The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011807	Pandoraea faecigallinarum strain DSM 23572 chromosome, complete genome	5241671	949389	1018650	5241671	tRNA,transposase	uncultured_Mediterranean_phage(12.5%)	60	NA	NA
WP_047907080.1|949389_950520_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.4	2.2e-86
WP_047907081.1|950657_951740_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_047907082.1|951818_954152_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_047907083.1|954317_955262_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.1	2.6e-08
WP_047907084.1|955691_957140_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.5	3.3e-103
WP_084663314.1|957168_957846_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_047907085.1|958100_958598_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	34.8	5.6e-18
WP_047907086.1|958694_959483_+	YdcF family protein	NA	NA	NA	NA	NA
WP_047907087.1|959623_960031_+	heme-binding protein	NA	NA	NA	NA	NA
WP_047908786.1|960481_960724_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_047907088.1|960965_961436_-	DUF1857 family protein	NA	NA	NA	NA	NA
WP_047907089.1|961518_961929_-	OsmC family protein	NA	NA	NA	NA	NA
WP_047907090.1|962125_963022_-	pirin family protein	NA	NA	NA	NA	NA
WP_039396348.1|963271_963694_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_044454348.1|963721_964459_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_053059556.1|964490_965210_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_047907091.1|965609_965870_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_084663316.1|965913_966825_-	glutamate racemase	NA	NA	NA	NA	NA
WP_047907092.1|966955_967435_-	bacterioferritin	NA	NA	NA	NA	NA
WP_047907093.1|967718_969242_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_084663318.1|969287_969881_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	31.8	3.2e-20
WP_047907095.1|970039_970933_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047907096.1|971275_973258_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	42.6	1.3e-81
WP_157112228.1|973440_973617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167362672.1|973739_974114_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_047907098.1|974110_976129_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_047907100.1|977486_978623_+	porin	NA	NA	NA	NA	NA
WP_157112220.1|980363_981162_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_084663320.1|981278_982307_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047907101.1|982359_983955_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_157112229.1|984305_985463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047907103.1|985522_987238_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_167362673.1|987307_987721_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_047907105.1|987756_988404_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071386833.1|988447_991768_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	37.9	1.0e-30
WP_047907107.1|991815_992076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071386834.1|992457_993012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047907109.1|993136_993928_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_047907110.1|993904_995167_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_167362674.1|995163_996990_-	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_053059561.1|997600_998641_+	helix-turn-helix transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	35.1	1.6e-06
WP_053059739.1|998801_999371_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_047907113.1|999448_1000258_+	A24 family peptidase	NA	NA	NA	NA	NA
WP_047907114.1|1000325_1000883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084664071.1|1001173_1001518_+	toxin co-regulated pilus biosynthesis Q family protein	NA	NA	NA	NA	NA
WP_053059563.1|1001510_1003169_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_047907115.1|1003179_1004472_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_047907116.1|1004455_1004980_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_053059564.1|1004976_1006518_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_047907117.1|1006528_1007617_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_084663326.1|1007637_1008732_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_047908796.1|1008944_1009325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112231.1|1009357_1009741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064674770.1|1009933_1010659_+	DUF2968 domain-containing protein	NA	NA	NA	NA	NA
WP_157112232.1|1010972_1012075_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047905280.1|1012164_1012431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084663328.1|1012797_1015554_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_157112220.1|1016483_1017281_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071386838.1|1017357_1018452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167362675.1|1018485_1018650_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011807	Pandoraea faecigallinarum strain DSM 23572 chromosome, complete genome	5241671	1717132	1722949	5241671		Staphylococcus_phage(33.33%)	6	NA	NA
