The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	45792	55830	5029496	tRNA	Tupanvirus(14.29%)	10	NA	NA
WP_003832580.1|45792_46776_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_003030574.1|46791_49179_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003030571.1|49183_49483_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003832584.1|49636_50617_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030569.1|50677_51229_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003030567.1|51228_51978_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003836644.1|52055_52520_+	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003836643.1|52836_53550_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044699989.1|53611_55054_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	4.5e-52
WP_003836641.1|55050_55830_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
>prophage 2
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	712176	831300	5029496	terminase,tail,holin,integrase,tRNA,head,portal,transposase,protease,capsid	Enterobacteria_phage(21.95%)	135	770451:770466	835909:835924
WP_003034964.1|712176_713058_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003034960.1|713250_715299_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
WP_003034957.1|715318_716005_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_003034953.1|716101_716599_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003841983.1|716727_718011_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_003034947.1|717979_720613_+	PqiB family protein	NA	NA	NA	NA	NA
WP_071681312.1|720692_722114_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003034943.1|722211_722451_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_003034941.1|722553_722745_+	YebW family protein	NA	NA	NA	NA	NA
WP_003034937.1|722745_723387_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
WP_044700293.1|723799_724138_-	YebY family protein	NA	NA	NA	NA	NA
WP_003034931.1|724158_725031_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034928.1|725034_725409_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034925.1|725552_725783_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003841657.1|725889_726546_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034918.1|726569_727232_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	7.0e-08
WP_044700296.1|727222_729301_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_016150461.1|729363_730023_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003034909.1|730117_730471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003034906.1|730592_730883_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_044700298.1|731014_732193_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_047722290.1|732260_732902_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003841668.1|732936_734748_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034896.1|734981_736457_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_003034893.1|736824_737694_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034890.1|737812_739255_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_032935377.1|739299_740271_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034883.1|740390_741710_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_003841677.1|741725_742670_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034877.1|742748_743504_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_003034874.1|743500_744286_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034872.1|744364_745375_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034869.1|745383_745995_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034867.1|746075_746597_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034865.1|746631_747375_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034863.1|747403_747847_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034862.1|747848_749621_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044700301.1|749909_750476_+	hydrolase	NA	NA	NA	NA	NA
WP_047715748.1|750841_751084_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	8.4e-28
WP_047715746.1|751151_752225_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	52.1	3.8e-88
WP_046155137.1|752283_752523_-	hypothetical protein	NA	K7PLZ0	Enterobacterial_phage	57.1	7.0e-19
WP_047715745.1|752631_753306_-	hypothetical protein	NA	O64337	Escherichia_phage	50.7	2.5e-53
WP_047715743.1|753306_753621_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	56.9	4.6e-26
WP_047715741.1|753620_756806_-	host specificity protein J	NA	O64335	Escherichia_phage	87.5	0.0e+00
WP_047715740.1|756859_757450_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	79.0	2.4e-76
WP_008322436.1|757505_757931_-	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	36.9	6.6e-12
WP_047715739.1|758041_758785_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	53.1	7.9e-61
WP_080964717.1|758862_759444_-	Bro-N domain-containing protein	NA	H6WRU8	Salmonella_phage	38.8	7.7e-27
WP_071698655.1|759517_759685_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	72.7	6.6e-16
WP_047715738.1|759804_760248_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	60.7	4.9e-34
WP_047715737.1|760254_760965_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.5	1.6e-135
WP_047715736.1|760966_761722_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.5	2.5e-131
WP_047715735.1|761718_762066_-|tail	phage minor tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	9.5e-41
WP_047715734.1|762069_765213_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	85.9	0.0e+00
WP_071845155.1|765196_765511_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	91.3	2.4e-51
WP_047715733.1|765519_765951_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	74.1	7.1e-54
WP_044700348.1|765961_766705_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	85.8	8.1e-114
WP_044700350.1|766714_767116_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	89.5	9.8e-66
WP_044700352.1|767112_767691_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	96.4	1.2e-93
