The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	676181	686072	4009746		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|676181_677474_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_047935407.1|677549_678269_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	8.3e-47
WP_003155758.1|678268_678523_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007408898.1|678519_679203_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_047935408.1|679186_681415_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	9.4e-158
WP_007609856.1|681390_682821_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_047935409.1|682912_683953_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.2	1.7e-64
WP_007408902.1|683949_684537_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_007408903.1|684533_686072_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	2.5e-77
>prophage 2
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	1244540	1256660	4009746	holin	uncultured_Caudovirales_phage(46.15%)	18	NA	NA
WP_087920760.1|1244540_1245677_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1245666_1245801_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_047935635.1|1245943_1246897_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	4.1e-62
WP_007610770.1|1246934_1247312_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_047935636.1|1247421_1248027_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_007407286.1|1248183_1248774_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.4e-39
WP_003154871.1|1248922_1249261_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_007407285.1|1249451_1249631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407283.1|1250337_1251138_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	5.2e-58
WP_007407281.1|1251402_1251744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407280.1|1251733_1251937_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
WP_007407279.1|1252050_1252563_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_007407260.1|1253785_1254157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012117366.1|1254161_1254359_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	2.5e-14
WP_047935637.1|1254414_1255176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1255227_1255491_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1255504_1255768_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_020955695.1|1255781_1256660_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.2	1.1e-80
>prophage 3
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	1814623	1820835	4009746		Bacillus_phage(50.0%)	7	NA	NA
WP_003154061.1|1814623_1815016_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_007410373.1|1814975_1817078_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_007410372.1|1817095_1818085_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	82.1	6.2e-154
WP_007410371.1|1818133_1818754_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	2.7e-46
WP_007410370.1|1818801_1819560_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_007410369.1|1819593_1819818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1819866_1820835_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 4
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	2112613	2124959	4009746		Bacillus_phage(90.0%)	15	NA	NA
WP_003153663.1|2112613_2113039_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
WP_007612049.1|2113072_2113249_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	5.0e-22
WP_047936419.1|2113598_2113952_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_032866265.1|2114403_2114640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032866266.1|2114765_2115140_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	51.2	1.5e-28
WP_025284885.1|2115373_2115826_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	5.7e-62
WP_047935827.1|2116203_2117319_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	48.6	6.3e-94
WP_021493942.1|2117315_2117438_+	phosphatase RapK inhibitor	NA	NA	NA	NA	NA
WP_076983350.1|2117483_2117597_-	impb/mucb/samb family protein	NA	A0A1P8CWP4	Bacillus_phage	91.9	5.1e-12
WP_047935828.1|2118367_2118727_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	9.8e-33
WP_041482154.1|2119107_2119566_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_047935832.1|2119568_2121374_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	71.1	1.1e-177
WP_096335157.1|2121410_2121845_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_007409540.1|2122109_2123075_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.4	4.9e-79
WP_047935833.1|2123291_2124959_+	resolvase	NA	O64015	Bacillus_phage	91.2	6.4e-276
>prophage 5
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	2160346	2224987	4009746	head,terminase,plate,tail,tRNA,protease,coat,capsid,holin,portal,integrase	Bacillus_phage(42.5%)	74	2177051:2177069	2215917:2215935
WP_047935852.1|2160346_2161837_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	26.4	5.6e-05
WP_046702283.1|2162221_2162818_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_040221738.1|2163027_2163555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047935853.1|2163749_2164913_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	48.8	3.6e-68
WP_047935854.1|2164958_2165381_-|holin	holin	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_032863638.1|2165430_2165616_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	72.1	5.8e-21
WP_047935855.1|2165615_2165978_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	55.5	1.9e-28
WP_047935856.1|2165974_2167798_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	37.7	5.8e-81
WP_047935857.1|2167812_2170377_-	peptidase G2	NA	D6R401	Bacillus_phage	80.0	0.0e+00
WP_047935858.1|2170430_2172134_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	57.2	5.5e-182
WP_047935859.1|2172148_2172988_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.3	6.2e-94
WP_047935860.1|2172981_2177469_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	31.5	7.2e-64
2177051:2177069	attL	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
WP_014418189.1|2177666_2178044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935861.1|2178105_2178714_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	34.9	1.3e-24
WP_014418191.1|2178728_2179112_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_043021774.1|2179108_2179507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043021773.1|2179507_2179822_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	5.8e-13
WP_014418194.1|2179811_2180114_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.2	3.6e-12
WP_038458894.1|2180131_2180548_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	51.2	5.9e-13
WP_047935864.1|2180570_2181863_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.1	3.1e-92
WP_043021770.1|2181901_2182528_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.2	5.6e-84