WP_047907551.1|1717132_1717933_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	4.6e-14
WP_047907552.1|1717929_1718643_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	3.2e-11
WP_084663438.1|1719019_1720471_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.9	5.6e-18
WP_047907553.1|1720500_1720989_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	47.5	2.0e-28
WP_047907554.1|1720985_1721780_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	68.6	4.4e-110
WP_047907555.1|1721839_1722949_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	8.0e-25
>prophage 3
NZ_CP011807	Pandoraea faecigallinarum strain DSM 23572 chromosome, complete genome	5241671	3256399	3303126	5241671	plate,head,integrase,terminase,capsid,tRNA,tail,portal	Burkholderia_virus(21.43%)	60	3291450:3291465	3312521:3312536
WP_047905199.1|3256399_3257512_-|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	32.1	6.8e-40
WP_047905200.1|3257511_3257955_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	41.7	9.3e-25
WP_053059376.1|3258012_3258642_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_047905202.1|3258638_3259730_-	Mu P family protein	NA	M1PVV2	Vibrio_phage	30.6	4.0e-37
WP_047905203.1|3259746_3260253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905204.1|3260424_3260916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112469.1|3260985_3262371_-	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	31.5	2.3e-05
WP_053059377.1|3262457_3264449_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	45.5	1.4e-24
WP_084664167.1|3264448_3264571_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_047905207.1|3264570_3264861_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_010804693.1|3264863_3265238_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_047905208.1|3265292_3266786_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	42.2	5.3e-96
WP_047905209.1|3266848_3267037_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047905210.1|3267046_3267610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905211.1|3267606_3267939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905212.1|3268159_3269221_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.4	1.8e-53
WP_047905213.1|3269303_3269717_-|head	head decoration protein	head	NA	NA	NA	NA
WP_047905214.1|3269744_3270374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905215.1|3270398_3271286_-	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	39.8	5.8e-50
WP_047908214.1|3271282_3272857_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.3	4.7e-87
WP_084664169.1|3272919_3273150_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_047905217.1|3273196_3275203_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.8	2.2e-145
WP_047905218.1|3275180_3275768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071386881.1|3275901_3276435_-|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	31.5	7.1e-11
WP_157112331.1|3276803_3277277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053059379.1|3277344_3277770_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	49.6	6.8e-33
WP_047905221.1|3277766_3278084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047908217.1|3278080_3278419_-	DUF1064 domain-containing protein	NA	B0VK09	Azospirillum_phage	43.0	9.6e-14
WP_047905222.1|3278738_3279398_-	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	64.8	2.5e-74
WP_053059380.1|3279394_3280297_-	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	39.2	5.3e-35
WP_047905224.1|3280781_3281045_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064674836.1|3281162_3281354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905225.1|3281366_3281675_-	hypothetical protein	NA	E5E3P2	Burkholderia_phage	51.8	1.9e-16
WP_047905226.1|3281831_3282074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905227.1|3282245_3282773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905228.1|3282889_3283273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084663705.1|3283287_3283611_-	helix-turn-helix domain-containing protein	NA	Q6JIG9	Burkholderia_virus	58.9	8.0e-18
WP_047905229.1|3283693_3284074_+	transcriptional regulator	NA	Q6JIH0	Burkholderia_virus	50.0	7.5e-23
WP_157112332.1|3284070_3284799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167362702.1|3284795_3285605_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_084663707.1|3286061_3286298_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_157112333.1|3287281_3287428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905233.1|3287424_3287649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905234.1|3287682_3288603_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	41.2	3.9e-57
WP_064674838.1|3288617_3289136_+	hypothetical protein	NA	I6NP82	Burkholderia_phage	55.2	5.5e-53
WP_071386883.1|3289163_3289805_+	hypothetical protein	NA	R9VX45	Serratia_phage	28.0	3.1e-05
WP_157112334.1|3289889_3290990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905237.1|3290986_3291211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905238.1|3291207_3291618_+	HNH endonuclease	NA	A0A0U4IIE4	Pseudomonas_phage	75.7	6.0e-26
3291450:3291465	attL	GGCATCGATGTCGCTC	NA	NA	NA	NA