WP_047715732.1|767700_767976_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	61.5	6.8e-26
WP_047499162.1|767968_768295_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	59.3	1.2e-29
WP_047715731.1|768387_770412_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
WP_047715730.1|770356_771865_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.1	6.6e-256
770451:770466	attL	ACCAGCCCCATCTCTT	NA	NA	NA	NA
WP_001082414.1|771861_772077_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
WP_047499052.1|772073_774176_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	87.3	0.0e+00
WP_044700360.1|774175_774664_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	94.4	8.9e-77
WP_042922208.1|774888_776427_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_042922210.1|776476_776824_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922212.1|776823_777201_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_044700519.1|777844_778804_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_044700520.1|778817_779348_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_044700522.1|779344_779872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044700524.1|779868_780354_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_044700526.1|780350_781571_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044700528.1|781567_782290_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_044700531.1|782291_783548_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044700533.1|783544_784264_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044700535.1|784260_784695_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044700539.1|784898_785627_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.8	7.8e-45
WP_044700540.1|785862_786447_-	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	47.9	1.1e-46
WP_044700543.1|788443_791845_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.4	0.0e+00
WP_071681833.1|791917_792595_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	71.1	2.0e-71
WP_044700545.1|792492_793227_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.9	1.9e-115
WP_044700547.1|793238_793934_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.0	1.8e-94
WP_044700550.1|793942_794275_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.0	2.0e-40
WP_044700552.1|794275_797566_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.3	0.0e+00
WP_044700554.1|797813_798176_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	2.5e-28
WP_044700555.1|798237_798720_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	81.2	4.7e-62
WP_044700558.1|798753_799155_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	85.0	1.1e-56
WP_044700560.1|799151_799541_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	63.7	1.6e-41
WP_044700562.1|799509_799860_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	73.9	1.6e-43
WP_003832371.1|799856_800174_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
WP_044700565.1|800154_800532_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
WP_044700568.1|800629_801916_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	8.0e-210
WP_044700569.1|801988_802909_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.7	6.0e-135
WP_044700572.1|802945_804205_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.0	7.1e-219
WP_003832363.1|804204_804384_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	71.2	3.3e-13
WP_016150031.1|804377_806105_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	92.8	0.0e+00
WP_044700575.1|806101_806599_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	93.3	8.4e-83
WP_047715729.1|806832_807195_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	86.7	3.7e-56
WP_044700576.1|807470_808010_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	79.0	6.4e-44
WP_044700578.1|808382_808556_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000756041.1|808760_808991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057069020.1|809064_809253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066494.1|809263_809476_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
WP_079938067.1|809854_810010_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_044700634.1|810047_810245_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	3.7e-26
WP_044700579.1|810635_810866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088169141.1|810862_811396_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_044700584.1|811374_811923_-	lysozyme	NA	K7PM52	Enterobacteria_phage	93.4	1.0e-97
WP_044700586.1|811894_812173_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	96.7	1.2e-43
WP_044700587.1|812326_812515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080941995.1|812617_813034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700635.1|813786_814401_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	76.9	1.0e-85
WP_044700591.1|815451_815811_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.4e-42
WP_044700593.1|815813_816014_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	1.2e-16
WP_071681812.1|816143_816389_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.0	2.9e-20
WP_044700595.1|816434_816668_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	6.0e-31
WP_044700597.1|816954_818046_-	permease	NA	NA	NA	NA	NA
WP_038641364.1|818145_818442_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038641366.1|818509_818935_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
WP_038641369.1|818947_820237_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	9.6e-171
WP_044700601.1|820283_822035_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_038641374.1|822052_822415_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_044700602.1|822462_822816_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_122984015.1|822939_823485_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.2e-67
WP_122984016.1|823396_824512_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.0	8.9e-48
WP_044700607.1|824560_825115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003832309.1|825118_825331_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
