The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007689	Listeria monocytogenes strain L2074 chromosome, complete genome	2897190	635406	696610	2897190	tRNA,protease	Streptococcus_phage(16.67%)	59	NA	NA
WP_003732816.1|635406_637113_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723454.1|637152_638415_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_047932493.1|638428_639571_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003727496.1|639585_640374_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003732812.1|640387_641146_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003723450.1|641375_641933_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723449.1|641932_642661_-	UMP kinase	NA	NA	NA	NA	NA
WP_003723448.1|642953_643328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072217143.1|643305_644511_+	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	3.7e-92
WP_003723446.1|644500_645805_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_003723445.1|645814_646321_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723444.1|646342_647074_+	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	59.1	1.2e-80
WP_003723443.1|647092_647935_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003723442.1|647985_648225_-	YneF family protein	NA	NA	NA	NA	NA
WP_047932497.1|648445_650440_-	transketolase	NA	NA	NA	NA	NA
WP_003723440.1|650586_650814_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003723439.1|650905_651235_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723438.1|651392_652007_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_031674623.1|652036_652558_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003723436.1|652601_653897_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	61.6	1.8e-145
WP_003723435.1|654040_655375_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003719570.1|655445_655814_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989728.1|656017_657244_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_022741839.1|657236_658460_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003719566.1|658570_658804_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012951578.1|658926_659844_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003723738.1|659969_661646_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_012951577.1|661878_662577_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	9.9e-13
WP_026749937.1|662789_664658_+	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_031674621.1|664691_666506_-	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_047932505.1|666837_668571_-	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_009913867.1|668897_669365_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_010989723.1|669447_671907_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	4.7e-102
WP_003723731.1|671903_673871_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_003732802.1|674051_674459_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_031674617.1|674616_675213_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003724131.1|675254_676127_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724130.1|676129_676441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003724129.1|676462_676882_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003726695.1|676984_677764_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_031674616.1|677784_679194_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.7	1.7e-43
WP_003724001.1|679207_679747_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_009911635.1|679767_680670_-	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_009924616.1|680952_682257_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009924617.1|682319_684398_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.7	1.4e-107
WP_003723892.1|684668_685529_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003723891.1|685662_686448_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723890.1|686444_687308_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723889.1|687317_687860_-	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723888.1|687961_688531_-	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723887.1|688565_689132_-	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723886.1|689250_690510_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_047932516.1|690695_691979_-	trigger factor	NA	NA	NA	NA	NA
WP_014600790.1|692093_693032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732795.1|693293_693959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047932518.1|693976_694510_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_047932521.1|694628_694844_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003723563.1|694994_695390_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003723562.1|695470_696610_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP007689	Listeria monocytogenes strain L2074 chromosome, complete genome	2897190	829633	837055	2897190		Hokovirus(33.33%)	8	NA	NA
WP_003736259.1|829633_831190_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	7.8e-18
WP_003730540.1|831318_831723_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_009925410.1|831782_832091_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_031674562.1|832103_832928_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.3	8.8e-69