WP_047905239.1|3291620_3291938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905240.1|3291970_3292159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905241.1|3292173_3292524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905242.1|3292520_3293627_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.6	4.9e-107
WP_047905243.1|3294007_3295081_+|integrase	site-specific integrase	integrase	A4JWQ7	Burkholderia_virus	38.2	5.3e-58
WP_084664171.1|3295209_3297594_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	31.2	2.4e-34
WP_157112335.1|3297607_3297898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047905245.1|3297912_3299796_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.8	3.2e-66
WP_047905246.1|3299865_3300312_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.5e-22
WP_047908221.1|3300752_3302003_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047905247.1|3302094_3303126_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.2	1.6e-91
3312521:3312536	attR	GGCATCGATGTCGCTC	NA	NA	NA	NA
>prophage 4
NZ_CP011807	Pandoraea faecigallinarum strain DSM 23572 chromosome, complete genome	5241671	3322428	3353843	5241671	transposase,tRNA	Bacillus_phage(22.22%)	27	NA	NA
WP_053059383.1|3322428_3323895_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.7	2.5e-82
WP_047905264.1|3324038_3326357_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	31.1	4.2e-76
WP_047905265.1|3326467_3329329_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.3	6.2e-146
WP_047905266.1|3329359_3330247_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.7	7.7e-71
WP_047905267.1|3330449_3330677_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_047905268.1|3330778_3331309_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_047905269.1|3331573_3332854_+	chloride channel protein	NA	NA	NA	NA	NA
WP_084663711.1|3332917_3334054_-	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_047905271.1|3334145_3334334_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_047905272.1|3334453_3335224_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_047905273.1|3335291_3336563_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_047905274.1|3337019_3339644_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	8.4e-81
WP_047905275.1|3339889_3341113_+	CoA transferase	NA	NA	NA	NA	NA
WP_084663713.1|3341273_3342587_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_047905276.1|3342703_3343330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053059384.1|3343558_3344269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905277.1|3344268_3344634_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_084663715.1|3344648_3344801_-	alpha helical protein	NA	NA	NA	NA	NA
WP_047905278.1|3344814_3345252_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.7	5.2e-12
WP_157112340.1|3345581_3346316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167362748.1|3347006_3347567_+|transposase	transposase	transposase	A0A1B0Z042	Pseudomonas_phage	72.3	3.0e-36
WP_157112341.1|3347612_3348729_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_167362703.1|3348691_3349237_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.3	1.7e-28
WP_047905282.1|3350207_3350684_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_047905283.1|3350664_3351015_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_047905284.1|3351083_3352691_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	33.3	9.4e-59
WP_167362705.1|3353744_3353843_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP011807	Pandoraea faecigallinarum strain DSM 23572 chromosome, complete genome	5241671	3393684	3468182	5241671	head,integrase,terminase,capsid,protease,transposase,tail	Ralstonia_phage(61.76%)	63	3406835:3406850	3441511:3441526
WP_047905311.1|3393684_3395559_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	42.4	4.6e-113
WP_047905312.1|3395678_3396329_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_047905313.1|3396482_3396983_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_047905314.1|3397177_3397693_-	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_047905315.1|3397676_3398153_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_047905316.1|3398462_3401705_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_047905317.1|3401723_3402404_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_047905318.1|3402450_3403596_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.1	1.7e-49
WP_047905319.1|3403790_3404552_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047905320.1|3404711_3406331_-	alpha,alpha-trehalase TreF	NA	NA	NA	NA	NA
WP_047905321.1|3406327_3407095_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	1.2e-22
3406835:3406850	attL	CAGCACGTCGATGCGC	NA	NA	NA	NA
WP_047905322.1|3407382_3408402_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047905323.1|3408996_3410322_+	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_047905324.1|3410451_3411474_+	allantoicase	NA	NA	NA	NA	NA
WP_047905325.1|3411545_3412079_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_047908235.1|3412215_3412626_-	RidA family protein	NA	NA	NA	NA	NA
WP_047905326.1|3412628_3413099_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_047905327.1|3413216_3414860_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	18.2	2.3e-07
