The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	552287	578892	6217725	terminase,head,transposase	Salmonella_phage(25.0%)	30	NA	NA
WP_077257948.1|552287_553634_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_022652343.1|553883_554852_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_012695467.1|554873_555458_-	MFS transporter	NA	NA	NA	NA	NA
WP_021243026.1|555535_556693_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695469.1|556886_557780_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012695470.1|557916_558732_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_013815099.1|558892_559861_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_001567369.1|560338_560971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|560999_562403_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_016808964.1|562725_563259_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_032743587.1|563255_563756_-	lysozyme	NA	H9C184	Pectobacterium_phage	75.8	4.4e-71
WP_016808966.1|563775_564054_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	52.5	3.4e-09
WP_016808967.1|564054_564393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808968.1|564393_564990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808969.1|565071_565338_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	41.6	8.4e-05
WP_016808970.1|565348_567280_-	tape measure protein	NA	NA	NA	NA	NA
WP_004113073.1|567407_567893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719835.1|567892_568315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808973.1|568317_569676_-	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	27.8	2.8e-35
WP_016808974.1|569676_570462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808975.1|570461_570716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808976.1|570811_571285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808977.1|571405_571765_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_004113060.1|571774_572029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719836.1|572032_572971_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	30.8	6.6e-28
WP_016808979.1|572988_573780_-	Ig domain-containing protein	NA	A0A1S5R5Y7	Pseudomonas_phage	55.3	5.6e-12
WP_026055954.1|573779_574793_-	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	35.0	2.6e-14
WP_016808981.1|574764_576126_-|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	28.6	1.7e-16
WP_016808982.1|576112_577486_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_016808983.1|577482_578892_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2I7RTP3	Vibrio_phage	33.7	1.0e-56
>prophage 2
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	861781	923542	6217725	tRNA,holin,plate,protease	Enterobacteria_phage(23.53%)	59	NA	NA
WP_004112629.1|861781_862771_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
WP_004101623.1|862896_863337_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_029496829.1|863333_863606_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_017146002.1|863933_864299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017146003.1|864528_865071_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	64.6	4.9e-68
WP_004101614.1|865078_865351_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	56.6	1.2e-17
WP_004101612.1|865340_865733_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	53.7	2.2e-25
WP_004101611.1|865809_866172_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	5.1e-29
WP_047719902.1|866632_867334_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	40.0	5.1e-33
WP_047719904.1|867812_871340_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_004101605.1|871694_872801_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.7	1.7e-107
WP_004112591.1|872950_873163_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004101601.1|873245_873680_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_017146008.1|873865_874156_+	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	64.9	1.1e-29
WP_023320857.1|874362_875301_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_024274080.1|876251_877187_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_023320856.1|877231_878605_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.8e-50
WP_016807751.1|879087_880071_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_029779322.1|880412_881033_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047719906.1|881151_881670_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023329611.1|881678_882611_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023329610.1|882642_885174_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_016807754.1|885237_885909_-	molecular chaperone	NA	NA	NA	NA	NA
WP_024274079.1|885964_886495_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_032734669.1|886912_887542_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004101576.1|887625_888258_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024274078.1|888427_889174_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	5.4e-17
WP_017146018.1|889187_890255_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023320845.1|890418_891684_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.1	5.9e-157
WP_023320844.1|891683_892106_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.1	6.8e-33
WP_004178082.1|892184_893672_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178082.1|894093_895581_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004101565.1|896207_896402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004112572.1|896556_896748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017146020.1|896925_897240_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_004101558.1|898118_898307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024274077.1|898973_899879_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024274076.1|900016_900949_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_023320841.1|901118_902099_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_024274075.1|902255_903140_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004101547.1|903271_903814_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004101545.1|904017_904902_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807767.1|905073_906210_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023320840.1|906351_907539_+	MFS transporter	NA	NA	NA	NA	NA
WP_023320839.1|907637_907982_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_004101537.1|908082_908811_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	2.1e-45
WP_004101535.1|909078_909513_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004101533.1|909509_910229_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017146024.1|910225_911485_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004101529.1|911486_912209_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_024274073.1|912205_913429_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024274072.1|913425_913959_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_024274071.1|913973_914933_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_163470950.1|916401_917841_+	MFS transporter	NA	NA	NA	NA	NA
WP_004101515.1|917896_919576_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_004101512.1|919724_920216_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004101511.1|920215_920755_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_024274069.1|920732_921818_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024274068.1|921781_923542_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	1086005	1147481	6217725	portal,terminase,plate,tail,capsid,tRNA,head,integrase	Enterobacteria_phage(52.94%)	68	1091322:1091338	1128635:1128651
WP_023320736.1|1086005_1086506_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004101248.1|1086685_1087132_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004101246.1|1087115_1087907_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004101244.1|1088007_1089192_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004101242.1|1089229_1089922_-	CTP synthase	NA	NA	NA	NA	NA
WP_004101240.1|1090084_1090594_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004101238.1|1090580_1090928_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_023320734.1|1090931_1091171_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
1091322:1091338	attL	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
WP_004216467.1|1091434_1091686_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_047719938.1|1091729_1092869_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.7	1.4e-144
WP_047719940.1|1093023_1094196_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	2.9e-158
WP_047719941.1|1094195_1094711_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_047719942.1|1094756_1095068_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	52.2	1.5e-16
WP_053086776.1|1095088_1095226_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_047719943.1|1095212_1098188_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.2	1.1e-217
WP_047721071.1|1098203_1098677_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.1	1.9e-52
WP_047719944.1|1098841_1101301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719945.1|1101572_1102670_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	8.8e-08
WP_047719946.1|1102654_1102870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719947.1|1102866_1105896_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
WP_047719948.1|1105885_1106809_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	42.9	9.3e-51
WP_017898624.1|1106810_1107161_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_047719949.1|1107157_1107745_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	56.0	4.8e-53
WP_047719950.1|1107741_1108377_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	7.8e-57
WP_032720044.1|1108373_1108841_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_128316295.1|1108841_1109033_-	peptidase	NA	NA	NA	NA	NA
WP_049070297.1|1109022_1109352_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_047719951.1|1109363_1109909_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	1.1e-30
WP_032432781.1|1109905_1110190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|1110180_1110381_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_032708341.1|1110380_1110896_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	1.7e-41
WP_047719953.1|1111000_1111867_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.9	2.6e-71
WP_047719954.1|1111916_1112951_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.3	6.2e-96
WP_047719956.1|1112961_1113801_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_047719957.1|1113957_1115685_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.4	8.2e-234
