The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011798	Enterobacter ludwigii strain UW5 chromosome, complete genome	4904981	2117113	2189519	4904981	plate,tRNA,protease	Moumouvirus(10.0%)	58	NA	NA
WP_032677806.1|2117113_2118514_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.9	1.4e-79
WP_047955304.1|2118683_2119886_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	1.3e-44
WP_014169413.1|2120141_2122754_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.2e-18
WP_032677808.1|2122797_2123568_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	2.2e-29
WP_044866350.1|2123564_2124356_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_047955305.1|2124365_2125511_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_020884802.1|2125507_2126470_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032681324.1|2126462_2127038_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_020884800.1|2127288_2128299_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_025204541.1|2128464_2129007_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_047955306.1|2129003_2130113_-	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	40.6	4.9e-06
WP_032677814.1|2130211_2132320_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_047955307.1|2132332_2134240_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	1.6e-49
WP_047357172.1|2134253_2135507_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_047955308.1|2135511_2137149_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_025204538.1|2137148_2137715_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|2137972_2138140_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_014169427.1|2138212_2138731_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_047955309.1|2138799_2140560_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_014169429.1|2140746_2141199_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_020884794.1|2141268_2142324_-	porin OmpA	NA	NA	NA	NA	NA
WP_032677816.1|2142678_2143188_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_047955310.1|2143405_2144032_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_020884791.1|2143988_2146151_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_047955311.1|2146170_2146617_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_047955312.1|2146740_2148795_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.4e-17
WP_020884788.1|2148854_2149313_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_041162938.1|2149393_2150056_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_162488932.1|2150174_2150645_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_013097248.1|2150679_2150997_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_032677819.1|2151057_2152248_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_025204530.1|2152423_2152981_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_080346990.1|2152991_2153780_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047955315.1|2153791_2154073_+	acylphosphatase	NA	NA	NA	NA	NA
WP_020884782.1|2154069_2154399_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_047955316.1|2154487_2155147_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.4	4.9e-46
WP_047955317.1|2155416_2157045_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047955318.1|2157607_2157877_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_025204527.1|2158586_2159087_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_047955319.1|2159120_2160668_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_025204525.1|2160681_2162031_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_047955320.1|2162027_2162717_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_047955321.1|2162716_2164396_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007312.1|2164398_2164890_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_047955322.1|2165052_2167725_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	2.0e-93
WP_047955323.1|2167721_2170079_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_074439188.1|2172781_2173258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071843301.1|2174418_2174682_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	56.0	2.1e-08
WP_032681310.1|2174684_2175893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955325.1|2175885_2179257_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_047955326.1|2179657_2181265_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_047955327.1|2181298_2183068_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_047955328.1|2183031_2184114_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_047955329.1|2184149_2184674_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_047955330.1|2184678_2187150_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_047955331.1|2187150_2188035_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_047955332.1|2188024_2188579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955333.1|2189069_2189519_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP011798	Enterobacter ludwigii strain UW5 chromosome, complete genome	4904981	2346947	2430735	4904981	capsid,holin,terminase,tRNA,portal,tail,plate,protease	Escherichia_phage(12.77%)	98	NA	NA
WP_047955374.1|2346947_2348234_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	48.9	1.4e-108
WP_010429804.1|2348233_2348449_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	56.3	4.8e-19
WP_047955375.1|2348510_2348750_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	61.8	7.7e-18
WP_047955376.1|2348736_2350641_-	hypothetical protein	NA	H6WRX1	Salmonella_phage	29.9	2.8e-25
WP_047955377.1|2350863_2351136_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	45.5	3.1e-15
WP_071843302.1|2351566_2351908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955378.1|2351836_2352217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955379.1|2352418_2352910_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	60.3	6.1e-17
WP_047955380.1|2352982_2353252_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.8e-08
WP_047955381.1|2353251_2353704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955382.1|2353726_2354644_+	hypothetical protein	NA	U5P0A0	Shigella_phage	43.4	1.5e-56