WP_047905328.1|3415060_3416257_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_047905329.1|3416259_3417123_-	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_047905330.1|3417294_3418119_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_047905331.1|3418128_3420471_-	bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase	NA	NA	NA	NA	NA
WP_084663725.1|3420710_3422066_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.5	7.6e-86
WP_047908237.1|3422062_3423460_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_047905332.1|3423694_3424612_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064674842.1|3424648_3426064_-	multidrug transporter subunit MdtD	NA	A0A0M3UL24	Mycobacterium_phage	28.1	2.6e-20
WP_047908239.1|3426106_3428008_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	34.7	3.2e-66
WP_047905333.1|3428343_3430038_-	transglycosylase SLT domain-containing protein	NA	I1VXB7	Halocynthia_phage	37.1	2.2e-05
WP_047905334.1|3430575_3431403_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_047905335.1|3431417_3432281_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_047905336.1|3432292_3432739_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	49.6	1.3e-37
WP_047905337.1|3432872_3433613_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	45.1	6.7e-36
WP_064674843.1|3434025_3435045_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	55.9	8.0e-96
WP_053059389.1|3435162_3435498_-	hypothetical protein	NA	A0A0A1I670	Burkholderia_phage	40.7	1.3e-07
WP_157112470.1|3435494_3435974_-	glycoside hydrolase family protein	NA	A0A068Q6I2	Ralstonia_phage	59.5	3.3e-44
WP_047905340.1|3435970_3436186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053059390.1|3436187_3437981_-|terminase	phage terminase large subunit	terminase	A0A1L7DQE6	Ralstonia_phage	78.9	6.0e-280
WP_053059391.1|3437980_3438268_-	hypothetical protein	NA	A0A1L7DQF8	Ralstonia_phage	57.7	9.9e-20
WP_047905341.1|3438264_3438462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053059392.1|3438501_3440145_-	hypothetical protein	NA	B5BTX4	Ralstonia_phage	63.5	2.3e-44
WP_047905342.1|3440221_3445180_-	transglycosylase SLT domain-containing protein	NA	A0A1L7DQA5	Ralstonia_phage	37.7	1.8e-273
3441511:3441526	attR	GCGCATCGACGTGCTG	NA	NA	NA	NA
WP_047905343.1|3445250_3447581_-	hypothetical protein	NA	A0A1L7DQB4	Ralstonia_phage	50.3	3.6e-208
WP_047905344.1|3447598_3448447_-	hypothetical protein	NA	A0A1L7DQA8	Ralstonia_phage	49.1	7.0e-45
WP_047905345.1|3448456_3451018_-	hypothetical protein	NA	A0A1L7DQL7	Ralstonia_phage	61.2	9.1e-306
WP_047905346.1|3451017_3451629_-	hypothetical protein	NA	A0A0A1I5V9	Burkholderia_phage	56.9	3.6e-59
WP_047905347.1|3451702_3452719_-|capsid	capsid protein	capsid	A0A1L7DQF3	Ralstonia_phage	69.8	1.0e-130
WP_053059393.1|3452850_3453627_-	hypothetical protein	NA	A0A1S6L1B7	Ralstonia_phage	53.9	1.4e-52
WP_047905348.1|3453630_3455190_-|head,tail	head-tail joining protein	head,tail	A0A1L7DQD6	Ralstonia_phage	67.3	1.8e-195
WP_157112347.1|3455189_3455525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905350.1|3455602_3456034_-	hypothetical protein	NA	A0A1L7DQB1	Ralstonia_phage	36.8	3.6e-21
WP_167362707.1|3456017_3456188_-	hypothetical protein	NA	A0A0A1I675	Burkholderia_phage	64.8	3.4e-12
WP_047905353.1|3458744_3459437_-	adenylyl-sulfate kinase	NA	A0A1S6L1B9	Ralstonia_phage	53.4	5.3e-51
WP_047905354.1|3459499_3460279_-	ribonuclease H-like domain-containing protein	NA	A0A1S6L1C7	Ralstonia_phage	89.6	3.7e-141
WP_047905355.1|3460297_3460534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084663727.1|3460526_3460895_-	hypothetical protein	NA	A0A1L7DQG2	Ralstonia_phage	69.4	1.6e-38
WP_174554728.1|3460845_3461823_-	hypothetical protein	NA	A0A1L7DQH5	Ralstonia_phage	61.4	6.1e-101
WP_064674844.1|3461823_3462708_-	hypothetical protein	NA	A0A1L7DQE1	Ralstonia_phage	62.6	3.1e-88
WP_053059706.1|3462773_3465173_-	DNA polymerase A family protein	NA	A0A1L7DQB7	Ralstonia_phage	71.1	0.0e+00
WP_047905357.1|3465190_3465445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905358.1|3465441_3465864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112349.1|3465865_3466093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053059394.1|3466098_3467304_-	AAA family ATPase	NA	A0A1L7DQC0	Ralstonia_phage	61.2	5.1e-142
WP_047905360.1|3467357_3468182_-	hypothetical protein	NA	A0A1L7DQD5	Ralstonia_phage	63.0	3.9e-101
>prophage 1
NZ_CP011808	Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence	386625	2047	81331	386625	integrase,transposase,protease	Stx2-converting_phage(22.22%)	55	14853:14904	63308:63359
WP_047909271.1|2047_2773_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.7	4.6e-37
WP_047909272.1|2881_3280_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_047909273.1|3276_3522_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157112497.1|4533_4689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909275.1|4804_5044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909276.1|5336_5609_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_047909277.1|5605_6010_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_053059768.1|6047_8294_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_047909278.1|8401_9070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909279.1|9070_9835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167362753.1|9843_10101_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157112498.1|11610_11760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909281.1|13198_14092_-	hypothetical protein	NA	NA	NA	NA	NA