WP_047719958.1|1115678_1116740_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	4.1e-143
WP_047719959.1|1117322_1118687_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	22.3	1.8e-18
WP_047719961.1|1118889_1120578_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	53.1	1.3e-175
WP_047719963.1|1123228_1124245_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.1e-65
WP_047719965.1|1124518_1125085_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.5	4.7e-13
WP_004213098.1|1125081_1125306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719966.1|1125374_1125647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009486498.1|1125662_1126040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021466843.1|1126055_1126274_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	47.3	1.6e-06
WP_023300862.1|1126407_1126623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023300861.1|1126727_1126997_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.8	3.9e-42
WP_038423230.1|1127119_1127419_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.7	3.5e-36
WP_047719967.1|1127534_1128518_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	2.4e-150
WP_023320733.1|1128780_1129794_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
1128635:1128651	attR	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
WP_004101234.1|1129851_1129953_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_100248259.1|1129952_1130027_+	protein YoaJ	NA	NA	NA	NA	NA
WP_085955747.1|1130167_1130293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004112248.1|1130341_1130605_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_023320731.1|1130733_1131372_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004101221.1|1131461_1132376_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	1.0e-73
WP_023320730.1|1132914_1133703_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004101219.1|1133960_1134482_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004101218.1|1134478_1135426_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_047719968.1|1135523_1137854_+	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_004101215.1|1137934_1138306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719969.1|1138695_1139739_-	type II asparaginase	NA	NA	NA	NA	NA
WP_023320726.1|1140017_1141205_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024274036.1|1141285_1143070_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	2.5e-20
WP_004101200.1|1143266_1143605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101197.1|1143701_1144952_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_023320724.1|1145188_1145839_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004112222.1|1145859_1146336_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017146107.1|1146374_1147481_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	2036316	2079994	6217725	terminase,plate,capsid,tRNA,holin	Enterobacteria_phage(21.57%)	66	NA	NA
WP_047720220.1|2036316_2036904_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	1.1e-33
WP_047720222.1|2036896_2038129_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	51.0	4.6e-106
WP_047721096.1|2038136_2038493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720225.1|2038558_2039212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720228.1|2039214_2039802_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	27.5	2.9e-05
WP_047720230.1|2039791_2040661_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.8	3.0e-27
WP_019725008.1|2040657_2040963_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_047720232.1|2040964_2041804_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	33.1	2.0e-28
WP_047720233.1|2041807_2043706_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	62.6	1.7e-38
WP_047720234.1|2043907_2044384_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	31.1	1.6e-06
WP_047720237.1|2044462_2044993_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	67.2	1.8e-62
WP_023304864.1|2045169_2045613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720240.1|2045612_2047094_-	DUF3383 domain-containing protein	NA	I2GUE7	Acinetobacter_phage	33.0	1.6e-57
WP_047720241.1|2047097_2047649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720243.1|2047630_2047999_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	2.1e-06
WP_047720244.1|2047995_2048559_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	5.7e-19
WP_047720245.1|2048561_2049005_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	5.7e-14
WP_047720246.1|2049004_2049331_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	3.6e-10
WP_047720248.1|2049332_2050370_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	1.4e-84
WP_047720249.1|2050369_2050852_-	hypothetical protein	NA	A0A2R3UAX9	Myoviridae_environmental_samples	57.7	1.3e-32
WP_077257936.1|2050853_2052671_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.3	1.2e-57
WP_047720252.1|2052733_2053423_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	51.3	9.6e-61
WP_047720253.1|2053475_2054996_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.8	4.0e-99
WP_047720256.1|2054996_2056673_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.1	3.3e-248
WP_047720257.1|2056674_2057160_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	80.1	9.7e-68
WP_047720260.1|2057191_2057827_-	hypothetical protein	NA	I6S676	Salmonella_phage	80.7	1.6e-102
WP_167879619.1|2058256_2058433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720262.1|2058429_2058972_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	78.1	1.1e-78
WP_031280382.1|2058968_2059268_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_012542610.1|2059749_2060250_-	late gene antiterminator protein	NA	G8C7V7	Escherichia_phage	92.1	8.7e-88
WP_047720267.1|2060246_2060387_-	YlcG family protein	NA	NA	NA	NA	NA
WP_047720268.1|2060383_2060608_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	61.6	7.5e-23
WP_047720270.1|2060604_2061186_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	47.3	1.3e-39
WP_047720271.1|2061178_2061349_-	prophage protein NinE	NA	G8C7V4	Escherichia_phage	73.2	4.3e-15
WP_040239931.1|2061348_2061804_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	2.3e-55
WP_047720274.1|2062004_2062262_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	4.1e-25
WP_158414337.1|2062347_2062503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125961865.1|2062495_2063068_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	45.2	2.1e-13
WP_052959178.1|2063553_2063835_-	hypothetical protein	NA	O64352	Escherichia_phage	72.7	9.1e-10
WP_047720276.1|2063831_2064350_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.1	6.7e-91
WP_052959179.1|2064349_2064973_-	hypothetical protein	NA	Q5G8U8	Enterobacteria_phage	41.1	2.6e-12
WP_047720277.1|2064969_2065395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720280.1|2065948_2066242_-	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.3e-24
WP_047720282.1|2066238_2067108_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.2	4.0e-96
WP_047720283.1|2067092_2067947_-	replication protein	NA	K7PGT1	Enterobacteria_phage	55.7	3.4e-63
WP_004139615.1|2068032_2068254_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004201115.1|2068294_2068522_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_047721102.1|2068633_2069332_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	1.2e-106
WP_047720286.1|2069380_2069704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720289.1|2069700_2070168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176678792.1|2070190_2070397_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	65.7	6.2e-16
WP_019725103.1|2071041_2071236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032431540.1|2071325_2071610_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.5e-39
WP_014342891.1|2071789_2072125_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_023283324.1|2072121_2072745_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.1	7.9e-46
WP_047671926.1|2072741_2073170_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.7	2.6e-64
WP_047720291.1|2073166_2073823_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	6.0e-113
WP_017898877.1|2073819_2074041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720292.1|2074037_2074616_+	morphogenetic protein	NA	M1F3E2	Salmonella_phage	50.5	9.9e-43
WP_025269983.1|2074612_2074804_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_047720295.1|2074800_2075019_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	46.2	1.2e-06
WP_047720296.1|2075171_2075411_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	6.3e-12
WP_004151317.1|2075423_2075759_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004099791.1|2077233_2078100_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
WP_004099787.1|2078101_2078314_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_047720298.1|2078608_2079994_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	7.9e-46
>prophage 5
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	3465530	3559582	6217725	plate,tail,protease,tRNA,head,transposase	Vibrio_phage(62.16%)	101	NA	NA
WP_004107530.1|3465530_3466061_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004107529.1|3466070_3467405_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
WP_047720474.1|3467609_3468536_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004107523.1|3468628_3469114_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_004107521.1|3469174_3470137_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004107519.1|3470339_3471236_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_004107516.1|3471385_3471889_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_004107514.1|3472038_3472737_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004107505.1|3472733_3474107_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_047721119.1|3474199_3474874_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107495.1|3474945_3475566_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	3.2e-63
WP_004107493.1|3475857_3476892_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_073971822.1|3476897_3477854_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_004107487.1|3477819_3478656_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_047720475.1|3478967_3480434_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_004107479.1|3480430_3481690_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_004107477.1|3481825_3482656_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_004107475.1|3482737_3483724_+	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032729189.1|3485372_3486377_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047720476.1|3486373_3487378_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047720477.1|3487538_3488687_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_004107466.1|3488683_3488998_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_004116819.1|3489052_3490417_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004107462.1|3490520_3491909_-	MFS transporter	NA	NA	NA	NA	NA