WP_047955383.1|2354646_2355387_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	71.9	3.9e-100
WP_047955384.1|2355404_2356061_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	28.3	1.8e-11
WP_047955385.1|2356262_2356736_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	1.5e-65
WP_047955386.1|2356988_2357225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955387.1|2357247_2357502_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	85.0	2.5e-30
WP_047955388.1|2357519_2357780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955389.1|2358546_2358870_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	62.7	9.1e-30
WP_047955391.1|2359361_2359655_+	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	57.0	4.1e-21
WP_047955392.1|2359647_2360016_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.1	5.7e-36
WP_047955393.1|2360008_2360356_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.0	4.0e-55
WP_047955394.1|2360372_2361260_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_032677913.1|2361264_2361783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955395.1|2362192_2363050_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	50.0	9.3e-05
WP_047056281.1|2363242_2363647_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_047955396.1|2363643_2363940_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_047955397.1|2363936_2364566_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	3.0e-101
WP_047955398.1|2364573_2364846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955400.1|2365022_2365307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955401.1|2365743_2366247_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.9	3.1e-48
WP_047955402.1|2366250_2368368_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.4	3.0e-302
WP_023311211.1|2368364_2368580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955403.1|2368588_2370109_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	8.7e-155
WP_047955404.1|2370098_2372177_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	57.9	1.1e-197
WP_047955405.1|2372245_2372581_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	43.6	3.4e-11
WP_047955406.1|2372580_2372937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955407.1|2372938_2373601_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.2	3.2e-21
WP_047955408.1|2373609_2374164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955409.1|2374156_2374780_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	1.2e-06
WP_047955410.1|2374818_2376288_+|tail	tail protein	tail	R9TMQ0	Vibrio_phage	45.4	1.4e-77
WP_047955411.1|2376284_2376791_+|tail	tail protein	tail	NA	NA	NA	NA
WP_047955412.1|2376842_2377130_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_047955413.1|2377244_2379143_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	34.9	4.6e-28
WP_053058873.1|2379139_2379610_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.1	3.2e-15
WP_047955414.1|2379584_2379800_+|tail	tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	44.8	1.5e-07
WP_047955415.1|2379801_2380920_+	late control protein D	NA	R9TNM7	Vibrio_phage	34.0	4.9e-38
WP_047955416.1|2380956_2381310_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	49.1	1.1e-20
WP_047955417.1|2381293_2382208_+|plate	baseplate assembly protein	plate	A0A193GYM8	Enterobacter_phage	48.5	1.6e-63
WP_047955418.1|2382200_2382752_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	42.8	4.6e-29
WP_047955419.1|2384915_2385338_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	49.6	1.6e-26
WP_047955420.1|2386257_2386677_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	3.8e-36
WP_047955421.1|2386679_2387948_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	5.8e-229
WP_047955422.1|2388161_2388641_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047955423.1|2388721_2389390_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.7	2.5e-74
WP_047955424.1|2389801_2391172_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	7.2e-108
WP_014169611.1|2391191_2391821_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_032670452.1|2391848_2392961_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_047955425.1|2393001_2393475_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_047955426.1|2393484_2394138_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_014169617.1|2394255_2395506_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_053058875.1|2396094_2397141_+	beta-mannosidase	NA	NA	NA	NA	NA
WP_040017214.1|2397340_2397691_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_047955428.1|2397767_2398013_+	YmjA family protein	NA	NA	NA	NA	NA
WP_047955429.1|2398256_2398952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955430.1|2398948_2400460_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_080346965.1|2400697_2402218_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_047956216.1|2402399_2403872_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_006174788.1|2404147_2404396_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071605476.1|2404450_2404525_-	protein YoaJ	NA	NA	NA	NA	NA
WP_014883431.1|2404525_2404624_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_047955431.1|2404669_2405698_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	1.6e-14
WP_047955432.1|2406002_2406257_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_020884446.1|2406337_2406643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955433.1|2406643_2406988_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_014169630.1|2407139_2407847_+	CTP synthase	NA	NA	NA	NA	NA
WP_047955434.1|2407877_2409065_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_020884444.1|2409164_2409956_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014169633.1|2409939_2410386_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_014169635.1|2410656_2411157_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_014883442.1|2411271_2412555_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
WP_014169637.1|2412656_2414591_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_047955435.1|2414668_2416603_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	27.1	5.5e-13