14853:14904	attL	ACTGCTGCCGGGATCGTAAGCACTTCTGGCCTATGATTTGAGCATAGGAGGA	NA	NA	NA	NA
WP_047909283.1|16667_18074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909286.1|19953_21111_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	5.2e-35
WP_047909217.1|22553_22940_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	47.9	1.4e-13
WP_047909218.1|22936_23284_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	8.0e-40
WP_047909219.1|23313_24876_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.1	3.4e-154
WP_047909220.1|24915_25512_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	32.6	8.1e-24
WP_047909287.1|25585_27193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909288.1|28424_28655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909289.1|28799_30143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112499.1|31114_31267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071386912.1|31519_31873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909292.1|32335_32578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909293.1|32699_34784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053059783.1|35078_35564_-	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	51.7	5.6e-31
WP_047909294.1|35759_37580_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_084664277.1|37982_38270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047906141.1|39367_40423_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	62.6	2.4e-127
WP_047909296.1|40663_41110_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_157112500.1|41681_41831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909300.1|44451_45045_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_084664349.1|46403_47354_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	40.7	4.3e-11
WP_047909302.1|47368_48580_-	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	27.6	2.8e-31
WP_084664360.1|49616_50969_+	replication initiation protein	NA	NA	NA	NA	NA
WP_084664281.1|51080_52334_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_047909304.1|52785_53832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909306.1|55168_57220_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_047909307.1|58085_59996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909415.1|60458_61022_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.1	2.5e-14
WP_047909308.1|61181_61589_-	Hsp20/alpha crystallin family protein	NA	A0A218MM84	uncultured_virus	30.2	5.0e-09
WP_047909416.1|61617_62061_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_047909309.1|62306_62690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112501.1|63789_64743_-	hypothetical protein	NA	NA	NA	NA	NA
63308:63359	attR	TCCTCCTATGCTCAAATCATAGGCCAGAAGTGCTTACGATCCCGGCAGCAGT	NA	NA	NA	NA
WP_157112502.1|65604_66222_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.3	4.8e-35
WP_157112541.1|66510_66810_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.9	4.2e-21
WP_047909313.1|66813_67110_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.6	1.1e-13
WP_047905322.1|70448_71468_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047909419.1|71791_72145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112503.1|72407_74048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909317.1|76668_77493_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	36.3	1.0e-40
WP_047909318.1|79052_79466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112504.1|79438_80555_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.4	4.3e-42
WP_084664285.1|80896_81331_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	47.2	1.2e-11
>prophage 2
NZ_CP011808	Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence	386625	134791	171490	386625	integrase,transposase	Mycobacterium_phage(33.33%)	31	134003:134019	163511:163527
134003:134019	attL	GGCGAACACCTGAAGTG	NA	NA	NA	NA
WP_157112264.1|134791_135590_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_047909350.1|136578_136941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909351.1|136962_137691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909427.1|137702_138170_+	type III secretion protein	NA	NA	NA	NA	NA
WP_047909352.1|138166_139654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909353.1|139672_140356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112510.1|140367_140550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112511.1|140989_142009_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_047909428.1|142228_142609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909355.1|142602_143928_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_047909356.1|143914_145972_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_047909429.1|145955_146336_-	type III secretion protein	NA	NA	NA	NA	NA
WP_047909357.1|146914_148204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909358.1|149104_149458_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.4	4.1e-39