WP_004107460.1|3491980_3492991_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047720479.1|3493401_3494781_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_004107456.1|3494883_3495477_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_024274858.1|3495516_3496782_-	MFS transporter	NA	NA	NA	NA	NA
WP_004107452.1|3496823_3498947_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004107449.1|3499061_3500057_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004107447.1|3500132_3500681_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016809579.1|3500781_3501441_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_004107443.1|3501440_3501764_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_004116813.1|3501801_3502836_-	YiiG family protein	NA	NA	NA	NA	NA
WP_024274857.1|3502967_3503519_-	ATPase AAA	NA	NA	NA	NA	NA
WP_004107437.1|3503515_3503953_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_024274856.1|3503962_3504232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004107433.1|3504288_3505131_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_004107430.1|3505117_3506485_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_004107427.1|3506477_3506792_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004116804.1|3506803_3507784_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_157776753.1|3507957_3508188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720480.1|3508320_3510921_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_004107410.1|3511095_3511578_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004107407.1|3511574_3512753_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_047720481.1|3512766_3513264_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_047720482.1|3513275_3514067_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016807439.1|3514129_3514399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807441.1|3516390_3517266_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.0	9.8e-26
WP_016807442.1|3517265_3518078_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	56.1	6.5e-32
WP_016807443.1|3518080_3518665_-	YmfQ family protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
WP_047720484.1|3518649_3519726_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	53.7	2.0e-105
WP_016807445.1|3519712_3520165_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	42.8	8.6e-26
WP_016807446.1|3520161_3520701_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	45.8	1.0e-33
WP_016807447.1|3520691_3521783_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	50.1	5.2e-93
WP_016807448.1|3521775_3523032_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	41.7	3.8e-87
WP_047720486.1|3523031_3524825_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	30.3	1.4e-63
WP_016807450.1|3524923_3525307_-|tail	phage tail assembly protein	tail	A0A2P9JZJ9	Alteromonadaceae_phage	41.3	4.4e-15
WP_016807451.1|3525310_3525664_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_016807452.1|3525673_3527155_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	58.9	1.6e-161
WP_016807453.1|3527156_3527387_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_016807454.1|3527389_3528001_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.6	4.6e-38
WP_016807455.1|3527997_3528540_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	3.4e-61
WP_016807456.1|3528539_3528980_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	3.2e-33
WP_016807458.1|3529684_3530587_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	60.9	2.3e-102
WP_016807459.1|3530589_3531561_-	I protein	NA	M1Q578	Vibrio_phage	48.7	1.8e-73
WP_016807460.1|3531793_3532636_-|head	phage head morphogenesis protein	head	M1PVV7	Vibrio_phage	55.4	2.5e-87
WP_139153325.1|3532639_3533083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720489.1|3533066_3534638_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	9.6e-157
WP_047720491.1|3534637_3536227_-	Mu-like prophage FluMu protein gp28	NA	M4MHG0	Vibrio_phage	69.8	4.6e-199
WP_044348588.1|3536223_3536799_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	56.8	6.4e-50
WP_044348586.1|3536788_3537073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807465.1|3537075_3537363_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_016807466.1|3537375_3537678_-	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_047720492.1|3537658_3537889_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_047720494.1|3537885_3538497_-	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	3.7e-24
WP_047720495.1|3538484_3538889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720497.1|3539102_3539681_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	3.3e-38
WP_047720498.1|3539784_3540108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720499.1|3540113_3540506_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	63.3	3.8e-38
WP_047720500.1|3540502_3541057_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	45.1	1.1e-35
WP_052959182.1|3541053_3541653_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	45.5	1.1e-12
WP_016807476.1|3541645_3542143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044348544.1|3542223_3542841_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	60.9	3.4e-65
WP_047720501.1|3542856_3543144_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	53.9	4.9e-19
WP_004114539.1|3543146_3543386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720503.1|3543390_3544338_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	77.8	3.0e-137
WP_047720504.1|3544374_3546453_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	46.1	4.2e-168
WP_023301751.1|3546455_3546680_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_047720505.1|3546851_3547490_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004107400.1|3547791_3548634_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_004107397.1|3548856_3549555_+	porin	NA	NA	NA	NA	NA
WP_004107394.1|3549719_3549932_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004107391.1|3550060_3550897_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_123830053.1|3551053_3554104_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004107383.1|3554116_3555019_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_004107380.1|3555015_3555651_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004107377.1|3555979_3556909_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004107374.1|3557223_3558141_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.1	6.7e-17
WP_004107372.1|3558158_3559100_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_004107369.1|3559144_3559582_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	4313589	4369445	6217725	portal,terminase,tail,plate,capsid,tRNA,head,lysis,integrase,holin	Erwinia_phage(35.71%)	61	4328510:4328555	4361297:4361342
WP_004105930.1|4313589_4313922_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_004105929.1|4313958_4315338_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.2e-33
WP_004105928.1|4315578_4316124_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023321656.1|4316363_4317137_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_047720615.1|4317300_4318950_-	glycerone kinase	NA	NA	NA	NA	NA
WP_047720617.1|4319017_4320439_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_004105924.1|4320449_4321082_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_004105923.1|4321092_4322163_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_004105922.1|4322758_4323856_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_174202071.1|4323954_4325874_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_004105920.1|4325932_4327096_-	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
WP_004105919.1|4327120_4327546_-	heme-binding protein	NA	NA	NA	NA	NA
WP_071530277.1|4328089_4328413_+	DUF1889 family protein	NA	NA	NA	NA	NA
4328510:4328555	attL	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_047720619.1|4328714_4330163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720621.1|4330182_4331181_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.5	3.4e-192
WP_047720623.1|4331180_4331756_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_001630878.1|4331885_4332149_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_015959030.1|4332179_4332689_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	4.4e-87
WP_032433679.1|4332696_4332897_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
WP_047720626.1|4332860_4333199_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	8.0e-53
WP_047720628.1|4333266_4333494_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	94.7	2.4e-29
WP_047720629.1|4333493_4333715_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	94.5	6.0e-33
WP_176678794.1|4333863_4335936_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.8	0.0e+00
WP_176678780.1|4336078_4336264_+	Tum protein	NA	A0A218M4I0	Erwinia_phage	78.7	9.2e-19
WP_047720635.1|4336572_4337304_+	hypothetical protein	NA	Q37850	Escherichia_phage	87.2	7.9e-122
WP_047720637.1|4337417_4338215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720639.1|4338593_4339640_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	92.8	7.7e-187
WP_047720640.1|4339639_4341409_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	97.5	0.0e+00
WP_047720642.1|4341574_4342429_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	94.7	1.9e-151
WP_047720643.1|4342504_4343572_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	93.2	6.0e-187
WP_047720645.1|4343576_4344326_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	91.2	2.6e-112
WP_047720648.1|4344419_4344929_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	95.9	6.2e-89
WP_015370176.1|4344928_4345132_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	91.0	8.3e-29
WP_032413163.1|4345134_4345431_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	96.9	2.9e-46
WP_032413164.1|4345417_4345915_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	93.3	3.9e-88
WP_047720651.1|4345911_4346325_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	93.4	2.8e-63
WP_047045389.1|4346432_4346900_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	4.2e-84
WP_047720652.1|4346892_4347342_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	93.3	2.0e-67
WP_047720653.1|4347408_4348134_-	UPF0489 family protein	NA	NA	NA	NA	NA
WP_047720654.1|4348264_4348906_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	90.6	4.5e-105
WP_047720655.1|4348902_4349250_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	75.7	1.4e-44
