The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010423	Pragia fontium strain 24613 chromosome, complete genome	4094629	1151478	1237770	4094629	terminase,integrase,holin,head,tail,protease,capsid,portal,lysis	Enterobacteria_phage(14.06%)	107	1164808:1164823	1219716:1219731
WP_047780212.1|1151478_1152195_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	36.8	2.9e-28
WP_047780213.1|1152334_1152694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082119023.1|1153201_1153462_+|holin	holin	holin	F1C5D1	Cronobacter_phage	50.0	2.2e-18
WP_047780215.1|1153451_1153877_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	57.0	3.1e-33
WP_047780216.1|1153873_1154275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780217.1|1154557_1154965_+	hypothetical protein	NA	A0A2H4J4N2	uncultured_Caudovirales_phage	23.5	2.0e-05
WP_047780218.1|1155031_1155691_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.8	3.4e-55
WP_047780219.1|1155807_1156119_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	59.2	1.7e-28
WP_047780220.1|1156166_1156421_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	43.7	6.3e-10
WP_047780221.1|1156423_1159072_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	26.5	2.0e-58
WP_047780222.1|1159071_1159416_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	39.1	3.3e-17
WP_047780223.1|1159423_1160173_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	57.0	2.5e-78
WP_047780224.1|1160176_1160890_+	peptidase P60	NA	Q9MCU3	Escherichia_phage	64.8	6.8e-94
WP_047780225.1|1161063_1161696_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	54.3	1.5e-52
WP_047780226.1|1161751_1164925_+	host specificity protein J	NA	F1C571	Cronobacter_phage	58.0	0.0e+00
1164808:1164823	attL	CGGAACGTTTGAATTG	NA	NA	NA	NA
WP_047780227.1|1164924_1165227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780228.1|1165226_1165895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780229.1|1165904_1167974_+|tail	tail fiber domain-containing protein	tail	Q9F4J1	Streptococcus_phage	30.5	3.1e-06
WP_047780230.1|1168360_1168858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780231.1|1168862_1169945_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	45.1	1.9e-95
WP_047780232.1|1169962_1170400_+	DUF3277 family protein	NA	I3PGV0	Xanthomonas_phage	45.5	1.1e-30
WP_047780233.1|1170491_1170908_+	hypothetical protein	NA	E5AGB6	Erwinia_phage	47.2	5.9e-21
WP_047780234.1|1170907_1171108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780235.1|1171104_1173213_+	tape measure protein	NA	I3PGV2	Xanthomonas_phage	30.7	4.9e-07
WP_047780236.1|1173209_1173896_+	hypothetical protein	NA	E5AGB8	Erwinia_phage	34.8	7.4e-21
WP_047780237.1|1173913_1174237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053007527.1|1174406_1175372_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	41.5	1.8e-60
WP_047780238.1|1175358_1176024_+	hypothetical protein	NA	I3PGV6	Xanthomonas_phage	43.4	1.1e-37
WP_047780239.1|1176020_1176374_+	hypothetical protein	NA	I3PGV7	Xanthomonas_phage	55.8	1.7e-29
WP_047780240.1|1176373_1177795_+	hypothetical protein	NA	E5AGC3	Erwinia_phage	35.8	9.8e-68
WP_047780241.1|1177791_1178535_+	DUF2612 domain-containing protein	NA	A0A142IEZ9	Pseudomonas_phage	27.2	3.6e-05
WP_071845540.1|1178648_1179191_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	48.4	8.4e-28
WP_053007529.1|1179190_1179781_+|tail	tail assembly chaperone	tail	K7PMH7	Enterobacteria_phage	39.2	3.7e-29
WP_158487454.1|1180096_1180810_+|integrase	integrase	integrase	Q9MCR6	Enterobacteria_phage	50.8	1.4e-38
WP_053007530.1|1180974_1181181_-	hypothetical protein	NA	A0A218M4J2	Erwinia_phage	47.6	1.9e-09
WP_053007531.1|1181184_1181403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780243.1|1181855_1182419_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	70.2	6.9e-65
WP_053007532.1|1182586_1183453_+|tail	tail fiber protein	tail	A0A2K9VKP4	Shigella_phage	42.0	9.7e-26
WP_047780244.1|1183643_1185209_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_053007533.1|1185192_1186293_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_047780245.1|1186873_1187569_-	pirin family protein	NA	NA	NA	NA	NA
WP_047780246.1|1187755_1188403_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_047780247.1|1188621_1189014_-	glyoxalase	NA	NA	NA	NA	NA
WP_047780248.1|1189177_1189504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780249.1|1189754_1191083_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_082118940.1|1191280_1193389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047782523.1|1193669_1194575_+	diaminopimelate dehydrogenase	NA	NA	NA	NA	NA
WP_047780251.1|1194670_1195822_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	2.7e-84