WP_047909359.1|149579_151727_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_047909360.1|151740_152214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909361.1|152388_153414_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	29.0	2.9e-21
WP_064674953.1|153713_154991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084664367.1|155230_155788_-	YitT family protein	NA	NA	NA	NA	NA
WP_047906396.1|156500_157583_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_053059776.1|158285_158510_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_157112512.1|158727_159539_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.1	1.6e-22
WP_167362757.1|159742_162985_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_167362762.1|163644_164340_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	36.0	1.9e-24
163511:163527	attR	GGCGAACACCTGAAGTG	NA	NA	NA	NA
WP_157112513.1|164424_164586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112514.1|165675_166486_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.7	4.7e-22
WP_064674954.1|166641_166965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909369.1|167072_167816_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_084664311.1|167871_167997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047909370.1|168212_169202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909371.1|170266_171490_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.6	1.0e-44
>prophage 3
NZ_CP011808	Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence	386625	178878	248434	386625	holin,integrase,transposase	Leptospira_phage(38.46%)	54	187183:187242	223035:223268
WP_047909369.1|178878_179622_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_167362758.1|179663_180484_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.7	1.5e-20
WP_047909376.1|181651_182023_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_047909377.1|182019_182217_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_167362759.1|182372_182549_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_047909378.1|182550_183414_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	2.4e-48
WP_047909433.1|184064_185627_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.5	8.3e-68
WP_047909134.1|185658_186009_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	5.6e-17
WP_157112517.1|185984_186212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112514.1|186365_187176_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.7	4.7e-22
187183:187242	attL	CTTAAGCGCCAGCCGGGCAATCGACACGCCCGGCCGACGGCATAGCTCGACCAGTCGCCG	NA	NA	NA	NA
WP_047906141.1|191162_192218_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	62.6	2.4e-127
WP_157112518.1|192368_193517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909140.1|193616_194321_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	5.3e-38
WP_047909143.1|195356_196100_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
WP_084664325.1|196168_197038_+	DUF2165 family protein	NA	NA	NA	NA	NA
WP_157112519.1|198638_199456_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.9	8.3e-27
WP_157112520.1|199615_199930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909147.1|199880_203012_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_047909149.1|204347_205577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071386924.1|206832_207186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053059761.1|207395_207764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909151.1|208289_208616_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_047909153.1|208975_211339_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_047909154.1|211794_213291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909155.1|213370_214948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909156.1|216427_217663_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	23.0	5.5e-06
WP_157112521.1|217955_219321_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.5	7.2e-76
WP_047909159.1|219380_219905_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047909160.1|219880_220234_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	3.7e-16
WP_047909161.1|220266_221847_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.4	3.0e-65
WP_047909134.1|222417_222768_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	5.6e-17
WP_047909163.1|222743_223184_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_047909382.1|223691_224201_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
223035:223268	attR	CTTAAGCGCCAGCCGGGCAATCGACACGCCCGGCCGACGGCATAGCTCGACCAGTCGCCGCTTGGCGATGGGGTCGTAGTCACGTTTGCCGTTCGAACGTATGCGTACGACCCGCAGCGGGAAACAGTCGGTTTCGTTGAGTTCATTCATGTTTGCGTCCGCAAAAGTCTTTGCGGACGCAAGCTTGACCCCTGTCGAGCTACCGCGATAGGGCGTCCTTTAATGACGGCTTAC	NA	NA	NA	NA
WP_047909164.1|224264_224987_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_047909383.1|225095_226265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909384.1|227679_228306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112522.1|232673_233015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909167.1|233119_233410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909168.1|233690_233930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112523.1|235672_235891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112524.1|236615_237656_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_047909171.1|237643_238402_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_047909172.1|238398_238983_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047909173.1|238979_239648_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_047909174.1|239745_240630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909175.1|240972_241185_-	CsbD family protein	NA	NA	NA	NA	NA