WP_047720656.1|4349254_4350163_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.5	7.8e-111
WP_047720657.1|4350170_4350752_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	50.8	3.5e-48
WP_052959183.1|4350757_4352863_+	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.3	1.2e-109
WP_047720658.1|4352865_4353120_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	53.0	1.0e-15
WP_047720659.1|4353210_4354371_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	48.3	7.8e-47
WP_047720660.1|4354481_4355669_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.4	3.0e-211
WP_047720661.1|4355684_4356203_+|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	5.0e-94
WP_047720662.1|4356266_4356602_+|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	98.2	6.8e-52
WP_000763323.1|4356634_4356754_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_047720663.1|4356746_4359188_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	87.6	0.0e+00
WP_047720664.1|4359202_4359688_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	96.9	1.7e-83
WP_047720665.1|4359684_4360854_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	96.4	3.7e-206
WP_071845060.1|4360920_4361139_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	1.2e-38
WP_004105914.1|4361496_4362003_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4361297:4361342	attR	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_047720666.1|4361999_4363127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720667.1|4363123_4363768_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004105908.1|4364008_4365853_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_016808010.1|4366002_4367745_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.9	3.4e-70
WP_001144069.1|4367978_4368194_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032729227.1|4368431_4369445_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	2.4e-108
>prophage 7
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	4436758	4468276	6217725	transposase,plate,tail,head	Vibrio_phage(66.67%)	43	NA	NA
WP_016807441.1|4436758_4437634_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.0	9.8e-26
WP_016807442.1|4437633_4438446_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	56.1	6.5e-32
WP_047720673.1|4438448_4439033_-	YmfQ family protein	NA	A0A2I7S9L6	Vibrio_phage	47.2	2.8e-45
WP_047720674.1|4439017_4440094_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.6	6.0e-102
WP_019704449.1|4440080_4440533_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_047720675.1|4440529_4441069_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	45.3	3.0e-33
WP_047720676.1|4441059_4442151_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	48.8	3.2e-90
WP_047720677.1|4442143_4443400_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	41.7	2.9e-87
WP_016807449.1|4443399_4445211_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	32.6	1.8e-69
WP_016807450.1|4445309_4445693_-|tail	phage tail assembly protein	tail	A0A2P9JZJ9	Alteromonadaceae_phage	41.3	4.4e-15
WP_047720678.1|4445696_4446050_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_047720679.1|4446059_4447538_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	59.2	2.5e-162
WP_047720680.1|4447539_4447770_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047720681.1|4447772_4448384_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.8	1.0e-37
WP_047720682.1|4448380_4448923_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	4.9e-60
WP_016807456.1|4448922_4449363_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	3.2e-33
WP_016807458.1|4450067_4450970_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	60.9	2.3e-102
WP_016807459.1|4450972_4451944_-	I protein	NA	M1Q578	Vibrio_phage	48.7	1.8e-73
WP_016807460.1|4452176_4453019_-|head	phage head morphogenesis protein	head	M1PVV7	Vibrio_phage	55.4	2.5e-87
WP_139153325.1|4453022_4453466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720489.1|4453449_4455021_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	9.6e-157
WP_016807463.1|4455020_4456607_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	70.7	4.6e-199
WP_016807464.1|4456606_4457185_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.0	7.6e-51
WP_004114569.1|4457174_4457450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807465.1|4457452_4457740_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_016807466.1|4457749_4458052_-	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_016807467.1|4458032_4458263_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807468.1|4458259_4458871_-	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	2.9e-24
WP_016807469.1|4458858_4459263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807471.1|4459476_4460058_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	45.7	3.9e-39
WP_016807472.1|4460155_4460671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026055841.1|4460673_4461069_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	60.2	7.2e-37
WP_016807474.1|4461071_4461626_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	44.4	1.5e-35
WP_016807475.1|4461622_4462210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807476.1|4462202_4462700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807477.1|4462780_4463398_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	61.4	1.2e-65
WP_016807478.1|4463413_4463701_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	53.9	3.8e-19
WP_016807479.1|4463710_4463968_-	hypothetical protein	NA	A0A0U5KSG7	unidentified_phage	48.7	8.6e-15
WP_016807480.1|4463970_4464210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807481.1|4464214_4465162_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	78.5	4.2e-139
WP_176678781.1|4465198_4467292_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	50.6	5.5e-184
WP_016807483.1|4467294_4467543_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	84.0	1.0e-33
WP_016807484.1|4467706_4468276_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	54.1	7.2e-38
>prophage 8
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	5091514	5117336	6217725	integrase,holin,terminase	Salmonella_phage(37.93%)	36	5087467:5087480	5097894:5097907
5087467:5087480	attL	GAGAGAATCAGATC	NA	NA	NA	NA
WP_047720752.1|5091514_5092744_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	89.0	2.4e-224
WP_047720753.1|5092721_5093012_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	69.7	6.5e-27
WP_071532314.1|5093037_5093277_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	77.9	1.4e-27
WP_032413642.1|5093284_5093593_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	57.8	8.4e-25
WP_047720754.1|5094067_5094421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720755.1|5094455_5095544_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	57.1	8.0e-110
WP_047720756.1|5095555_5098495_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	59.0	3.0e-297
5097894:5097907	attR	GAGAGAATCAGATC	NA	NA	NA	NA
WP_047720757.1|5098798_5098990_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_048257997.1|5098989_5099184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721139.1|5099466_5100027_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	39.5	2.0e-08
WP_032734636.1|5100436_5100757_+	hypothetical protein	NA	H6WRX6	Salmonella_phage	73.6	1.2e-37
WP_032734635.1|5101093_5102011_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	66.1	3.7e-100
WP_047720758.1|5102007_5102751_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.4	3.6e-61
WP_047720759.1|5102743_5103010_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.9	3.5e-11
WP_004103042.1|5103006_5103636_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	48.4	1.7e-43
WP_004103037.1|5104293_5104551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720760.1|5104547_5106629_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	1.4e-203
WP_024359402.1|5106775_5107009_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	3.7e-25
WP_047720761.1|5107087_5107309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720762.1|5107366_5107966_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.9	3.1e-92
WP_047720763.1|5107965_5108172_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	71.2	9.9e-22
WP_047720764.1|5108174_5108471_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	75.5	4.1e-37
WP_047720765.1|5108467_5108812_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	73.2	1.0e-39
WP_094298915.1|5108808_5108946_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	63.6	5.4e-08
WP_047720766.1|5108942_5109626_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	1.1e-64
WP_139153329.1|5110250_5110754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720768.1|5110852_5111245_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.7	1.0e-43
WP_047720769.1|5111234_5111513_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	77.2	4.8e-35
WP_047720770.1|5111512_5112142_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.0	3.1e-106
WP_047720771.1|5112149_5112425_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	54.4	1.7e-16
WP_029669831.1|5112375_5112570_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	4.1e-25
WP_047720772.1|5112566_5112860_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	1.3e-30
WP_047720773.1|5112923_5113907_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	46.2	1.5e-38
WP_047720774.1|5113908_5115501_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	40.6	3.0e-97
WP_014837912.1|5115501_5115723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257951.1|5115764_5117336_+	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.4	2.1e-55
>prophage 9
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	5465929	5530230	6217725	portal,terminase,tail,capsid,head,lysis,integrase,holin,protease	Enterobacteria_phage(40.91%)	62	5468621:5468636	5487527:5487542
WP_004114163.1|5465929_5466421_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004103976.1|5466750_5467857_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_127472320.1|5467879_5468182_+	hypothetical protein	NA	NA	NA	NA	NA
5468621:5468636	attL	ATACAGCAGCCGTTTA	NA	NA	NA	NA
WP_047720825.1|5469238_5471728_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.5	6.6e-19
WP_004114157.1|5472082_5472856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024274503.1|5472848_5474789_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.2	1.0e-54
WP_024274502.1|5475048_5475309_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004114150.1|5475308_5476742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720826.1|5476748_5480114_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_047720827.1|5480918_5482199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720828.1|5482452_5483631_-|integrase	phage integrase SAM-like domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	28.8	4.8e-28