WP_003832307.1|825436_825817_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
WP_044700608.1|826153_826420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003832304.1|826792_827119_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_052739229.1|827260_829732_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.6	3.3e-111
WP_032943036.1|829798_830014_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	56.3	5.7e-20
WP_044700610.1|830013_831300_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	50.4	5.5e-110
835909:835924	attR	ACCAGCCCCATCTCTT	NA	NA	NA	NA
>prophage 3
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	1023598	1135531	5029496	terminase,tail,integrase,tRNA,lysis,head,plate,portal,protease,capsid	Escherichia_phage(36.54%)	97	1041206:1041225	1143197:1143216
WP_003035878.1|1023598_1025359_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_003035875.1|1025427_1025946_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_003035871.1|1026053_1026221_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_003035868.1|1026477_1027041_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_003836843.1|1027037_1028678_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_003035862.1|1028682_1029936_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_003836846.1|1029950_1031858_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	2.1e-49
WP_044700762.1|1031870_1033979_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_044700763.1|1034077_1035184_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_003035852.1|1035180_1035723_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_044701565.1|1035888_1036899_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016149876.1|1037266_1037842_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_003836853.1|1037834_1038809_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044701566.1|1038805_1039951_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_003035843.1|1039961_1040753_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_032936311.1|1040749_1041517_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	1.7e-29
1041206:1041225	attL	CTGCTGCTGCTGGATGAACC	NA	NA	NA	NA
WP_044701568.1|1041588_1044201_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.4	1.6e-18
WP_003836860.1|1044467_1045670_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032936329.1|1045837_1047238_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	3.8e-80
WP_044701570.1|1049100_1050291_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_044701572.1|1050344_1050992_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003035820.1|1051020_1051569_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
WP_044701574.1|1051746_1053498_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003846984.1|1053743_1058204_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_003035809.1|1058203_1058908_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_003836877.1|1058888_1060211_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_003846990.1|1060203_1061007_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_003836882.1|1061142_1061907_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_003035798.1|1062024_1062918_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_003035796.1|1063082_1063829_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003035793.1|1063825_1064008_-	protein YcaR	NA	NA	NA	NA	NA
WP_044701577.1|1064059_1065292_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044701579.1|1065333_1066311_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003035784.1|1066307_1068056_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
WP_044701581.1|1068092_1070357_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|1070563_1070848_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_003035776.1|1071007_1072681_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003035772.1|1072794_1073478_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_003836891.1|1073649_1074411_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003836893.1|1074549_1075833_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003847007.1|1075902_1076991_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.2	5.9e-81
WP_016149861.1|1077203_1077896_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003836899.1|1078032_1079793_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_003035756.1|1080197_1081055_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_003035753.1|1081114_1083397_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_052746971.1|1083705_1083927_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	72.6	2.1e-25
WP_044701584.1|1083989_1085183_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.6	2.1e-164
WP_044701585.1|1085185_1085650_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	7.6e-62
WP_044701587.1|1085661_1088091_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	76.0	3.9e-266
WP_000763326.1|1088083_1088203_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_044701589.1|1088235_1088517_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_023223221.1|1088579_1089098_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_044701591.1|1089110_1090298_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.1e-189
WP_044701594.1|1090427_1090955_-|tail	tail assembly chaperone	tail	Q2A0A8	Sodalis_phage	28.6	7.5e-13
WP_044701597.1|1092809_1093340_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	97.2	5.6e-101
WP_044701599.1|1093332_1094241_-|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	84.4	5.2e-139
WP_023223227.1|1094245_1094593_-|plate	phage baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	71.3	9.5e-41
WP_044701601.1|1094589_1095231_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.6	4.5e-97
WP_047715975.1|1095305_1096049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044701606.1|1096062_1096518_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.1	1.3e-50