WP_047935866.1|2182490_2183771_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.1	5.6e-155
WP_038458898.1|2183959_2185669_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.1	1.7e-207
WP_014418201.1|2185665_2186181_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.3	7.0e-32
WP_047935868.1|2186408_2186774_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	1.8e-29
WP_043021766.1|2187081_2187483_-	hypothetical protein	NA	Q9T202	Bacillus_phage	82.7	2.2e-49
WP_047935870.1|2187617_2187830_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	43.9	2.9e-08
WP_043021764.1|2188381_2188594_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	4.3e-12
WP_047936421.1|2189133_2189649_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	3.6e-28
WP_047935872.1|2189876_2190611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935873.1|2190808_2191189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047935874.1|2191322_2191580_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	42.9	4.6e-08
WP_025852610.1|2191615_2191819_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.3	2.8e-21
WP_047935875.1|2192116_2192545_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	3.0e-44
WP_128424623.1|2192780_2193728_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	42.7	1.2e-53
WP_032859408.1|2193612_2194314_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_079978557.1|2194511_2195249_-	hypothetical protein	NA	A0A2P1JU03	Anoxybacillus_phage	42.4	4.8e-42
WP_047935881.1|2195268_2196189_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	63.6	1.0e-89
WP_038458929.1|2196185_2196374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046341367.1|2196475_2196673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032859261.1|2196669_2196927_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.8	6.4e-10
WP_014418218.1|2196923_2197496_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.9	4.7e-61
WP_047935882.1|2197553_2198282_-	kilA	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	68.3	1.4e-89
WP_047935883.1|2198278_2198593_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	43.2	1.4e-11
WP_072177205.1|2198605_2198854_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043021753.1|2199024_2199405_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	42.7	3.3e-10
WP_047935884.1|2199767_2200964_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	43.9	7.2e-80
WP_047935885.1|2201007_2202312_-	purine permease	NA	NA	NA	NA	NA
WP_007409503.1|2202308_2202893_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047935887.1|2203225_2204728_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_032866285.1|2204839_2206759_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
WP_003153550.1|2206862_2207054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153548.1|2207219_2207372_+	YpzG family protein	NA	NA	NA	NA	NA
WP_015417697.1|2207412_2208579_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003153541.1|2209112_2209412_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_007409499.1|2209491_2210040_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003153539.1|2210128_2210365_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007409498.1|2210448_2210544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032866286.1|2210677_2211916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032866287.1|2211935_2214182_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
WP_012117833.1|2214280_2214787_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_017418017.1|2214925_2215339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032866289.1|2215368_2215803_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003153532.1|2215989_2216172_+	hypothetical protein	NA	NA	NA	NA	NA
2215917:2215935	attR	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
WP_007409492.1|2216210_2216579_-	YppE family protein	NA	NA	NA	NA	NA
WP_007409491.1|2216624_2216870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153525.1|2217075_2217180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032866291.1|2217223_2218186_-	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
WP_007409489.1|2218227_2218836_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.7	1.7e-21
WP_042635292.1|2218874_2221658_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_015240085.1|2221735_2222227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935888.1|2222223_2222883_-	endonuclease III	NA	NA	NA	NA	NA
WP_003153516.1|2222901_2223600_-	DnaD domain-containing protein	NA	NA	NA	NA	NA
WP_003153515.1|2223694_2224987_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	7.9e-56
>prophage 6
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	2301923	2308177	4009746		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2301923_2302517_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_007409427.1|2302506_2303262_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_003153376.1|2303469_2303559_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_020956020.1|2303647_2304169_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2304234_2304609_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2304725_2305190_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_047935905.1|2305222_2306419_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.8e-116
WP_047935906.1|2306433_2307081_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_015240125.1|2307061_2308177_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.7e-55
>prophage 7
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	2661696	2721556	4009746	coat,protease,tRNA	uncultured_Mediterranean_phage(25.0%)	60	NA	NA
WP_007408194.1|2661696_2662140_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|2662154_2664359_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2664516_2665029_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_015240292.1|2665034_2667395_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	8.1e-91
WP_043021678.1|2667450_2667777_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_042635388.1|2667840_2668338_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_039254370.1|2668469_2670689_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	3.5e-27
WP_007408189.1|2670725_2671022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007408188.1|2671137_2672694_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_047935988.1|2672701_2673358_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|2673524_2673911_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2673962_2674223_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_007408186.1|2674253_2675399_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|2675426_2676455_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|2676480_2676681_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_007408185.1|2676673_2677678_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|2677688_2678294_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_007408184.1|2678428_2678938_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_039063356.1|2679070_2679310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020954253.1|2679323_2679917_-	spore cortex protein	NA	NA	NA	NA	NA