WP_045419636.1|5483633_5483843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720829.1|5483886_5484456_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	72.5	2.2e-79
WP_047720830.1|5484914_5485112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720831.1|5485111_5485639_-	hypothetical protein	NA	A0A0P0ZCH9	Stx2-converting_phage	65.3	5.1e-62
WP_004123003.1|5485771_5486599_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	85.8	3.0e-133
WP_047721149.1|5486655_5487027_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	8.3e-59
WP_176678784.1|5487815_5488472_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	58.1	1.8e-69
5487527:5487542	attR	TAAACGGCTGCTGTAT	NA	NA	NA	NA
WP_004122998.1|5488563_5488761_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.3	1.6e-16
WP_047720832.1|5488788_5489346_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.2	1.4e-65
WP_032741919.1|5489342_5489540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721152.1|5489595_5490240_+	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	50.7	4.3e-47
WP_032423246.1|5490241_5490421_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_004122995.1|5490417_5491296_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	57.7	1.7e-33
WP_004122994.1|5491292_5491550_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	75.0	3.3e-22
WP_047720833.1|5491549_5492434_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	71.8	7.4e-122
WP_047720834.1|5492426_5494274_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.4	4.0e-202
WP_047720835.1|5494270_5495332_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	3.3e-100
WP_071845044.1|5495344_5495947_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.5	2.4e-76
WP_047720836.1|5496176_5496608_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	37.3	7.4e-19
WP_047043763.1|5496632_5496815_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_139153342.1|5497056_5497386_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	89.9	5.1e-52
WP_047720838.1|5497372_5497792_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.4	7.4e-40
WP_047720839.1|5497794_5498262_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	63.2	1.7e-45
WP_047720840.1|5498492_5498723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153332.1|5499506_5499764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720841.1|5500220_5500406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720842.1|5500496_5500829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720843.1|5500828_5501248_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	53.6	5.2e-33
WP_047720844.1|5501541_5502087_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	87.2	1.1e-86
WP_047720845.1|5502061_5503984_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	89.7	0.0e+00
WP_015367380.1|5503983_5504190_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	88.1	6.7e-26
WP_047720846.1|5504186_5505779_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	86.6	6.3e-273
WP_047720847.1|5505759_5507091_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	73.2	2.6e-171
WP_047720848.1|5507100_5507433_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	80.0	5.1e-44
WP_047720849.1|5507500_5508526_+|capsid	major capsid protein	capsid	K7P6G7	Enterobacteria_phage	92.7	2.6e-179
WP_047720850.1|5508576_5508996_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	51.5	4.1e-22
WP_047720851.1|5509006_5509360_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	66.7	1.8e-42
WP_077257944.1|5509368_5509953_+|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	77.8	2.5e-78
WP_047720852.1|5509949_5510348_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	76.5	4.1e-56
WP_047720853.1|5510354_5511098_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	85.4	2.8e-114
WP_077257945.1|5511108_5511537_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	59.3	8.7e-36
WP_071845045.1|5511557_5511872_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	76.0	2.3e-41
WP_047720854.1|5511855_5515002_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	75.9	0.0e+00
WP_047720855.1|5515052_5515400_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	62.6	2.0e-35
WP_047720856.1|5515396_5516152_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.5	3.7e-130
WP_047720857.1|5516153_5516891_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.6	8.2e-135
WP_126488854.1|5516896_5517169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720858.1|5517258_5517849_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.0	3.0e-79
WP_047720859.1|5517914_5527127_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	41.6	0.0e+00
WP_047720860.1|5527167_5528310_+|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	33.3	9.8e-18
WP_004178082.1|5528742_5530230_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 10
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	5883100	5961693	6217725	portal,terminase,tail,plate,capsid,head,integrase,holin,protease	Enterobacteria_phage(26.67%)	96	5923219:5923278	5959816:5959939
WP_047720900.1|5883100_5884135_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.7	9.8e-126
WP_047720901.1|5884134_5884365_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047720902.1|5884702_5885098_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	78.6	1.2e-52
WP_047720903.1|5885740_5886079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720904.1|5886079_5886397_-	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	51.4	1.3e-17
WP_047720905.1|5886389_5886734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162556077.1|5886730_5886892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720906.1|5886888_5887677_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	3.1e-63
WP_047720907.1|5887676_5887976_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.2e-13
WP_047720908.1|5888064_5888982_-	recombination-associated protein RdgC	NA	A0A1Y0SUG1	Pseudomonas_phage	34.1	1.1e-38
WP_047720909.1|5889298_5890456_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	28.9	2.4e-35
WP_047720910.1|5890626_5891109_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.9	1.3e-11
WP_071845047.1|5891211_5891481_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	52.1	5.9e-14
WP_047720911.1|5891739_5892195_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.1	5.5e-65
WP_071845048.1|5892432_5892645_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	1.7e-16
WP_047720912.1|5892601_5893516_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	4.0e-30
WP_047720913.1|5893512_5894322_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	71.5	1.2e-115
WP_047720914.1|5894331_5894721_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	72.9	6.9e-48
WP_047720915.1|5894735_5895431_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	64.7	8.2e-76
WP_047720916.1|5895427_5896408_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.1e-134
WP_047720917.1|5896426_5896771_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	83.2	3.3e-54
WP_047720918.1|5897296_5898223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004121584.1|5898492_5898888_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	93.9	3.2e-61
WP_017145564.1|5898874_5899156_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.3e-37
WP_047720919.1|5899155_5899785_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.3e-104
WP_047720920.1|5899792_5900068_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	4.4e-25
WP_047720921.1|5900349_5900715_+	hypothetical protein	NA	L7TH90	Pseudomonas_virus	53.6	5.5e-15
WP_047720923.1|5901121_5901367_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	59.3	3.6e-18
WP_032419453.1|5901427_5901778_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_047720924.1|5901936_5902434_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
WP_047720925.1|5902437_5904189_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	72.0	8.8e-252
WP_047720926.1|5904185_5904347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720927.1|5904336_5905563_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	8.4e-209
WP_032439289.1|5905555_5906155_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	5.9e-91
WP_047720928.1|5906164_5907403_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	68.0	1.0e-153
WP_047720929.1|5907480_5907798_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	54.9	6.7e-25
WP_047720930.1|5907806_5908145_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	2.4e-41
WP_047720931.1|5908141_5908591_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	3.3e-62
WP_032750781.1|5908587_5908935_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	2.3e-31
WP_047720932.1|5908991_5909702_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	68.2	7.5e-85
WP_047720933.1|5909732_5910137_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.7	5.5e-32
WP_047720934.1|5910139_5910445_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_015370209.1|5910520_5910904_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	2.3e-32
WP_047720935.1|5910973_5914381_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	41.8	3.9e-187
WP_047720936.1|5914402_5914876_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
WP_017145580.1|5914862_5915339_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.1	6.7e-53
WP_016809748.1|5915351_5915732_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.7	1.3e-59
WP_047720937.1|5918883_5921016_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	36.9	2.0e-11
WP_047720938.1|5921018_5922419_+	hypothetical protein	NA	W6E8G0	Rhizobium_phage	29.7	2.8e-14
WP_047720940.1|5922763_5923093_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	2.5e-22
5923219:5923278	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGG	NA	NA	NA	NA
WP_047720941.1|5923406_5924414_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	55.6	3.9e-103
WP_047720942.1|5924426_5924834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720944.1|5925212_5925458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720945.1|5925479_5926109_-	membrane protein	NA	NA	NA	NA	NA
WP_077257946.1|5926118_5926547_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	40.2	3.7e-10
WP_047720947.1|5926587_5926800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720948.1|5926802_5927045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437051.1|5927067_5927271_+	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	8.3e-05
WP_071845051.1|5927280_5927484_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	66.1	5.2e-15
WP_047720949.1|5927497_5927737_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_047720950.1|5927733_5928012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720951.1|5928080_5928305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720952.1|5928301_5928868_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.1	2.1e-13