WP_044701608.1|1096510_1096978_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	70.3	9.7e-57
WP_044701609.1|1097085_1097499_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	1.9e-35
WP_044701612.1|1097495_1098005_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	83.8	1.9e-77
WP_000524754.1|1097988_1098210_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|1098200_1098404_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|1098403_1098904_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_044701614.1|1099001_1099760_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.7	1.3e-79
WP_044701616.1|1099763_1100924_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	4.3e-130
WP_044701617.1|1100955_1101819_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.6	3.7e-102
WP_044701619.1|1101983_1103753_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	8.5e-287
WP_023223238.1|1103752_1104790_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.3	1.2e-163
WP_044701651.1|1105227_1106319_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	36.8	7.0e-05
WP_044701622.1|1106334_1106820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044701624.1|1106919_1109211_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.4	0.0e+00
WP_044701626.1|1109200_1109476_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	63.7	4.7e-27
WP_044701628.1|1109475_1109775_-	hypothetical protein	NA	M1RZ07	Escherichia_phage	57.7	3.6e-20
WP_044701629.1|1109774_1109999_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	67.6	1.6e-17
WP_047722292.1|1110062_1110563_-	hypothetical protein	NA	M1SV55	Escherichia_phage	84.3	3.7e-78
WP_044701633.1|1110740_1111097_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	76.1	3.8e-45
WP_040090132.1|1111200_1111500_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	73.7	1.4e-32
WP_044701636.1|1111642_1112638_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	87.6	1.0e-167
WP_044701640.1|1112669_1113467_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.7e-21
WP_003035749.1|1113510_1114932_-	amino acid permease	NA	NA	NA	NA	NA
WP_003836902.1|1115145_1116294_-	MFS transporter	NA	NA	NA	NA	NA
WP_003035746.1|1116678_1117305_+	hydrolase	NA	NA	NA	NA	NA
WP_003035744.1|1117414_1118278_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003035741.1|1118279_1118897_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_032948932.1|1118907_1121352_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	3.5e-222
WP_003836908.1|1121588_1122881_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
WP_044701644.1|1122973_1124317_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	1.1e-81
WP_003831898.1|1124327_1124939_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_046155120.1|1125050_1129034_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.8e-88
WP_002439523.1|1129168_1129663_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_003035727.1|1130210_1131179_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_044701662.1|1131293_1133060_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-23
WP_003035722.1|1133060_1134782_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.4e-15
WP_032948928.1|1134826_1135531_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
1143197:1143216	attR	GGTTCATCCAGCAGCAGCAG	NA	NA	NA	NA
>prophage 4
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	2458900	2532678	5029496	terminase,tail,integrase,holin,tRNA,head,portal,transposase,protease,capsid	Enterobacteria_phage(40.35%)	82	2457481:2457497	2522169:2522185
2457481:2457497	attL	CAGAATCCGCCGCCCAG	NA	NA	NA	NA
WP_109547143.1|2458900_2460077_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	67.2	5.8e-122
WP_003031758.1|2460183_2460750_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_003844735.1|2460794_2462231_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_003841063.1|2462664_2464623_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	4.6e-92
WP_003031750.1|2464860_2465175_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003031747.1|2465171_2466821_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_044702194.1|2466866_2467556_-	LrgB family protein	NA	NA	NA	NA	NA
WP_003031742.1|2467548_2467959_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_044702196.1|2468060_2468951_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044702199.1|2469021_2469513_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003031737.1|2469738_2471385_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_003031735.1|2471542_2472892_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	8.8e-159
WP_003031733.1|2473616_2474075_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003031731.1|2474161_2474485_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_003841054.1|2474487_2476074_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003031727.1|2476627_2476909_+	membrane protein	NA	NA	NA	NA	NA
WP_003826621.1|2476975_2477500_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
WP_003031720.1|2477751_2480574_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_003031719.1|2480689_2481046_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_044702294.1|2481173_2481887_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_044702292.1|2482135_2483329_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_003031716.1|2483457_2484537_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	3.1e-29
WP_003826610.1|2484553_2485969_-	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
WP_003841359.1|2486033_2487017_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003031713.1|2487318_2487561_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_139239398.1|2487694_2488732_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_047722298.1|2488819_2489914_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	85.0	2.1e-179
WP_047722299.1|2489946_2490336_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	2.3e-51
WP_047715748.1|2490414_2490657_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	8.4e-28
WP_047715746.1|2490724_2491798_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	52.1	3.8e-88