WP_003721509.1|832939_834430_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_026749862.1|834638_835652_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_031674558.1|835666_836650_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	1.2e-11
WP_003721506.1|836671_837055_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
>prophage 3
NZ_CP007689	Listeria monocytogenes strain L2074 chromosome, complete genome	2897190	1790764	1799050	2897190		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1790764_1791331_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_003722244.1|1791327_1792377_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.2	1.0e-61
WP_003722245.1|1792395_1793823_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_031671881.1|1793807_1796027_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	1.7e-159
WP_031671882.1|1796019_1796703_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015454911.1|1796706_1796952_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014931516.1|1796963_1797677_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	37.8	8.8e-41
WP_020246648.1|1797757_1799050_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 4
NZ_CP007689	Listeria monocytogenes strain L2074 chromosome, complete genome	2897190	2463142	2470986	2897190		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2463142_2464114_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2464121_2465090_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_010990001.1|2465091_2465967_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_031672028.1|2466074_2467805_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	3.3e-174
WP_009930954.1|2467846_2468908_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952019.1|2468924_2469908_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_003722610.1|2470026_2470986_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 5
NZ_CP007689	Listeria monocytogenes strain L2074 chromosome, complete genome	2897190	2557446	2627817	2897190	holin,protease,integrase,terminase,tail,tRNA	Listeria_phage(84.75%)	89	2589277:2589326	2627905:2627954
WP_003723609.1|2557446_2559117_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|2559113_2559563_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_031674805.1|2559640_2560294_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003723612.1|2560367_2560553_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_009924630.1|2560587_2561910_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	2.6e-30
WP_003723614.1|2561924_2562761_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003729274.1|2563078_2563279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723616.1|2563300_2563624_-	YxeA family protein	NA	NA	NA	NA	NA
WP_077421966.1|2563778_2565440_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003726112.1|2565575_2566190_-	SdpI family protein	NA	NA	NA	NA	NA
WP_009926161.1|2566213_2566846_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003723621.1|2566846_2567371_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_012952036.1|2567373_2568372_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003723623.1|2568468_2568741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723624.1|2568789_2569701_-	cation transporter	NA	NA	NA	NA	NA
WP_047933314.1|2569826_2574419_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_003733264.1|2574639_2575467_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_047933315.1|2575581_2576457_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_047933317.1|2576467_2576761_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003733262.1|2576793_2576955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723280.1|2577023_2577692_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	5.0e-38
WP_047933321.1|2577691_2578780_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047933324.1|2578858_2580238_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	47.5	2.0e-57
WP_047933328.1|2580234_2580912_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	47.5	4.4e-58
WP_014931680.1|2580958_2581744_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_003723285.1|2581805_2582282_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_046335584.1|2582281_2585269_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_009931305.1|2585767_2586610_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_003733258.1|2586657_2588139_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003723289.1|2588239_2589127_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2589277:2589326	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_031667946.1|2589759_2590023_+	anti-CRISPR protein AcrIIA4	NA	A0A2D0TCG7	unidentified_phage	96.6	4.6e-40
WP_047933338.1|2590027_2590477_+	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	98.0	1.3e-74
WP_047933342.1|2590560_2590755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003733663.1|2590855_2591701_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	94.7	2.7e-137
WP_003722522.1|2591700_2591982_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2591994_2592360_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_047933347.1|2592398_2594564_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	94.2	0.0e+00
WP_047933349.1|2594576_2596145_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	98.5	1.3e-302
WP_047933352.1|2596141_2600932_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	94.2	0.0e+00
WP_072225507.1|2600936_2601248_-	hypothetical protein	NA	A8ATV8	Listeria_phage	98.9	1.2e-42