WP_156773533.1|2417182_2417350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053058876.1|2417422_2417944_+	hypothetical protein	NA	A0A223LGJ3	Pseudoalteromonas_phage	34.3	1.9e-13
WP_047955436.1|2418016_2418478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955437.1|2418950_2419676_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_131701763.1|2419865_2420126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955439.1|2420156_2420891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955440.1|2421087_2421693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955441.1|2421701_2422265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955442.1|2422325_2422661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955443.1|2422858_2423533_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_071843304.1|2423573_2424383_-	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	55.2	6.2e-83
WP_071843305.1|2424551_2425091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047956218.1|2424996_2426919_+	hypothetical protein	NA	A0A067ZJA1	Vibrio_phage	25.9	1.1e-42
WP_047955444.1|2426928_2427414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047955445.1|2427413_2428925_+|portal	phage portal protein	portal	V5YTM3	Pseudomonas_phage	23.8	6.9e-27
WP_047955446.1|2428881_2430735_+|capsid	phage major capsid protein	capsid	A0A2H4JBW9	uncultured_Caudovirales_phage	26.9	1.9e-23
>prophage 3
NZ_CP011798	Enterobacter ludwigii strain UW5 chromosome, complete genome	4904981	3667582	3673854	4904981		Enterobacteria_phage(50.0%)	6	NA	NA
WP_047366478.1|3667582_3668119_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.8	6.8e-54
WP_047955853.1|3668122_3669001_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_047955854.1|3669052_3669952_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.1	3.9e-30
WP_047955855.1|3669951_3671037_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.3e-100
WP_040017950.1|3671388_3672285_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.4e-43
WP_025203690.1|3672462_3673854_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
>prophage 4
NZ_CP011798	Enterobacter ludwigii strain UW5 chromosome, complete genome	4904981	4638129	4671693	4904981	lysis,tRNA,integrase,plate,tail	Erwinia_phage(38.71%)	39	4644198:4644246	4649136:4649184
WP_020883618.1|4638129_4639143_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	6.3e-109
WP_001144069.1|4639379_4639595_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_025202985.1|4639709_4641455_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.5	2.1e-75
WP_020883616.1|4641605_4643453_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_025202984.1|4643535_4644042_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4644198:4644246	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATT	NA	NA	NA	NA
WP_047956251.1|4644620_4644773_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_047956116.1|4644825_4645329_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	69.5	1.5e-58
WP_047956118.1|4645715_4646306_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.3	2.8e-32
WP_053058887.1|4646307_4647261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047956119.1|4647262_4648306_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.9	1.4e-111
WP_047956120.1|4648289_4649018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025202983.1|4649262_4649463_-	late control protein B	NA	A0A2I8TV89	Erwinia_phage	76.8	6.3e-21
4649136:4649184	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATT	NA	NA	NA	NA
WP_047956121.1|4649530_4650685_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	61.5	1.1e-130
WP_014171677.1|4650681_4651146_-|tail	phage tail protein	tail	O80317	Escherichia_phage	67.9	2.8e-56
WP_047956122.1|4651157_4653605_-|tail	phage tail tape measure protein	tail	Q37848	Escherichia_phage	47.3	2.6e-148
WP_014171679.1|4653597_4653717_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	2.8e-13
WP_014171680.1|4653749_4654058_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	7.6e-26
WP_047956123.1|4654114_4654633_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	2.2e-78
WP_025202978.1|4654644_4655832_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.8	8.8e-187
WP_020883609.1|4655956_4656478_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.9	7.3e-37
WP_032678995.1|4658267_4658798_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.1	3.6e-92
WP_047956124.1|4658790_4659699_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	79.8	1.5e-130
WP_047956125.1|4659704_4660055_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	69.8	2.6e-38
WP_020883605.1|4660051_4660693_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	78.4	2.4e-90
WP_041162863.1|4660802_4661270_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	59.5	1.2e-46
WP_020883602.1|4661377_4661809_-|lysis	phage lysis regulatory protein, LysB family	lysis	O80310	Escherichia_phage	57.7	6.9e-33
WP_047956126.1|4661787_4662297_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.1	2.3e-75
WP_014171693.1|4662280_4662502_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	76.4	9.3e-26
WP_020883600.1|4662492_4662696_-|tail	tail X family protein	tail	A0A218M4L8	Erwinia_phage	74.6	1.8e-23
WP_053058888.1|4662819_4663260_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	77.4	3.6e-53
WP_047956127.1|4663369_4665565_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	74.6	0.0e+00
WP_047956128.1|4665572_4665794_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	73.6	6.0e-25
WP_020883596.1|4665793_4666021_-	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	62.7	6.4e-14
WP_047956129.1|4666088_4666427_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	75.7	3.7e-42
WP_047956130.1|4666714_4667290_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	64.9	4.7e-69
WP_047956131.1|4667561_4668731_+	DNA repair protein	NA	NA	NA	NA	NA
WP_032680231.1|4668731_4669496_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_047956132.1|4669642_4670137_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032679007.1|4670133_4671693_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.4	3.8e-12