WP_052941158.1|2492204_2492702_-	hypothetical protein	NA	O64337	Escherichia_phage	50.3	8.5e-35
WP_080964712.1|2492789_2496437_-	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	80.7	0.0e+00
WP_047722302.1|2496487_2497075_-|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	74.3	1.0e-71
WP_071845168.1|2497133_2497472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722306.1|2497502_2498213_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.9	1.7e-137
WP_047722307.1|2498214_2498970_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	85.7	2.4e-129
WP_047722308.1|2498966_2499314_-|tail	phage minor tail protein	tail	K7PJT2	Enterobacteria_phage	68.7	3.4e-38
WP_047722309.1|2499317_2501834_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	69.1	4.6e-312
WP_071524448.1|2501811_2502132_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_047722310.1|2502140_2502548_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	59.3	2.0e-26
WP_047722312.1|2502584_2503322_-|tail	tail fiber protein	tail	O64327	Escherichia_phage	62.4	1.8e-81
WP_003034811.1|2503329_2503728_-|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	1.2e-60
WP_047722313.1|2503724_2504279_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	92.0	8.0e-74
WP_047722314.1|2504288_2504642_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	74.4	7.6e-46
WP_047722315.1|2504653_2505058_-	DNA-packaging protein	NA	O64323	Escherichia_phage	53.1	3.2e-24
WP_003034798.1|2505103_2506129_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	92.7	1.9e-182
WP_003826193.1|2506196_2506529_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_047722316.1|2506538_2507855_-	S49 family peptidase	NA	O64320	Escherichia_phage	78.5	2.2e-186
WP_003826190.1|2507835_2509428_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
WP_003034782.1|2509424_2509631_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_047722317.1|2509630_2511553_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.0	0.0e+00
WP_000453624.1|2511527_2512073_-|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_047722320.1|2512323_2513052_-	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	82.6	3.6e-106
WP_153752826.1|2513066_2513240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722321.1|2513363_2513903_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	52.4	9.7e-08
WP_047722322.1|2513899_2514517_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.9	1.7e-93
WP_000250463.1|2514516_2514798_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_008784467.1|2514784_2515171_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
WP_047722324.1|2515317_2516370_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	81.3	1.2e-171
WP_003034749.1|2516520_2516712_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	85.7	1.3e-23
WP_047722325.1|2516952_2517642_-	antitermination protein	NA	NA	NA	NA	NA
WP_047722327.1|2517663_2518659_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.9	4.5e-144
WP_003034743.1|2518655_2519342_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.8	9.9e-58
WP_003034741.1|2519355_2519742_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
WP_047722328.1|2519738_2521673_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.5	1.1e-199
WP_047722329.1|2521665_2522988_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.1	1.4e-116
2522169:2522185	attR	CAGAATCCGCCGCCCAG	NA	NA	NA	NA
WP_047722330.1|2522984_2523851_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	82.3	4.5e-39
WP_071845170.1|2523840_2524020_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	71.2	3.9e-14
WP_047722332.1|2524192_2524744_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	5.4e-46
WP_044702968.1|2524772_2525015_-	chaperone TorD	NA	NA	NA	NA	NA
WP_044702969.1|2525151_2525838_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.3e-38
WP_044702970.1|2525829_2526711_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	29.8	2.0e-34
WP_044702971.1|2526925_2527291_+|protease	Clp protease	protease	A0A1C9IHZ4	Salmonella_phage	51.6	1.7e-11
WP_047722335.1|2527626_2527998_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	91.9	4.1e-58
WP_003034720.1|2528054_2528882_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	92.0	1.0e-141
WP_003034717.1|2529010_2529550_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.3	8.0e-79
WP_047722336.1|2529710_2529965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722338.1|2529961_2530306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052941159.1|2530298_2530826_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	82.4	4.8e-28
WP_047722339.1|2530827_2531400_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.6	3.0e-92
WP_020838472.1|2531438_2531711_+	Pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	1.2e-38
WP_047722340.1|2532144_2532678_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	84.7	8.7e-86
>prophage 5
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	3369490	3418635	5029496	transposase,tRNA,integrase,protease	uncultured_Caudovirales_phage(50.0%)	49	3370609:3370633	3381518:3381542
WP_016151075.1|3369490_3370375_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	2.8e-28
3370609:3370633	attL	GTGCAGTCAGTGGTGCAGTCAGTTT	NA	NA	NA	NA
WP_047715943.1|3370664_3371888_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	88.0	1.1e-219
WP_052941160.1|3371884_3372238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|3372264_3373385_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_052941161.1|3373397_3373841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047715942.1|3373935_3374136_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	83.3	2.7e-24
WP_071681840.1|3374925_3375591_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	74.1	9.7e-42
WP_024153894.1|3375583_3375808_+	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	75.9	2.3e-16
WP_047715937.1|3375804_3376173_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	89.3	1.7e-56
WP_047715935.1|3376169_3377543_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	67.7	6.4e-173