WP_025285054.1|2680065_2681256_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_007408180.1|2681382_2682486_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_047935989.1|2682487_2683336_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_047935990.1|2683317_2684883_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_047935991.1|2684988_2686140_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	29.3	7.8e-31
WP_012118101.1|2686136_2686679_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003152668.1|2686704_2687562_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2687575_2688019_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_007408172.1|2688072_2689359_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_007408171.1|2689390_2689969_-	sporulation protein	NA	NA	NA	NA	NA
WP_003152662.1|2690286_2690571_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2690583_2690925_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2690927_2691236_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_020956150.1|2691381_2692248_-|protease	membrane metalloprotease	protease	NA	NA	NA	NA
WP_007408168.1|2692240_2693044_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2693171_2693975_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2693977_2694658_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_007408167.1|2694711_2695230_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_007408166.1|2695226_2696090_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2696120_2697134_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_007408165.1|2697224_2697920_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_007408164.1|2697951_2698521_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_039254352.1|2698661_2699663_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_007408162.1|2699788_2700541_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_047935993.1|2700681_2701974_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_047935994.1|2702032_2704675_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.2e-161
WP_003152639.1|2705127_2705319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012118110.1|2705333_2706356_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_047935995.1|2706389_2708279_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_021494394.1|2708411_2709701_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_015240312.1|2709729_2710704_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_020956156.1|2710709_2711489_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_007408155.1|2711478_2712420_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_015417935.1|2712454_2713285_-|tRNA	negative effector of the concentration of glutamyl-tRNA reductase HemA	tRNA	NA	NA	NA	NA
WP_003152628.1|2713292_2714660_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_020956158.1|2714854_2715346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|2715378_2715966_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_007612896.1|2715962_2718287_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_012118116.1|2718485_2720144_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_007408149.1|2720293_2721556_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 8
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	3256967	3312225	4009746	head,terminase,plate,tail,protease,capsid,holin,portal,transposase,integrase	Bacillus_phage(32.43%)	68	3255556:3255580	3292363:3292387
3255556:3255580	attL	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_047936149.1|3256967_3257942_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	68.9	9.1e-65
WP_015239640.1|3257987_3258410_-|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_047936150.1|3258460_3258649_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	93.5	4.5e-29
WP_047936151.1|3258645_3259008_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	89.2	7.8e-54
WP_047936152.1|3259004_3260141_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	76.6	1.8e-136
WP_047936154.1|3260153_3262718_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	2.3e-288
WP_047936155.1|3262750_3264472_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	68.4	2.1e-221
WP_047936157.1|3264484_3265321_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.0	1.0e-109
WP_047936158.1|3265321_3269068_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	63.8	5.7e-107
WP_017418253.1|3269130_3269313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936162.1|3269324_3269687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936164.1|3269744_3270323_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	39.3	7.4e-30
WP_047936171.1|3270341_3270731_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_047936172.1|3270727_3271117_-|head,tail	head-tail joining protein	head,tail	I7A9A4	Enterococcus_phage	36.7	3.3e-10
WP_047936173.1|3271116_3271443_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014472232.1|3271432_3271726_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
WP_047936174.1|3271777_3272236_-	phage protein	NA	D6R3Z0	Bacillus_phage	62.6	6.1e-11
WP_047936175.1|3272263_3273460_-|capsid	phage major capsid protein	capsid	A0A2H4J312	uncultured_Caudovirales_phage	49.3	6.3e-76
WP_047936177.1|3273508_3274105_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.6	4.7e-48
WP_047936178.1|3274097_3275324_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	5.5e-67
WP_047936180.1|3275328_3275535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936182.1|3275551_3277285_-|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	48.0	3.0e-143
WP_013353510.1|3277274_3277760_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	36.5	4.8e-14
WP_052941789.1|3278481_3278706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047936185.1|3279010_3279358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936187.1|3279359_3279563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936189.1|3279924_3280467_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.6	1.5e-61
WP_047936430.1|3280463_3280916_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	4.4e-38
WP_047936190.1|3282233_3283610_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	49.3	2.4e-143
WP_047936192.1|3283614_3283869_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	8.5e-07
WP_047936195.1|3283881_3284283_-	hypothetical protein	NA	X2JNJ3	Bacillus_phage	46.0	3.4e-26