WP_047780252.1|1196321_1197221_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_047780253.1|1197240_1197600_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_047782524.1|1198129_1199551_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.1	1.4e-101
WP_047780254.1|1199559_1200036_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	46.9	4.6e-30
WP_047780255.1|1200157_1201474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780256.1|1201665_1202220_-	membrane protein	NA	NA	NA	NA	NA
WP_144413099.1|1202304_1202493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780257.1|1203082_1203322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780258.1|1203596_1204424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780259.1|1204717_1205893_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.1	2.0e-146
WP_047780261.1|1206046_1206337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144413100.1|1206338_1206644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780263.1|1206715_1207054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780264.1|1207047_1207242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780265.1|1207238_1207469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780266.1|1207461_1207743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780267.1|1207735_1208080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780268.1|1208158_1208545_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	40.5	8.4e-14
WP_047780269.1|1208547_1208742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780270.1|1208734_1208929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780271.1|1208918_1209143_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	56.5	7.8e-12
WP_047780272.1|1209142_1209466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780273.1|1209458_1209644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780274.1|1209636_1209861_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_047780275.1|1210061_1210715_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	42.4	2.7e-44
WP_047782525.1|1211056_1211314_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	55.6	5.4e-17
WP_047780277.1|1211567_1211849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780278.1|1211909_1213532_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	73.1	1.8e-227
WP_047780279.1|1213528_1214509_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.6	4.2e-118
WP_047780280.1|1214505_1215147_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	72.8	5.6e-87
WP_047782526.1|1215155_1216013_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	53.0	2.4e-77
WP_047780281.1|1216012_1216393_+	antitermination protein	NA	A0A088CD47	Shigella_phage	73.6	1.1e-50
WP_047780282.1|1216501_1216834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126468243.1|1217042_1217297_+|holin	holin	holin	F1C5D1	Cronobacter_phage	58.0	3.0e-20
WP_047780283.1|1217289_1217682_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	62.3	1.1e-37
WP_053007534.1|1217678_1218137_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	38.7	7.4e-17
WP_047780284.1|1218302_1218488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780285.1|1218866_1219217_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	70.4	3.2e-44
WP_047780286.1|1219213_1219420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780287.1|1219560_1220016_+|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	54.5	5.6e-25
1219716:1219731	attR	CGGAACGTTTGAATTG	NA	NA	NA	NA
WP_047780288.1|1220018_1221737_+|terminase	terminase large subunit	terminase	A0A1J0GUY5	Halomonas_phage	61.8	5.1e-220
WP_047780290.1|1221890_1223105_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	72.8	5.1e-174
WP_047780291.1|1223097_1223697_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	78.4	2.9e-85
WP_047782528.1|1223718_1224942_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	2.7e-159
WP_047780292.1|1225027_1225342_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.5	1.6e-15
WP_047780293.1|1225338_1225674_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_047780294.1|1225670_1226048_+	hypothetical protein	NA	A0A1W6JP15	Morganella_phage	43.3	1.0e-19
WP_047780295.1|1226044_1226374_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	42.5	8.5e-15
WP_047780296.1|1226440_1226911_+	hypothetical protein	NA	A0A1P8DTJ5	Proteus_phage	49.7	2.6e-33
WP_047780297.1|1226910_1227300_+	hypothetical protein	NA	S4TSQ0	Salmonella_phage	44.3	1.0e-19
WP_053007535.1|1227323_1227617_+	DUF4035 domain-containing protein	NA	K7PJX0	Enterobacterial_phage	62.3	4.7e-17
WP_158487418.1|1227778_1230787_+	tape measure protein	NA	A0A0H5AWE4	Pseudomonas_phage	33.1	1.7e-37
WP_047780300.1|1230790_1231120_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	50.9	1.1e-27