WP_047715934.1|3377738_3378452_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_044067013.1|3378603_3378798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100216202.1|3380131_3381300_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_000462905.1|3381606_3381903_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
3381518:3381542	attR	GTGCAGTCAGTGGTGCAGTCAGTTT	NA	NA	NA	NA
WP_003025224.1|3381928_3382894_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_044701349.1|3383192_3383969_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016151073.1|3384096_3384978_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016151072.1|3384989_3386441_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_003025216.1|3386430_3386673_-	YhdT family protein	NA	NA	NA	NA	NA
WP_003025213.1|3386780_3388130_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003025210.1|3388140_3388611_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003839882.1|3389003_3389603_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_044701347.1|3389603_3390608_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_016151069.1|3390727_3391702_-	oxidoreductase	NA	NA	NA	NA	NA
WP_044701343.1|3391927_3393868_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_153752135.1|3393876_3394197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000913396.1|3394174_3395218_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_003844819.1|3395284_3396307_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003025196.1|3396307_3396796_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003839891.1|3396803_3397397_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003025190.1|3397386_3398856_+	ribonuclease G	NA	NA	NA	NA	NA
WP_044701342.1|3398967_3402783_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_044701339.1|3402944_3404390_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003839896.1|3404476_3405406_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_003025177.1|3405590_3405794_+	AaeX family protein	NA	NA	NA	NA	NA
WP_003025174.1|3405801_3406734_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003025171.1|3406739_3408707_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003025168.1|3408826_3409105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025165.1|3409162_3409429_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_003025162.1|3409805_3410276_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003025158.1|3410712_3411648_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003025154.1|3411704_3412772_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_044701337.1|3412861_3414229_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	1.5e-20
WP_003025147.1|3414397_3414796_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_044701335.1|3414988_3416116_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003025141.1|3416334_3416763_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003025138.1|3416778_3417171_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003025132.1|3417487_3418126_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003025130.1|3418131_3418635_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 6
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	4113993	4126250	5029496	integrase	Enterobacteria_phage(80.0%)	14	4097368:4097382	4130599:4130613
4097368:4097382	attL	TGCGTCTGGCGGTGA	NA	NA	NA	NA
WP_071681355.1|4113993_4114212_+	hypothetical protein	NA	G8C7R9	Escherichia_phage	69.1	1.2e-20
WP_044699584.1|4114385_4115591_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_044699583.1|4116203_4118537_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
WP_000743156.1|4118548_4118869_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_024173160.1|4118865_4119093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044699580.1|4119197_4119647_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.1e-44
WP_044699579.1|4119639_4119939_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	67.7	7.7e-31
WP_047715918.1|4119931_4120531_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	77.4	2.8e-48
WP_016242327.1|4120527_4120794_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	2.8e-24
WP_047715917.1|4121345_4122149_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	25.2	9.6e-12
WP_000984214.1|4122145_4122388_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_044699572.1|4122404_4122980_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	50.8	1.1e-38
WP_044699570.1|4123620_4125039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016242323.1|4125050_4126250_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	5.3e-107
4130599:4130613	attR	TGCGTCTGGCGGTGA	NA	NA	NA	NA
>prophage 7
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	4657217	4728735	5029496	integrase,tRNA,transposase,protease,capsid	Enterobacteria_phage(26.32%)	69	4673190:4673237	4688574:4688621
WP_044702103.1|4657217_4658165_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	2.2e-07
WP_032936682.1|4658148_4658880_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|4658860_4658968_-	protein YohO	NA	NA	NA	NA	NA
WP_003844381.1|4659019_4659751_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027348.1|4659976_4661662_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|4661658_4662378_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|4662424_4662895_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003840158.1|4662937_4663396_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
WP_003844377.1|4663602_4665636_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
WP_003027343.1|4665800_4666910_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_044702105.1|4667175_4667460_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_044702107.1|4667732_4668311_+	fimbrial protein	NA	NA	NA	NA	NA
WP_044702109.1|4668374_4669058_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_044702112.1|4669072_4671559_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_127746369.1|4671530_4672538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016150637.1|4672591_4672924_-	hypothetical protein	NA	NA	NA	NA	NA