WP_047936196.1|3284279_3284504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936198.1|3284500_3284863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085436.1|3285003_3285207_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_015387918.1|3285454_3285595_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_047936201.1|3285703_3286252_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_157680797.1|3286403_3286565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936203.1|3286551_3287403_-	AAA family ATPase	NA	A8ATL1	Listeria_phage	30.6	2.0e-23
WP_047936204.1|3287353_3288208_-	DNA damage-inducible protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	49.4	3.7e-62
WP_047936205.1|3288200_3288431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936206.1|3288445_3288637_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	61.3	5.4e-14
WP_052941794.1|3288672_3288876_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047936207.1|3289039_3289438_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047936208.1|3289864_3290965_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047936209.1|3291226_3292291_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	65.3	3.6e-131
WP_003151688.1|3292897_3293368_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
3292363:3292387	attR	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_047936210.1|3293507_3295841_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.4	1.6e-86
WP_007409986.1|3295859_3296600_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003151681.1|3296718_3296949_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_087920807.1|3297072_3297258_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151677.1|3297453_3297864_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_003151674.1|3297888_3298320_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151672.1|3298401_3298719_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007409984.1|3298803_3300207_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_007613820.1|3300197_3300860_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042635494.1|3300881_3301652_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_042635495.1|3301648_3302383_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_003151665.1|3302379_3303093_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	2.5e-56
WP_015240601.1|3303203_3303881_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015240602.1|3303899_3304817_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015240603.1|3304831_3305485_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409976.1|3305501_3306647_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	4.3e-13
WP_003151660.1|3306932_3307466_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094246999.1|3307527_3308678_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
WP_012118473.1|3308788_3309463_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_088005516.1|3309480_3310374_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003151654.1|3310411_3311065_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003151651.1|3311085_3312225_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	7.3e-13
>prophage 9
NZ_CP011686	Bacillus velezensis strain G341 chromosome, complete genome	4009746	3664973	3710097	4009746	coat,protease	Escherichia_phage(22.22%)	47	NA	NA
WP_003151043.1|3664973_3665633_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_020957977.1|3665738_3665927_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_020957978.1|3665964_3666384_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015240784.1|3666769_3668149_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407653.1|3668213_3668714_-	YwgA family protein	NA	NA	NA	NA	NA
WP_007407654.1|3668753_3670055_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3670214_3670439_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_007407656.1|3670641_3671415_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_079891039.1|3671714_3671990_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012118697.1|3671990_3672545_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_007407659.1|3672642_3673563_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.3e-36
WP_047936275.1|3673559_3674513_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047936276.1|3674502_3675339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047936277.1|3675329_3676127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015240789.1|3676095_3677019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3677067_3677247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007407665.1|3677400_3678264_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_007407666.1|3678310_3679210_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_015240790.1|3679325_3680303_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3680340_3681312_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3681573_3682338_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_007407669.1|3682456_3683236_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007407670.1|3683252_3684452_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_007407671.1|3684464_3685646_-	MFS transporter	NA	NA	NA	NA	NA
WP_007407672.1|3685642_3687061_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_007407673.1|3687078_3687840_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
WP_003151000.1|3687836_3688547_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015418458.1|3688536_3689151_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_047936278.1|3689312_3690551_-	MFS transporter	NA	NA	NA	NA	NA
WP_047936279.1|3690773_3691976_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	9.3e-27
WP_047936280.1|3692008_3693427_-	amino acid permease	NA	NA	NA	NA	NA
WP_007407678.1|3693451_3695134_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003150992.1|3695205_3696753_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025285442.1|3696960_3698247_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_007407681.1|3698436_3698898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007407682.1|3699113_3699569_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_007407683.1|3699565_3700414_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	4.1e-37
WP_032869419.1|3700434_3701382_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	42.1	2.7e-69
WP_003150981.1|3701384_3702122_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_047936281.1|3702149_3703154_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_096335147.1|3703155_3703899_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_047936283.1|3703888_3705010_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_047936284.1|3705009_3705873_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007407691.1|3705873_3707043_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_047936285.1|3707065_3708490_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003150972.1|3708494_3709265_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_007407693.1|3709545_3710097_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