WP_047780301.1|1231153_1231498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780302.1|1231560_1232268_+|tail	phage minor tail protein L	tail	A0A0M3LPJ6	Mannheimia_phage	50.4	6.0e-66
WP_047780303.1|1232272_1232998_+	C40 family peptidase	NA	K7PLW1	Enterobacteria_phage	58.8	7.4e-88
WP_047780304.1|1232940_1233504_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	36.1	6.3e-18
WP_144413101.1|1233504_1234164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053007536.1|1234218_1237770_+	hypothetical protein	NA	C6ZCZ5	Enterobacteria_phage	41.9	2.4e-227
>prophage 2
NZ_CP010423	Pragia fontium strain 24613 chromosome, complete genome	4094629	1468203	1526129	4094629	tRNA,terminase,protease,holin,integrase,head,tail,lysis	Cronobacter_phage(14.0%)	79	1479006:1479051	1527390:1527435
WP_047780484.1|1468203_1468854_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_047780485.1|1468824_1469511_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	8.5e-33
WP_047780486.1|1469507_1471943_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047780487.1|1472020_1473088_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_047780488.1|1473084_1473594_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_047780489.1|1473823_1474558_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_047780490.1|1474568_1475069_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_047782554.1|1475759_1476116_+	RidA family protein	NA	NA	NA	NA	NA
WP_047780491.1|1476295_1477687_+|tRNA	cysteine--tRNA ligase	tRNA	F1C984	Moumouvirus	34.4	1.0e-45
WP_047780492.1|1477757_1478618_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.7	1.9e-29
1479006:1479051	attL	CTTCTAAGCCGTAGGTCGCAGGTTCGAATCCTGCTGGGGGCGCCAT	NA	NA	NA	NA
WP_047780493.1|1479069_1480227_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	77.7	8.9e-176
WP_047780494.1|1480645_1480933_-	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	56.8	4.2e-18
WP_047780495.1|1480929_1481475_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	60.7	1.5e-56
WP_047780496.1|1481519_1481750_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.0	3.8e-14
WP_047780499.1|1482208_1482571_-	DUF2591 family protein	NA	A0A0K0MDE9	Pseudoalteromonas_phage	44.2	1.1e-12
WP_047780500.1|1482560_1482749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780501.1|1482748_1482964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780503.1|1483196_1483565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780504.1|1483554_1483941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780505.1|1483943_1484156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053007546.1|1484152_1485064_-	hypothetical protein	NA	A0A0U1UNM2	Pseudomonas_phage	54.7	4.0e-22
WP_047780506.1|1485060_1485243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780507.1|1485235_1485721_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	66.4	3.4e-60
WP_047780508.1|1485710_1486469_-	site-specific DNA-methyltransferase	NA	A0A2I7RXU5	Vibrio_phage	57.7	3.2e-81
WP_047780509.1|1486465_1486744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780510.1|1486753_1486999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780511.1|1487021_1487588_-	hypothetical protein	NA	A0A2I7QTL0	Vibrio_phage	37.9	3.8e-31
WP_047780512.1|1487597_1488059_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	81.9	8.4e-53
WP_047780513.1|1488058_1488922_-	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	54.2	1.6e-60
WP_047780514.1|1488924_1489596_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_047780515.1|1489592_1489796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082118945.1|1489985_1490759_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	69.9	4.6e-27
WP_047780516.1|1490848_1491466_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	42.0	4.8e-35
WP_144413107.1|1491494_1491791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780518.1|1492256_1492697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071845445.1|1492696_1493179_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.8	2.9e-32
WP_047780519.1|1493175_1493418_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	53.8	1.6e-15
WP_053007548.1|1493618_1494290_-	LexA family transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	42.0	1.9e-37
WP_047780520.1|1494382_1494601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780521.1|1494639_1494972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158487426.1|1495008_1495161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053007549.1|1495153_1496323_+	hypothetical protein	NA	E5AGE9	Erwinia_phage	59.3	8.4e-73
WP_047780522.1|1496319_1497684_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	69.7	4.1e-180
WP_047780523.1|1497667_1497877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780524.1|1497876_1498320_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	55.5	1.8e-44