WP_047720953.1|5929100_5930054_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	57.9	2.3e-89
WP_176678787.1|5930322_5930496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158414348.1|5930505_5930661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071845053.1|5930636_5931779_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	50.4	8.1e-97
WP_047720956.1|5931771_5934369_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.6	4.0e-192
WP_047720957.1|5934570_5935323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720958.1|5935801_5936863_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	8.5e-141
WP_047720959.1|5936856_5938584_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	69.5	2.5e-238
WP_047720960.1|5938740_5939580_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	4.3e-95
WP_047720961.1|5939589_5940624_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.7	1.1e-95
WP_047720962.1|5940672_5941530_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.9	1.3e-70
WP_047720963.1|5941642_5942158_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_047724057.1|5942157_5942358_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	61.5	7.9e-16
WP_047720965.1|5942628_5943174_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	2.4e-30
WP_158414347.1|5943360_5943696_+	peptidase	NA	NA	NA	NA	NA
WP_032411298.1|5943696_5944164_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_047720967.1|5944160_5944796_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	5.0e-56
WP_047720968.1|5944792_5945380_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	59.5	5.9e-59
WP_047720969.1|5945376_5945727_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	1.8e-26
WP_047720970.1|5945728_5946652_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	8.4e-52
WP_047720971.1|5946641_5949671_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
WP_032445019.1|5949667_5949883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720973.1|5951310_5952183_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_047720975.1|5952432_5952924_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	1.3e-54
WP_047720977.1|5952939_5955945_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.4	7.8e-232
WP_053086776.1|5955931_5956069_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_047720979.1|5956089_5956401_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	53.3	8.5e-17
WP_047720980.1|5956446_5956962_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_047720981.1|5956961_5958131_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	5.1e-155
WP_047720983.1|5958282_5959416_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	69.5	3.9e-144
WP_071845063.1|5959459_5959711_+	ogr/Delta-like zinc finger family protein	NA	Q858U4	Yersinia_virus	44.6	1.0e-07
WP_004103451.1|5960070_5960958_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
5959816:5959939	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGGATAAAAGCAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_004103450.1|5961024_5961693_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	65.5	9.5e-05
>prophage 11
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	6071343	6098140	6217725	terminase,holin	Escherichia_phage(28.95%)	49	NA	NA
WP_047720995.1|6071343_6072627_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	56.3	7.1e-142
WP_047721168.1|6072660_6072912_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	44.4	6.0e-13
WP_047720996.1|6072953_6073178_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	5.9e-12
WP_047720997.1|6073174_6074044_-	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	41.5	5.1e-59
WP_047720998.1|6074040_6074232_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	66.1	6.0e-13
WP_047720999.1|6074228_6074765_-	hypothetical protein	NA	J9Q748	Salmonella_phage	70.9	1.8e-70
WP_047721000.1|6074761_6074980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721001.1|6074976_6075636_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.7	1.0e-115
WP_043875719.1|6075632_6075860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046878446.1|6075856_6076015_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	69.2	2.2e-13
WP_047721002.1|6076011_6076692_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.3e-123
WP_047721003.1|6076688_6077534_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	2.6e-68
WP_047721004.1|6077549_6077834_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	71.3	5.4e-34
WP_047721005.1|6077841_6078843_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	6.8e-39
WP_071845055.1|6078922_6079129_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	95.6	8.1e-32
WP_047721006.1|6079121_6079310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052959190.1|6079605_6079887_-	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	61.7	1.0e-08
WP_047721007.1|6080124_6080406_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	82.8	3.9e-37
WP_176678789.1|6080548_6081271_-	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	63.2	2.5e-75
WP_047721009.1|6081339_6081567_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	53.7	2.2e-14
WP_047721010.1|6081607_6081928_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	8.5e-36
WP_165473733.1|6081927_6082077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435255.1|6082307_6083036_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_047721011.1|6083032_6083812_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.7	2.6e-94
WP_047721012.1|6083808_6084114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071458385.1|6084110_6084623_+	hypothetical protein	NA	K7PJM1	Enterobacteria_phage	51.6	3.7e-25
WP_047721013.1|6084900_6085170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052959187.1|6085166_6085646_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_047721014.1|6085818_6086574_+	DUF551 domain-containing protein	NA	O64350	Escherichia_phage	63.6	4.5e-11
WP_047721015.1|6086658_6086856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153335.1|6087045_6087318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721017.1|6087649_6087907_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.4	5.4e-25
WP_047721018.1|6088108_6088558_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.3	5.3e-36
WP_071532248.1|6088550_6088721_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	69.6	5.7e-15
WP_047721019.1|6088713_6089352_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.3	5.7e-76
WP_047721020.1|6089348_6089489_+	YlcG family protein	NA	NA	NA	NA	NA
WP_042934016.1|6089485_6089983_+	antiterminator	NA	G8C7V7	Escherichia_phage	92.7	1.9e-87
WP_139153343.1|6090444_6090744_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	8.4e-46
WP_004136189.1|6090740_6091283_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	77.5	5.8e-77
WP_047721022.1|6091279_6091624_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	74.6	2.0e-35
WP_047721023.1|6091620_6091896_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	5.4e-15
WP_047721026.1|6092037_6092331_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	2.6e-31
WP_047721174.1|6092394_6092874_+	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	59.1	1.2e-54
WP_025108058.1|6092949_6093195_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	56.8	2.0e-16
WP_047721175.1|6093424_6093640_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	73.2	3.1e-26
WP_047720773.1|6093727_6094711_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	46.2	1.5e-38
WP_047721029.1|6094712_6096305_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	40.6	3.0e-97
WP_014837912.1|6096305_6096527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257953.1|6096568_6098140_+	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.8	2.8e-55
>prophage 12
NZ_CP011597	Klebsiella oxytoca strain CAV1099 chromosome, complete genome	6217725	6115761	6124625	6217725		Klebsiella_phage(25.0%)	8	NA	NA
WP_042946229.1|6115761_6116019_-	hypothetical protein	NA	L0ARW5	Klebsiella_phage	49.4	3.2e-17
WP_053003256.1|6116022_6117714_-	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.3	2.5e-102
WP_047721037.1|6117789_6118368_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.1	2.0e-88
WP_004178082.1|6118798_6120286_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178082.1|6120707_6122195_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_041147657.1|6122274_6122694_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_047721039.1|6122695_6123961_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	1.1e-208
WP_047721040.1|6123953_6124625_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.6e-79
>prophage 1
NZ_CP011594	Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-111, complete sequence	111395	0	111152	111395	tail,capsid,terminase,integrase,portal	Salmonella_phage(86.25%)	119	61474:61494	83887:83907
WP_047719619.1|811_1246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719620.1|1301_1619_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_047719621.1|1770_2064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719622.1|2245_2896_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	48.1	5.2e-56
WP_047719623.1|2905_3205_-	hypothetical protein	NA	A0A192Y8D4	Enterobacteria_phage	34.3	3.1e-08
WP_047719624.1|3340_3601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719625.1|3597_4248_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	54.2	2.4e-53
WP_047719626.1|4351_6019_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	64.6	1.2e-210
WP_047719627.1|6027_6207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719628.1|6248_6860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719629.1|6933_7161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719630.1|7232_7553_+	hypothetical protein	NA	J9Q750	Salmonella_phage	69.8	1.3e-41
WP_139153311.1|7575_7956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719632.1|8007_8277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153312.1|9435_9630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719633.1|9779_9989_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	72.9	2.5e-20
WP_047719634.1|9985_10354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719635.1|10514_10844_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	53.3	3.2e-14
WP_047719636.1|10970_11411_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	43.7	8.7e-23
WP_047719637.1|11514_11754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719638.1|11973_12456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719639.1|13045_13690_-	hypothetical protein	NA	J9Q754	Salmonella_phage	49.8	1.3e-51