4673190:4673237	attL	GGCTGAGAAATACCCGTACCACCTGATCTGGATAATGCCAGCGTAGGG	NA	NA	NA	NA
WP_044702114.1|4673320_4674622_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_127791446.1|4674705_4675422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702117.1|4675428_4676244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702119.1|4676309_4676498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702121.1|4676503_4677064_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044702123.1|4679818_4680265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702126.1|4680273_4680555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080942041.1|4680802_4681066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702129.1|4681058_4681397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702132.1|4682124_4682349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702134.1|4682345_4682708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702135.1|4682724_4683756_+|capsid	phage capsid E family protein	capsid	NA	NA	NA	NA
WP_100216202.1|4685399_4686568_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_044701865.1|4687233_4687908_+	hypothetical protein	NA	I7I023	Enterobacteria_phage	76.1	6.3e-73
WP_044701866.1|4687933_4688176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044701867.1|4688670_4689453_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
4688574:4688621	attR	GGCTGAGAAATACCCGTACCACCTGATCTGGATAATGCCAGCGTAGGG	NA	NA	NA	NA
WP_044701870.1|4689455_4690256_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003027325.1|4690298_4691045_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044701874.1|4691018_4691984_-	sugar kinase	NA	NA	NA	NA	NA
WP_044701877.1|4691980_4692985_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	4.1e-12
WP_003027315.1|4692981_4694259_-	MFS transporter	NA	NA	NA	NA	NA
WP_071681969.1|4694242_4694476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003027312.1|4694511_4695564_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003027310.1|4695586_4696486_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	2.8e-12
WP_003834417.1|4696617_4697349_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003840185.1|4697610_4698279_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_003027301.1|4698278_4698995_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_044701878.1|4699001_4699733_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003027295.1|4699749_4700478_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
WP_044701881.1|4700703_4701219_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160725.1|4701345_4701669_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044701884.1|4701665_4702496_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_003840192.1|4702601_4703615_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044701955.1|4703712_4705143_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_044701886.1|4705153_4706155_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_003027264.1|4706191_4707910_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	8.9e-31
WP_044701888.1|4708062_4708497_+	DoxX family protein	NA	NA	NA	NA	NA
WP_044701891.1|4708572_4710186_-	FAD-NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_003027256.1|4710385_4711354_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_044701892.1|4711364_4713017_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_044701893.1|4713172_4714072_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_003840208.1|4714216_4714912_-	aquaporin Z	NA	NA	NA	NA	NA
WP_003036822.1|4715283_4716942_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_016150622.1|4716938_4717886_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_016150621.1|4718045_4719161_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_003840216.1|4719157_4721104_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
WP_003036813.1|4721178_4721403_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|4721726_4722047_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|4722077_4724354_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_044701894.1|4724623_4725985_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	5.3e-204
WP_003841759.1|4726144_4726477_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|4726612_4727335_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003844344.1|4727331_4728735_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
>prophage 8
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	4779924	4787549	5029496		Enterobacteria_phage(42.86%)	7	NA	NA
WP_003844299.1|4779924_4780467_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.7	3.3e-56
WP_003844298.1|4780483_4781572_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.0	4.1e-98
WP_044701929.1|4781571_4782471_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	3.0e-30
WP_044701931.1|4782509_4783382_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	1.7e-107
WP_032936740.1|4783714_4785121_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.4e-37
WP_044701934.1|4785319_4786486_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	1.5e-114
WP_044701936.1|4786544_4787549_-	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	32.2	1.9e-17
>prophage 9
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	4939949	4966884	5029496	transposase,integrase,holin	Escherichia_phage(19.35%)	41	4933414:4933428	4959078:4959092
4933414:4933428	attL	TTGACGCATAACCGG	NA	NA	NA	NA
WP_003034686.1|4939949_4940693_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|4940733_4941129_-	membrane protein	NA	NA	NA	NA	NA
WP_101677548.1|4941181_4941946_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	1.4e-55
WP_047715903.1|4941933_4943247_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	89.9	3.9e-236
WP_003034696.1|4943305_4943542_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	92.3	2.1e-39
WP_047715901.1|4943581_4944016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047715899.1|4944012_4944435_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.0	2.5e-67