WP_047780525.1|1498319_1498523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780526.1|1498515_1499103_+	hypothetical protein	NA	A0A077KCD7	Edwardsiella_phage	45.6	7.2e-41
WP_047782561.1|1499105_1499603_+	antiterminator	NA	H6WZJ5	Escherichia_phage	66.0	1.8e-56
WP_126468243.1|1499946_1500201_+|holin	holin	holin	F1C5D1	Cronobacter_phage	58.0	3.0e-20
WP_047780283.1|1500193_1500586_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	62.3	1.1e-37
WP_053007534.1|1500582_1501041_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	38.7	7.4e-17
WP_047780284.1|1501206_1501392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780528.1|1501524_1502091_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	60.6	1.4e-52
WP_047780529.1|1502087_1503644_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	83.1	1.8e-272
WP_047780530.1|1503648_1505076_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	67.2	1.7e-173
WP_047780531.1|1505082_1506114_+|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	46.3	1.6e-83
WP_047780532.1|1506202_1506883_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	64.2	5.6e-53
WP_047780533.1|1506886_1507840_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	79.0	8.7e-137
WP_047780534.1|1507842_1508220_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	58.7	2.2e-30
WP_047780535.1|1508396_1508762_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	50.4	3.8e-24
WP_047780536.1|1508764_1509133_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	64.8	5.2e-37
WP_047780537.1|1509129_1509510_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	58.3	1.8e-37
WP_047780538.1|1509579_1510332_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	85.3	2.7e-72
WP_047780540.1|1510517_1511057_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	74.4	7.7e-74
WP_047780541.1|1511129_1511795_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	54.9	2.1e-65
WP_053007550.1|1511784_1515444_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	40.8	1.1e-160
WP_047780542.1|1515484_1515724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071845446.1|1516348_1516522_+	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	62.3	3.0e-11
WP_047780543.1|1516598_1517336_+	hypothetical protein	NA	Q71TC0	Escherichia_phage	44.8	9.1e-41
WP_047780544.1|1517335_1517542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780545.1|1518025_1518394_+	hypothetical protein	NA	A0A2H4J9F9	uncultured_Caudovirales_phage	45.2	1.6e-22
WP_047780546.1|1518449_1518797_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	80.9	7.7e-51
WP_047780547.1|1518834_1519539_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	87.2	2.9e-121
WP_047780548.1|1519538_1520258_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	69.7	2.1e-103
WP_047780549.1|1520200_1520710_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	62.6	5.3e-48
WP_047780550.1|1520719_1523854_+	host specificity protein J	NA	I6R9B3	Salmonella_phage	77.2	0.0e+00
WP_047780551.1|1523853_1524159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780552.1|1524161_1524803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413108.1|1525871_1526129_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	62.7	3.5e-24
1527390:1527435	attR	CTTCTAAGCCGTAGGTCGCAGGTTCGAATCCTGCTGGGGGCGCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP010423	Pragia fontium strain 24613 chromosome, complete genome	4094629	1838758	1900870	4094629	protease,tRNA,plate	Bodo_saltans_virus(15.38%)	52	NA	NA
WP_047780810.1|1838758_1839805_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	33.7	4.9e-24
WP_047780811.1|1840221_1840473_-	YciN family protein	NA	NA	NA	NA	NA
WP_047780812.1|1840853_1843436_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.5	1.8e-91
WP_047780813.1|1843684_1844659_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_047780814.1|1844724_1845315_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	1.6e-40
WP_047780815.1|1845569_1846328_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_047780816.1|1846512_1846830_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_047780817.1|1846836_1848006_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_047780818.1|1848073_1848769_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_047780819.1|1848774_1849101_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_047780820.1|1849180_1849645_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_047780821.1|1849773_1850472_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_047780822.1|1850491_1852531_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	5.3e-83