WP_139153313.1|14321_14855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139153314.1|14919_15273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719642.1|15318_16896_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	70.9	1.6e-212
WP_047719643.1|16961_17675_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	65.7	1.7e-84
WP_047719644.1|17658_18333_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	64.8	3.4e-71
WP_047719645.1|18325_18967_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	85.3	2.9e-96
WP_047719646.1|18956_19514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719647.1|19510_20401_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	78.1	2.1e-137
WP_047719648.1|20410_20677_+	hypothetical protein	NA	J9Q757	Salmonella_phage	76.1	1.0e-31
WP_047719649.1|20846_21437_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	61.3	6.5e-58
WP_047719650.1|21436_22693_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	88.5	1.5e-229
WP_047719651.1|22724_24299_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	73.0	5.2e-227
WP_047719652.1|24311_25178_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	56.1	2.1e-76
WP_047719653.1|25207_26080_+|capsid	phage capsid protein	capsid	J9Q710	Salmonella_phage	81.4	1.0e-131
WP_047719654.1|26153_26597_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	44.6	2.8e-21
WP_047719655.1|26638_27064_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	63.6	1.2e-42
WP_047719656.1|27063_27897_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	48.9	7.0e-74
WP_047719657.1|27907_28252_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	57.0	5.5e-33
WP_047719658.1|28242_28737_+	hypothetical protein	NA	J9Q711	Salmonella_phage	51.2	1.4e-34
WP_077257922.1|28733_29117_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	44.4	1.7e-30
WP_047719660.1|29209_29650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719662.1|30598_30916_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	66.7	4.8e-31
WP_047719731.1|31041_31269_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	76.7	4.0e-24
WP_047719663.1|31273_35776_+	tape measure protein	NA	J9Q712	Salmonella_phage	36.8	2.7e-188
WP_047719664.1|35822_36158_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	70.0	1.3e-42
WP_047719665.1|36212_36911_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	75.2	2.5e-101
WP_047719666.1|36900_37704_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	74.8	7.9e-115
WP_047719667.1|37691_38303_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	57.1	3.6e-59
WP_053003253.1|38314_50740_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	60.5	2.8e-41
WP_047719668.1|50787_52332_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	40.1	2.8e-44
WP_009484919.1|52414_52729_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	69.8	2.3e-33
WP_047719669.1|52739_53432_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	77.6	1.4e-99
WP_047719670.1|53428_53680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719672.1|53870_55058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719673.1|55206_55872_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	75.2	4.1e-93
WP_047719674.1|55876_56251_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	54.3	9.9e-20
WP_047719675.1|56579_57326_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	55.2	4.4e-75
WP_047719676.1|57364_58726_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	69.8	1.6e-179
WP_047719677.1|58861_59977_+	DNA primase catalytic core, N-terminal domain protein	NA	J9Q720	Salmonella_phage	66.6	8.9e-149
WP_047719678.1|60042_60951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719679.1|61037_61493_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	42.4	4.6e-27
61474:61494	attL	AAACAAAGGAAAACACATGAA	NA	NA	NA	NA
WP_047719680.1|61489_61954_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_047719681.1|61953_63282_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	71.5	4.4e-187
WP_047719682.1|63278_63494_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	57.1	2.2e-16
WP_047719683.1|63648_63900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719685.1|65047_65659_+	hypothetical protein	NA	S4TP42	Salmonella_phage	35.1	6.6e-21
WP_047719686.1|65868_66339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257924.1|66517_66955_+	DUF2829 domain-containing protein	NA	K4N0H8	Escherichia_phage	43.0	1.2e-21
WP_047719687.1|66951_67197_+	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	56.8	2.3e-17
WP_047719688.1|67208_67454_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	42.3	2.2e-12
WP_047719689.1|67667_68003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719690.1|67999_68515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176678772.1|68718_68862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719692.1|69604_70096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052959163.1|70324_71404_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	27.2	1.5e-20
WP_047719694.1|71393_71699_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047719695.1|72303_74274_+	hypothetical protein	NA	J9Q7G6	Salmonella_phage	44.2	5.5e-125
WP_047719696.1|74370_75609_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	61.0	2.8e-143
WP_052959164.1|75786_78159_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	67.0	7.3e-310
WP_052959165.1|78229_79390_+	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	61.1	1.5e-138
WP_047719697.1|79386_79809_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	38.5	1.2e-13
WP_047719698.1|80246_80957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719699.1|81117_81558_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	46.9	7.8e-32
WP_047719700.1|81624_82605_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	45.6	9.5e-62
WP_047719701.1|82665_83628_+	exonuclease	NA	J9Q7S6	Salmonella_phage	64.1	4.5e-117
WP_047719702.1|83624_83885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719703.1|83902_84940_+	recombinase	NA	J9Q736	Salmonella_phage	74.8	6.1e-152
83887:83907	attR	AAACAAAGGAAAACACATGAA	NA	NA	NA	NA
WP_047719737.1|84926_85646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719704.1|85730_85934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719705.1|85930_86758_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	78.2	5.7e-100
WP_052959167.1|86896_87634_+	hypothetical protein	NA	G4KK93	Yersinia_phage	33.0	6.3e-26
WP_047719706.1|87916_88171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052959174.1|88311_88518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153316.1|88701_89049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719710.1|89524_90649_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	48.3	2.7e-76
WP_047719711.1|90967_91615_+	hypothetical protein	NA	J9Q739	Salmonella_phage	55.2	6.0e-65
WP_047719712.1|91851_92937_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	71.8	1.5e-148
WP_047719713.1|92933_94850_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	61.8	2.7e-214
WP_047719714.1|94839_95538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719715.1|95554_96127_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	58.7	9.8e-59
WP_047719739.1|96209_98540_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	70.7	0.0e+00
WP_052959168.1|98635_99040_+	DUF2591 family protein	NA	NA	NA	NA	NA
WP_047719716.1|99053_100196_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	80.0	1.3e-179
WP_052959175.1|100389_101136_+	hypothetical protein	NA	J9Q742	Salmonella_phage	51.0	1.6e-61
WP_047719718.1|101332_102424_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	59.2	3.1e-130
WP_047719719.1|102425_102839_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	38.4	3.1e-14
WP_176678773.1|102847_103312_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	53.9	5.2e-42
WP_052959171.1|103308_103959_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	37.7	8.6e-27
WP_047719721.1|104012_104420_+	hypothetical protein	NA	J9Q743	Salmonella_phage	37.6	9.8e-13
WP_047719722.1|104416_104959_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	58.7	3.6e-55
WP_139153317.1|105042_105906_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	42.1	4.3e-26
WP_139153318.1|106179_106596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719724.1|106637_107723_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_047719725.1|107920_108532_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	71.2	3.4e-78
WP_047719726.1|108714_108939_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	51.4	1.5e-15
WP_052959161.1|109509_110073_+	ribonuclease H	NA	J9Q745	Salmonella_phage	39.1	1.1e-30
WP_047719727.1|110726_111152_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	77.3	4.1e-54
>prophage 1
NZ_CP011596	Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence	113992	5	65465	113992	integrase,transposase,protease	Salmonella_phage(37.5%)	55	5987:6044	65498:65555
WP_000050481.1|5_1547_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|1951_2791_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|2784_3132_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3295_4087_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845039.1|4232_5246_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001044210.1|5892_6033_-	hypothetical protein	NA	NA	NA	NA	NA
5987:6044	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|6038_6743_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032413363.1|7689_8682_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427623.1|9085_10090_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_071571074.1|10652_10823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075209834.1|11314_12283_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	9.7e-184
WP_148662571.1|12396_13122_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.6	6.8e-33
WP_032413394.1|13216_14236_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_032413397.1|14232_15177_+	ectoine utilization protein EutC	NA	A0A1V0SL93	Klosneuvirus	23.0	7.8e-13
WP_032413223.1|15868_16885_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032413215.1|18135_18672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900946.1|20992_22003_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_023287153.1|22732_23899_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_004117790.1|23898_24870_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_032413223.1|27645_28662_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_043875877.1|29609_30173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|30159_30402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|30449_30914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946349.1|30923_31331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413230.1|31373_32333_+	DNA replication protein	NA	NA	NA	NA	NA