WP_047905322.1|241472_242492_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_084664329.1|243169_243478_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_047909176.1|243573_243954_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_157112525.1|243967_244504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909387.1|244590_244944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047905322.1|245267_246287_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047909178.1|246419_247124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909179.1|247414_248434_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011808	Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence	386625	272768	330028	386625	integrase,transposase	Escherichia_phage(22.73%)	43	280938:280994	331389:331445
WP_047909197.1|272768_273992_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.3	1.3e-44
WP_047909198.1|273988_274855_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	43.1	3.7e-49
WP_047909199.1|274926_276465_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.7	4.5e-50
WP_157112543.1|276762_277455_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	3.6e-39
WP_047909201.1|277889_278939_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157112526.1|279751_280932_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	4.5e-50
280938:280994	attL	CCTCCGTTCAACAGATTATCCAACTTCTCTGCTGTACGTCGTTTCGAGGCAAGGTCA	NA	NA	NA	NA
WP_157112527.1|281990_282155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909205.1|282752_284441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053059763.1|284638_285040_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_047909206.1|285168_286665_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_064674960.1|287752_289099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112528.1|289604_290416_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.1	6.1e-22
WP_047909212.1|291090_292674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047906187.1|292905_293940_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_047909213.1|294312_294738_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_047909214.1|294734_294974_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_047909397.1|295203_295896_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	1.0e-38
WP_047906396.1|297060_298143_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157112529.1|298295_299675_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2L1IV91	Escherichia_phage	73.9	2.0e-198
WP_047909216.1|299671_300628_+	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	82.9	7.1e-155
WP_047909217.1|300938_301325_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	47.9	1.4e-13
WP_047909218.1|301321_301669_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	8.0e-40
WP_047909219.1|301698_303261_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.1	3.4e-154
WP_047909220.1|303300_303897_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	32.6	8.1e-24
WP_157112530.1|304520_305337_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.9	1.1e-26
WP_064674961.1|305379_307506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064674970.1|308093_308804_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	5.9e-37
WP_047909226.1|309374_309815_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_047909134.1|309790_310141_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	5.6e-17
WP_047909161.1|310711_312292_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.4	3.0e-65
WP_047909160.1|312324_312678_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	3.7e-16
WP_047909159.1|312653_313178_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157112531.1|313236_314603_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.5	7.2e-76
WP_084664337.1|314709_315162_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157112532.1|315261_316018_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.3	4.4e-22
WP_157112533.1|316494_317844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909231.1|318114_319170_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	60.2	1.1e-119
WP_167362675.1|319217_319382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047909232.1|319506_322506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909400.1|322809_323211_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_047909401.1|323213_323510_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_047909234.1|326433_327363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909156.1|328792_330028_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	23.0	5.5e-06
331389:331445	attR	CCTCCGTTCAACAGATTATCCAACTTCTCTGCTGTACGTCGTTTCGAGGCAAGGTCA	NA	NA	NA	NA
>prophage 1
NZ_CP011809	Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-2, complete sequence	104368	11644	83449	104368	transposase,integrase	Streptococcus_phage(33.33%)	53	65835:65894	87431:88277