WP_047780823.1|1852761_1853634_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_047780824.1|1853714_1854200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047780825.1|1854459_1855476_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.6	4.5e-30
WP_114986525.1|1855775_1855865_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_047780826.1|1856040_1856586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780827.1|1856790_1857663_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_047780828.1|1857736_1858525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780829.1|1858787_1860716_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	1.8e-125
WP_071845455.1|1860719_1861262_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.7	3.7e-15
WP_029095034.1|1861358_1861556_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_027273088.1|1861592_1861949_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_047780831.1|1862318_1863302_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	41.6	7.1e-33
WP_047780832.1|1863318_1865706_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_029095030.1|1865710_1866007_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.1e-13
WP_047780833.1|1866100_1867102_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_047780834.1|1867085_1867853_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.2e-08
WP_047780835.1|1868466_1868979_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_047780836.1|1869018_1870554_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_047780837.1|1870575_1871928_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_047780838.1|1871924_1872572_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_053007563.1|1872825_1874541_+	OmpA family protein	NA	NA	NA	NA	NA
WP_047780839.1|1874551_1875040_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_082118954.1|1875236_1878020_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.6	5.0e-92
WP_053007564.1|1878024_1881129_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	4.4e-20
WP_047780840.1|1881132_1882035_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_047780841.1|1882034_1884860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053007565.1|1884859_1885993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413112.1|1886162_1886459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413113.1|1886500_1887295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413114.1|1887464_1888598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413115.1|1888767_1889901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780843.1|1890077_1890344_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	53.2	1.5e-06
WP_047780844.1|1890352_1891552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053007569.1|1891548_1895157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047780845.1|1895146_1896727_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_047780846.1|1897119_1898886_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_047780847.1|1898849_1899890_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053007570.1|1899902_1900445_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_047780848.1|1900456_1900870_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP010423	Pragia fontium strain 24613 chromosome, complete genome	4094629	2550421	2561072	4094629		Synechococcus_phage(28.57%)	10	NA	NA
WP_047781310.1|2550421_2551426_-	NAD-dependent epimerase	NA	A0A0E3FNQ3	Synechococcus_phage	29.4	8.9e-31
WP_047781311.1|2551434_2552778_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.6	1.8e-79
WP_047781312.1|2552804_2553716_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	6.1e-63
WP_047781313.1|2553955_2554966_-	two-component system response regulator RssB	NA	Q56AR1	Bacillus_thuringiensis_phage	32.5	9.9e-06
WP_047781314.1|2555169_2555628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047781315.1|2555744_2556578_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.5	5.0e-11
WP_047781316.1|2557179_2557752_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	24.6	4.2e-09
WP_047781317.1|2557865_2558672_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_047782667.1|2558731_2559139_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_047781318.1|2559140_2561072_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.2	4.8e-41
>prophage 5
NZ_CP010423	Pragia fontium strain 24613 chromosome, complete genome	4094629	2864604	2922348	4094629	tail,tRNA,plate,coat	Haemophilus_phage(46.43%)	57	NA	NA
WP_047781524.1|2864604_2865729_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.9	7.0e-93
WP_047781525.1|2865780_2866854_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_047782703.1|2867033_2867615_+	DUF479 domain-containing protein	NA	NA	NA	NA	NA