WP_004181760.1|32329_33088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|33084_33408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719752.1|33558_33876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413233.1|33941_35078_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004178082.1|35163_36651_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_016946352.1|37163_37418_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_043875876.1|37503_38565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026560.1|38885_39785_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
WP_003100847.1|40103_40661_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|40654_41026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|41022_41523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|41519_41846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|42100_42457_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|42446_42848_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|42844_43135_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_047719753.1|43293_46260_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_032413243.1|49024_49960_+|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
WP_004210306.1|50432_50915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186895.1|51157_51472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413246.1|52080_53481_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004210304.1|53847_54330_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_032413408.1|54343_55345_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_032413247.1|55304_56414_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_032413249.1|56424_56988_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032413250.1|56984_57947_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_032413253.1|57958_58249_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_032413255.1|58266_59532_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032413257.1|59512_61183_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.8	1.5e-35
WP_077257929.1|62797_63766_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	6.3e-183
WP_176678774.1|64496_65465_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.1e-184
65498:65555	attR	ATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 2
NZ_CP011596	Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence	113992	75818	83711	113992	transposase	uncultured_Caudovirales_phage(85.71%)	8	NA	NA
WP_022652343.1|75818_76787_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_000125668.1|77006_78410_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|78442_79147_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|79233_79554_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|79599_80889_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|80901_81327_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|81386_82214_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|82232_83711_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
>prophage 1
NZ_CP011593	Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-69, complete sequence	68910	0	11835	68910	integrase	Klebsiella_phage(25.0%)	18	5566:5580	11961:11975
WP_004187413.1|1433_1643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|1645_1864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206893.1|1908_2592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206894.1|2592_2850_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206895.1|2867_4142_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004206896.1|4669_5026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|5003_5582_+	hypothetical protein	NA	NA	NA	NA	NA
5566:5580	attL	ACGAACAGGGGGAAT	NA	NA	NA	NA
WP_004206898.1|5583_5991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|6143_6689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206900.1|6829_7300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187394.1|7286_7535_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_004206901.1|7527_8115_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187390.1|8111_8597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316874.1|8638_8842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187383.1|8860_9601_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
WP_004206903.1|9841_10816_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	4.6e-85
WP_004206904.1|10818_11262_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_004187378.1|11271_11835_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.3	5.2e-20
11961:11975	attR	ATTCCCCCTGTTCGT	NA	NA	NA	NA
>prophage 2
NZ_CP011593	Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-69, complete sequence	68910	15945	16806	68910		Marinomonas_phage(100.0%)	1	NA	NA
WP_004206911.1|15945_16806_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
>prophage 3
NZ_CP011593	Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-69, complete sequence	68910	20474	20909	68910		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004206919.1|20474_20909_+	single-stranded DNA-binding protein	NA	A0A0U4K5C0	Pseudomonas_phage	48.0	1.3e-26
>prophage 4
NZ_CP011593	Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-69, complete sequence	68910	49637	61192	68910	integrase,transposase	Escherichia_phage(33.33%)	11	42086:42099	52463:52476
42086:42099	attL	AGCAAATCAATATC	NA	NA	NA	NA
WP_000845048.1|49637_50651_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|50799_51333_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_004206941.1|51412_52201_+	APH(3') family aminoglycoside O-phosphotransferase AphA16	NA	E4ZFP6	Streptococcus_phage	47.2	1.4e-60
WP_032420064.1|52324_53170_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
52463:52476	attR	GATATTGATTTGCT	NA	NA	NA	NA
WP_001007673.1|53199_54027_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_000679427.1|54162_54510_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|54503_55343_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|55470_55971_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|56477_57242_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|57396_58101_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509966.1|60586_61192_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
>prophage 1
NZ_CP011595	Klebsiella oxytoca strain CAV1099 plasmid pKPC_CAV1099, complete sequence	113105	40502	100115	113105	transposase	uncultured_Caudovirales_phage(15.38%)	54	NA	NA
WP_139153319.1|40502_41667_+|transposase	IS3-like element ISKpn37 family transposase	transposase	Q716C2	Shigella_phage	48.0	1.3e-73
WP_003830760.1|42569_43349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274510.1|43402_43822_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104877.1|43832_44054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085947.1|44053_44731_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_000334635.1|45082_45754_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_000600201.1|45933_46356_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_000457553.1|46355_47627_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
WP_000756331.1|47772_48744_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
WP_000817638.1|48740_49946_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_003830762.1|50553_52380_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
WP_000695683.1|52551_52902_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
WP_000725002.1|53050_53482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059177.1|53718_55188_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
WP_000697973.1|55189_55870_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
WP_000475508.1|56059_57445_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001246157.1|57473_57827_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000168542.1|57918_59211_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000574019.1|59221_62368_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	2.3e-61
WP_000758233.1|62454_62895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003830763.1|63013_65467_+	Ag(+)-translocating P-type ATPase SilP	NA	E4ZFI9	Streptococcus_phage	34.9	1.3e-80
WP_000843500.1|65497_65695_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001667049.1|65725_66466_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E5G070	Clostridium_phage	33.3	8.0e-13
WP_000688485.1|66749_67196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719746.1|67430_69248_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001667050.1|69253_70141_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_000906228.1|70180_70561_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_001667051.1|70565_71495_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_001188929.1|71548_72229_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	35.4	2.1e-31
WP_000671200.1|72225_73626_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	8.3e-19
WP_000753365.1|73834_74269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091963.1|74681_75278_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.4	1.4e-20
WP_000728912.1|75401_76331_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-75
WP_000176304.1|76327_76939_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000429587.1|76935_77331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003830765.1|77383_78247_-	3'-5' exoribonuclease	NA	K7RFY5	Vibrio_phage	35.4	1.1e-26
WP_001247114.1|78239_79355_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152391.1|79590_81306_-	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152392.1|81415_84445_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|84551_85577_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|85573_86353_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|86739_87621_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|87870_89190_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_047719748.1|89521_90004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110156.1|90077_91055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114211.1|91345_91699_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.6	1.7e-24
WP_000855178.1|91746_92109_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001010162.1|92126_93878_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000922626.1|93922_95212_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	8.7e-172
WP_000065805.1|95224_95650_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_162862902.1|95681_97433_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000034288.1|97459_97822_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_001000741.1|97897_98443_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022542389.1|99110_100115_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
