919511	attL	ACAAAAACCCCTCAAAGCCTTACGCTTCAAGGGGTTTCTTGCTTAATACATTTCGATATA	NA	NA	NA	NA
WP_035184796.1|2919724_2920441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052042174.1|2920545_2921385_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5ILA1	Bacillus_phage	29.8	4.8e-14
WP_172653413.1|2921439_2921679_-|holin	phage holin	holin	M4ZR48	Bacillus_phage	67.1	1.0e-22
WP_080738180.1|2921690_2921885_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_035184794.1|2922081_2922336_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	41.5	5.5e-06
WP_164931350.1|2922406_2922574_-	hypothetical protein	NA	I1TLF8	Bacillus_phage	52.3	4.0e-05
WP_035184791.1|2922576_2922867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184789.1|2922882_2923611_-	hypothetical protein	NA	A0A2P0ZL22	Lactobacillus_phage	38.2	4.8e-34
WP_052042170.1|2923620_2925090_-	metallophosphoesterase	NA	A0A0U4JVA9	Exiguobacterium_phage	43.4	4.5e-15
WP_052042168.1|2925089_2926496_-|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	41.4	7.7e-73
WP_035184787.1|2926504_2927329_-|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	33.2	8.9e-29
WP_052042167.1|2927358_2931516_-|tail	phage tail tape measure protein	tail	A8ATA7	Listeria_phage	37.0	9.8e-92
WP_035184785.1|2931684_2932011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184783.1|2932064_2932673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184781.1|2932685_2933072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184779.1|2933068_2933500_-	HK97 gp10 family phage protein	NA	A0A1B1P9Z7	Enterococcus_phage	33.3	4.8e-10
WP_035184777.1|2933499_2933832_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_035184775.1|2933834_2934119_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	61.4	6.6e-24
WP_052042165.1|2934132_2935281_-|capsid	phage major capsid protein	capsid	A0A0A7S154	Clostridium_phage	43.2	9.4e-77
WP_035184773.1|2935295_2936012_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.1	2.8e-55
WP_035184772.1|2935998_2937285_-|portal	phage portal protein	portal	Q0SPK2	Clostridium_phage	54.3	7.4e-131
WP_088775930.1|2937303_2938872_-|terminase	terminase large subunit	terminase	A0A2I7SBY8	Paenibacillus_phage	74.7	2.6e-247
WP_035184770.1|2938861_2939398_-	hypothetical protein	NA	A0A2I7SBY3	Paenibacillus_phage	34.3	1.1e-16
WP_035184768.1|2939505_2939877_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	52.3	1.5e-31
WP_035184766.1|2939882_2940101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184764.1|2940424_2940724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184762.1|2940885_2941428_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	8.7e-57
WP_035184760.1|2941424_2941880_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	54.9	1.5e-38
WP_035184757.1|2941982_2942669_-	phage antirepressor KilAC domain-containing protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	39.1	4.8e-36
WP_035184755.1|2942731_2942971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184753.1|2942988_2943189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184750.1|2943194_2943497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184748.1|2943511_2943694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184746.1|2943962_2944151_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_035184744.1|2944283_2944493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080738177.1|2944687_2945080_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	60.0	2.0e-39
WP_035184743.1|2945076_2946039_-	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	60.3	1.6e-37
WP_035184742.1|2946051_2946417_-	hypothetical protein	NA	S6BFM8	Thermus_phage	32.4	1.7e-08
WP_035184741.1|2946580_2946772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043052499.1|2946858_2947140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184739.1|2947152_2947422_-	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	62.8	3.5e-27
WP_035184735.1|2947446_2947968_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035184732.1|2948256_2948484_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035184731.1|2948629_2949049_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	51.7	3.0e-09
WP_035184729.1|2949177_2950095_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_052042163.1|2950124_2951087_+	3'-5' exoribonuclease	NA	A0A0A8WJ41	Clostridium_phage	39.2	1.9e-30
WP_035184727.1|2951132_2953133_+	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	32.5	1.3e-20
WP_035184725.1|2953136_2953403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184723.1|2953507_2954017_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_172653412.1|2954059_2955193_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	71.9	2.0e-71
WP_014098212.1|2955301_2956639_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
2955260:2955358	attR	ACAAAAACCCCTCAAAGCCTTACGCTTCAAGGGGTTTCTTGCTTAATACATTTCGATATACTGGTCGCGTTCCCATTGGTGGACTTGTGTGCGGAACAT	NA	NA	NA	NA
WP_014098211.1|2956708_2957098_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017550446.1|2957190_2960790_-	dynamin family protein	NA	NA	NA	NA	NA
WP_014098209.1|2960955_2961159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014098207.1|2962168_2963482_-	purine permease	NA	NA	NA	NA	NA
WP_014098206.1|2963478_2964066_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_172653411.1|2964612_2966139_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_014098204.1|2966214_2967360_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_013859462.1|2968089_2968392_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_014098203.1|2968472_2969024_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_014098202.1|2969093_2969345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014098201.1|2969683_2970982_-	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_035184719.1|2970962_2973263_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	32.5	1.5e-09
WP_014098199.1|2973412_2973856_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_014098198.1|2973921_2974416_-	YppG family protein	NA	NA	NA	NA	NA
WP_014098197.1|2974487_2974850_-	YppE family protein	NA	NA	NA	NA	NA
WP_014098196.1|2974917_2975157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014098195.1|2975420_2975531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014098194.1|2975713_2976319_+	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
WP_035184715.1|2976411_2979147_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_014098191.1|2979234_2979894_-	endonuclease III	NA	NA	NA	NA	NA
WP_014098190.1|2979941_2980637_-	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	48.7	2.3e-25
WP_014098189.1|2981146_2982556_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	1.5e-36
WP_035184709.1|2982641_2983934_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.8	2.7e-56
>prophage 13
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	3276319	3335304	3694837	protease,coat,tRNA	Moraxella_phage(25.0%)	55	NA	NA
WP_035184513.1|3276319_3277459_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.5	1.9e-82
WP_029141942.1|3277476_3278505_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013859790.1|3278540_3278747_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_017552653.1|3278743_3279742_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.6	2.1e-08