WP_047781526.1|2867846_2868449_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_047782704.1|2868879_2870253_-	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_047781527.1|2870335_2871661_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_053007628.1|2872178_2873672_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_047781528.1|2873668_2874181_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_047781529.1|2874238_2874562_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	61.0	2.0e-24
WP_047781530.1|2874605_2875514_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047781531.1|2875752_2876043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047781532.1|2876102_2877218_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_047781533.1|2877298_2878552_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.5	1.2e-96
WP_047781534.1|2878563_2879667_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.7	6.9e-61
WP_047781535.1|2879783_2880182_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_047781536.1|2880242_2881490_-	esterase FrsA	NA	NA	NA	NA	NA
WP_047781537.1|2882103_2882628_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_158487440.1|2882666_2883194_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_053007630.1|2883204_2883771_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_082118982.1|2883797_2884577_+	molecular chaperone	NA	NA	NA	NA	NA
WP_047781538.1|2884756_2887135_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_053007631.1|2887141_2888131_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_047781539.1|2888203_2888662_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047781540.1|2888813_2889314_-	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	34.4	4.1e-13
WP_047781541.1|2889611_2891072_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_047781542.1|2891234_2892290_-	DNA polymerase IV	NA	M1Q231	Streptococcus_phage	27.5	1.4e-10
WP_047781543.1|2892368_2893370_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_144413164.1|2894092_2894746_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_047781545.1|2894755_2895523_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_047781546.1|2895577_2896156_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_047781547.1|2896264_2896873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047781548.1|2897028_2897565_-|tail	tail assembly chaperone	tail	A0A0M4RTP2	Salmonella_phage	31.8	3.9e-17
WP_047782710.1|2897567_2898110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047781549.1|2899171_2900644_-	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	54.5	7.4e-26
WP_047781550.1|2900734_2901088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047781551.1|2901087_2902122_-	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	45.4	9.8e-25
WP_047782711.1|2902249_2902687_-|tail	tail assembly chaperone	tail	U5P083	Shigella_phage	39.6	1.9e-14
WP_053007633.1|2902709_2904473_-	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	46.2	2.8e-24
WP_047781552.1|2904688_2906317_-	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	46.2	3.1e-25
WP_047781553.1|2906386_2908033_-	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	47.9	1.2e-24
WP_047781554.1|2908118_2908709_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	35.7	8.9e-31
WP_082119033.1|2908708_2909428_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	51.9	7.2e-35
WP_047781555.1|2909961_2910615_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	51.1	4.4e-47
WP_047781556.1|2910611_2911757_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	52.4	1.8e-104
WP_047781557.1|2911790_2912138_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	54.1	9.2e-28
WP_047781558.1|2912127_2912838_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	52.3	1.7e-31
WP_047781559.1|2912830_2913652_-	hypothetical protein	NA	Q7Y5S8	Haemophilus_phage	49.1	6.9e-74
WP_047781560.1|2913638_2913965_-	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	44.6	1.6e-18
WP_047781561.1|2913984_2914758_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	39.4	3.4e-30
WP_047781562.1|2914761_2916615_-	hypothetical protein	NA	Q7Y5T2	Haemophilus_phage	27.2	2.2e-11
WP_047781563.1|2916775_2917165_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	42.4	1.8e-24
WP_047781564.1|2917164_2917596_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	60.3	4.1e-41
WP_047781565.1|2917663_2919169_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	49.6	4.4e-135
WP_144413128.1|2919182_2919740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047781567.1|2920061_2920415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053007634.1|2920563_2921262_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	39.1	4.9e-36
WP_047782715.1|2921592_2922348_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	7.9e-40