WP_015987409.1|2601244_2601676_-	hypothetical protein	NA	A8ATV7	Listeria_phage	100.0	9.6e-75
WP_015987408.1|2601731_2602418_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	100.0	9.4e-117
WP_003725064.1|2602422_2602794_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_015987407.1|2602790_2603108_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	100.0	9.9e-53
WP_015987430.1|2603097_2603463_-	hypothetical protein	NA	A8ATV3	Listeria_phage	100.0	4.4e-65
WP_012951937.1|2603462_2603816_-	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_172425835.1|2603816_2603984_-	hypothetical protein	NA	A8ATV1	Listeria_phage	100.0	1.7e-11
WP_015987427.1|2603997_2604870_-	F420-dependent oxidoreductase	NA	A8ATV0	Listeria_phage	100.0	1.2e-161
WP_015987425.1|2604892_2605447_-	hypothetical protein	NA	A8ATU9	Listeria_phage	100.0	2.3e-89
WP_015987421.1|2605542_2606583_-	hypothetical protein	NA	A8ATU8	Listeria_phage	100.0	1.6e-200
WP_015987416.1|2606587_2608144_-	hypothetical protein	NA	A8ATU7	Listeria_phage	100.0	4.8e-302
WP_047933366.1|2608158_2609505_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.5	5.9e-264
WP_015987406.1|2609470_2610211_-	hypothetical protein	NA	A8ATU5	Listeria_phage	100.0	3.7e-135
WP_012951944.1|2610250_2610478_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_047933369.1|2610558_2611191_-	hypothetical protein	NA	A8AU05	Listeria_phage	99.5	5.3e-114
WP_015967178.1|2611372_2611807_-	hypothetical protein	NA	A8AU03	Listeria_phage	100.0	5.1e-76
WP_015967177.1|2611825_2611990_-	hypothetical protein	NA	A8AU02	Listeria_phage	100.0	3.9e-21
WP_003769966.1|2612118_2612523_-	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	100.0	5.4e-72
WP_014601286.1|2612488_2612629_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_015967175.1|2612625_2612931_-	hypothetical protein	NA	A8ATZ8	Listeria_phage	100.0	1.7e-46
WP_015967174.1|2612962_2613445_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	100.0	1.1e-82
WP_015967173.1|2613441_2613843_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	100.0	1.4e-67
WP_015967170.1|2614286_2614685_-	hypothetical protein	NA	A8ATZ3	Listeria_phage	100.0	4.4e-66
WP_047933379.1|2614681_2614891_-	hypothetical protein	NA	A8ATE0	Listeria_phage	92.8	3.5e-30
WP_023552342.1|2614993_2615584_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	67.3	3.7e-29
WP_047933382.1|2615580_2615790_-	hypothetical protein	NA	A8ATE0	Listeria_phage	91.3	7.7e-30
WP_047933386.1|2615786_2616302_-	hypothetical protein	NA	C9E2P0	Enterococcus_phage	46.2	1.1e-32
WP_047933389.1|2616405_2616624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047933392.1|2616620_2617214_-	DUF1642 domain-containing protein	NA	A8ATD8	Listeria_phage	60.0	5.9e-59
WP_047933393.1|2617210_2617420_-	hypothetical protein	NA	A8ASN7	Listeria_phage	88.4	2.8e-24
WP_047933395.1|2617416_2617701_-	hypothetical protein	NA	A0A059T7N1	Listeria_phage	94.7	5.2e-45
WP_009931092.1|2617716_2617884_-	hypothetical protein	NA	A8ASN5	Listeria_phage	92.7	8.9e-21
WP_047933398.1|2617972_2618887_-	hypothetical protein	NA	A0A0B5D175	Listeria_phage	35.8	1.3e-15
WP_047933399.1|2618907_2619717_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A290GJV0	Caldibacillus_phage	54.3	2.1e-78
WP_003753535.1|2619670_2620552_-	hypothetical protein	NA	A0A2P1JTZ5	Anoxybacillus_phage	58.6	3.4e-87
WP_003727754.1|2620548_2620752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989962.1|2620968_2621157_-	hypothetical protein	NA	Q9T175	Listeria_phage	79.0	2.0e-21
WP_031644321.1|2621258_2621465_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047933406.1|2621454_2621985_-	hypothetical protein	NA	A0A0B5D173	Listeria_phage	87.9	3.9e-78
WP_003733683.1|2622110_2622887_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	97.7	6.9e-140
WP_003733684.1|2622950_2623148_+	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_003722567.1|2623149_2623431_-	hypothetical protein	NA	A8ATX8	Listeria_phage	95.7	1.8e-37
WP_003733686.1|2623456_2623741_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	85.1	4.5e-41
WP_003733687.1|2623752_2623947_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003733688.1|2623967_2624177_-	helix-turn-helix domain-containing protein	NA	A0A0B5D0D3	Listeria_phage	95.6	3.5e-30
WP_003724014.1|2624342_2624765_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	98.6	7.7e-69
WP_003724015.1|2624780_2625206_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	100.0	2.2e-76
WP_003724016.1|2625220_2625928_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	100.0	2.8e-124
WP_047933409.1|2626653_2627817_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.2	5.8e-50
2627905:2627954	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
>prophage 6
NZ_CP007689	Listeria monocytogenes strain L2074 chromosome, complete genome	2897190	2789644	2799676	2897190		Tupanvirus(33.33%)	7	NA	NA
WP_003722116.1|2789644_2791798_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	4.0e-44
WP_015456051.1|2791821_2793594_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_003722118.1|2793754_2795221_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003722119.1|2795508_2796039_-	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	2.6e-29
WP_031672065.1|2796096_2797707_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.9e-46
WP_072215787.1|2797885_2798194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003725314.1|2798221_2799676_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