WP_047909179.1|11644_12664_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047906141.1|12857_13913_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	62.6	2.4e-127
WP_047909482.1|14168_14873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909519.1|14921_15275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909483.1|15361_15595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047906141.1|15778_16834_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	62.6	2.4e-127
WP_047909484.1|17287_17500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909485.1|17795_18074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112545.1|18158_19727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909487.1|19833_20568_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	33.0	2.1e-21
WP_047909488.1|21957_22194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064674971.1|22384_23125_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_047909491.1|23204_24107_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_167362763.1|24884_25181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112220.1|25484_26283_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_047909493.1|27521_29489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909494.1|29844_30108_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_157112220.1|30167_30965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_047909495.1|30974_31418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909496.1|31499_32237_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.5	4.5e-24
WP_047909497.1|33754_36007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157112546.1|36936_38112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909496.1|40410_41148_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.5	4.5e-24
WP_047909499.1|41419_41710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909500.1|41706_41991_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_167362764.1|42152_42950_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_047909502.1|42981_43251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071386935.1|48465_49434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047907355.1|50669_51467_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.9	4.9e-32
WP_047908873.1|51459_52965_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.9	3.8e-17
WP_047909438.1|53936_55817_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_047906187.1|58150_59185_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_174554750.1|59560_60787_+	AAA family ATPase	NA	A0A1I9KF58	Aeromonas_phage	28.6	1.1e-30
WP_053059786.1|60783_61803_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_053059787.1|62116_63469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047909440.1|63991_64321_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_174554751.1|64292_64556_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_047909442.1|65014_65758_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.5	4.6e-24
65835:65894	attL	GGTATTGTCAGGTTGTTCGGATGGGGGAGGCGGAAGGATAGAATGCGACATGAAAAAATT	NA	NA	NA	NA
WP_047909443.1|65883_66621_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.5	7.7e-24
WP_047909445.1|67535_68504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112549.1|68478_68787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909447.1|69592_69907_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_047909448.1|70308_71043_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	31.9	1.4e-20
WP_157112550.1|71800_72603_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.7	6.4e-24
WP_157112551.1|72739_73366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157112552.1|73319_73724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084664397.1|73754_74489_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	31.9	1.4e-20
WP_047909453.1|75226_75604_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047909454.1|75584_75920_+	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	34.2	2.5e-06
WP_047909156.1|78006_79242_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	23.0	5.5e-06
WP_084664403.1|79770_80400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047909512.1|80417_81542_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_047909456.1|81769_83449_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
87431:88277	attR	GGTATTGTCAGGTTGTTCGGATGGGGGAGGCGGAAGGATAGAATGCGACATGAAAAAATTTTCAGTCAGCCCCCAGCGCTCGAGCGACGCGGCGATCTCGTTCAAAGGCTACCGATTTCCGCCTGACATTATCCGCTATGCGGTGTGGCTGTATTACCGGTTTCCGCTGAGTCTACGCATGGTCGAGGAAATGTTGGCCGCGCGGGGGATTGAGCTGACCTACGAGACGGTACGGTGCTGGGCGACGAAGTTCGGTCTGGCCATCGCCGGGCGTATTCGATCGACGTCCCCGAGGCGCGGCGACAAATGGCATCTTGACGAGGTGGTCGTGACAATCCACGGCAAAAAACATTGGCTGTGGCGAGCGGTGGACGAACACGGCGCGCTGCTTGAGGTGCTGGTGCAAAGCCGTCGCGACACGGCCGCCGCCAAACGGCTCATGCGCCGCCTGCTCAAGCGCCATGGCGGCGCGCGCGTGATCGTCACGGATAAACTGCGCAGCTATGCGGCGGCCCACCGCGAGCTCGGGCTAAGCGTCGAACACCGCCAGCATAAAGGTTTGAACAACCGGGCGGAGAATTCGCATCAGCCTACGCGGGTGCGGGAGAAAGTGATGCGTCGCTTTAAGTCGGCACGCCAATTGCAGCGCTTCGCCTCAATCCACGGTCAGGTTTCGAACCTGTTCATGGCGTGCCGCTATCACCGCAATGCCGAGCAAAAACGTGCGGCGCGCACCCAGGCCTTCGCCGCCTGGGAATGGGCTTGCTCCACCCGCATGGCGGCGTAAGGGCGTCGTTTTCTGCCATGGTACCTTGGCTCGGTTTCAACTAAACAACCTGACAATACC	NA	NA	NA	NA