WP_035184511.1|3279758_3280361_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_035184508.1|3280859_3281579_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014097877.1|3281690_3282659_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_035184506.1|3282658_3283930_-|coat	SafA/ExsA family spore coat assembly protein	coat	S6BFI4	Thermus_phage	55.6	6.2e-05
WP_026683597.1|3284116_3284674_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_014097874.1|3284801_3285647_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_014097873.1|3285672_3286125_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_017551053.1|3286173_3287466_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_026683598.1|3287500_3288037_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_013859801.1|3288242_3288533_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_014097870.1|3288545_3288875_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_013859803.1|3288887_3289196_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_035184501.1|3289338_3290817_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014097868.1|3290868_3291735_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017551058.1|3291727_3292480_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_035184499.1|3292606_3293416_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_035184496.1|3293408_3294101_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017551061.1|3294325_3294844_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017551062.1|3294843_3295710_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017551063.1|3295816_3296833_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_035184522.1|3297006_3297681_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014097863.1|3297889_3298873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097862.1|3298991_3299753_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014097861.1|3299860_3300565_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_014097860.1|3300561_3301410_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_026683603.1|3301410_3302409_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_172653425.1|3302501_3302900_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_014097857.1|3303006_3304212_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014097856.1|3304198_3305251_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_014097855.1|3305260_3306922_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_035184493.1|3306967_3308422_-	VanW family protein	NA	NA	NA	NA	NA
WP_014097853.1|3308438_3309167_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_035184491.1|3309193_3310966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172653409.1|3311093_3312758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184489.1|3312754_3313264_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_013859827.1|3313260_3313680_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_035184488.1|3313798_3315121_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_035184486.1|3315183_3317829_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	44.0	1.4e-163
WP_014097848.1|3318255_3318447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026104585.1|3318463_3319480_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_035184479.1|3319678_3321496_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014097845.1|3321881_3323171_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.4e-06
WP_014097844.1|3323186_3324164_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014097843.1|3324400_3325189_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014097842.1|3325185_3326118_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014097841.1|3326130_3326955_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_014097840.1|3326970_3328302_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014097839.1|3328487_3328982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097837.1|3329738_3332063_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.5	4.8e-181
WP_014097836.1|3332106_3333744_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.4	2.9e-15
WP_014097835.1|3334035_3335304_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.4	5.4e-150
>prophage 14
NZ_CP011939	Bacillus coagulans strain S-lac chromosome, complete genome	3694837	3345072	3385242	3694837	coat,transposase,tRNA	Staphylococcus_phage(28.57%)	37	NA	NA
WP_014097825.1|3345072_3345375_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017551092.1|3345521_3346658_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	3.2e-13
WP_014097823.1|3346667_3347036_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014097822.1|3347032_3347248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017551093.1|3347339_3348149_-	glutamate racemase	NA	NA	NA	NA	NA
WP_035184469.1|3348159_3348612_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043052472.1|3349348_3350710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014097818.1|3351107_3352196_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_026684041.1|3352208_3352508_-	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_035184465.1|3352774_3352960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097816.1|3353245_3353470_-	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	77.0	6.1e-17
WP_043052492.1|3353829_3354339_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014097814.1|3354403_3355171_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017551099.1|3355243_3356995_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_035184462.1|3357066_3357675_-	succinate dehydrogenase cytochrome b558 subunit	NA	NA	NA	NA	NA
WP_014097811.1|3358103_3358568_+	YslB family protein	NA	NA	NA	NA	NA
WP_035184460.1|3358601_3359831_-	aspartate kinase	NA	NA	NA	NA	NA
WP_035184458.1|3360248_3362021_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_014097808.1|3362126_3362441_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.7	2.6e-21
WP_014097040.1|3362826_3364242_-|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_035184453.1|3364458_3365439_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_035184451.1|3365469_3366243_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_035184449.1|3366305_3367079_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_014097804.1|3367112_3367706_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014097803.1|3367848_3369546_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.7	2.5e-41
WP_014097802.1|3369782_3372137_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	49.6	2.6e-20
WP_035184447.1|3372212_3373931_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A0N9R450	Chrysochromulina_ericina_virus	26.2	2.6e-14
WP_080738175.1|3374209_3374746_-	CvpA family protein	NA	NA	NA	NA	NA
WP_013859878.1|3374732_3375023_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_035184443.1|3375123_3376059_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_035184441.1|3376451_3378866_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_035184439.1|3378878_3379916_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.1	5.4e-31
WP_035184438.1|3380561_3381317_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014097794.1|3381421_3381634_+	small acid-soluble spore protein SspI	NA	NA	NA	NA	NA
WP_035184435.1|3381660_3382086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097792.1|3382087_3383449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048339814.1|3384012_3385242_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