WP_052941163.1|4944436_4944853_-	hypothetical protein	NA	A0A125RNQ8	Pseudomonas_phage	31.1	6.3e-07
WP_047715896.1|4944849_4945341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052941164.1|4945337_4945829_-	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	40.5	4.7e-09
WP_047715894.1|4945825_4946653_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	84.4	6.9e-122
WP_047715892.1|4947822_4948029_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	7.4e-17
WP_047715889.1|4948067_4948418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047715886.1|4948417_4948852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047715883.1|4948868_4949621_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	55.8	1.5e-75
WP_047715881.1|4949655_4949907_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	52.2	2.7e-13
WP_047715878.1|4949935_4950490_+	hypothetical protein	NA	U5P4K1	Shigella_phage	51.9	2.2e-47
WP_047715876.1|4950822_4951806_+	hypothetical protein	NA	S5FM81	Shigella_phage	71.9	2.6e-59
WP_047715874.1|4951808_4952252_+	hypothetical protein	NA	U5P0U0	Shigella_phage	31.1	4.8e-13
WP_047715872.1|4952251_4952920_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.1	9.9e-95
WP_047715870.1|4952906_4953125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047715867.1|4953126_4953447_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	57.7	2.2e-28
WP_047715865.1|4953443_4953833_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	66.7	7.9e-44
WP_080964714.1|4953849_4954575_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.0	2.0e-56
WP_047715863.1|4954571_4955561_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	71.7	1.1e-142
WP_047715860.1|4955575_4956154_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-47
WP_044703006.1|4956750_4957329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008323296.1|4957428_4957824_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
WP_046155109.1|4957810_4958092_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	88.2	5.5e-39
WP_044703002.1|4958091_4958709_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	72.2	4.4e-81
WP_047715857.1|4958716_4958986_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	9.0e-23
WP_080941989.1|4959173_4959467_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.9	1.4e-21
4959078:4959092	attR	TTGACGCATAACCGG	NA	NA	NA	NA
WP_044702996.1|4959536_4959773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702995.1|4959964_4960489_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	96.0	4.9e-89
WP_044703079.1|4960567_4961077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044703081.1|4961555_4961759_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	62.9	2.0e-06
WP_042922212.1|4961922_4962300_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_042922210.1|4962299_4962647_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922208.1|4962696_4964235_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_044702835.1|4965674_4965911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702837.1|4966215_4966884_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.3e-81
>prophage 10
NZ_CP011657	Citrobacter freundii strain CAV1741, complete genome	5029496	4972800	4982491	5029496	transposase	uncultured_Caudovirales_phage(44.44%)	12	NA	NA
WP_003841892.1|4972800_4974051_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_003030767.1|4974189_4974699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003840850.1|4974873_4975116_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_071681874.1|4975194_4975428_+	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	80.3	6.6e-22
WP_008320415.1|4975504_4976203_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_003030762.1|4976288_4976609_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_016150088.1|4976653_4977943_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.2e-166
WP_044702844.1|4977955_4978381_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.7e-50
WP_032948081.1|4979269_4979755_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	2.3e-08
WP_044702845.1|4979765_4980020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032949082.1|4980285_4980558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100216202.1|4981322_4982491_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
>prophage 1
NZ_CP011654	Citrobacter freundii strain CAV1741 plasmid pCAV1741-101, complete sequence	100873	220	25531	100873	integrase,transposase	Macacine_betaherpesvirus(25.0%)	17	4818:4833	27316:27331
WP_001572362.1|220_1243_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652310.1|2318_3059_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_022652311.1|3384_4374_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
4818:4833	attL	TACCTGCTCCTGCCAG	NA	NA	NA	NA
WP_022652312.1|5229_5499_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652313.1|5502_6033_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086538014.1|6164_7058_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	87.1	6.7e-155
WP_022652315.1|8159_9311_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_001201739.1|9419_9803_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|9799_10147_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_032430836.1|10196_11732_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.5	6.5e-259
WP_047715661.1|11788_13147_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.7e-117
WP_022652317.1|13972_15139_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_022652318.1|15138_16104_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652236.1|18132_20271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652237.1|20574_22008_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_022652238.1|22041_23256_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.4e-35
WP_022652239.1|23404_25531_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
27316:27331	attR	TACCTGCTCCTGCCAG	NA	NA	NA	NA
>prophage 1
NZ_CP011655	Citrobacter freundii strain CAV1741 plasmid pCAV1741-110, complete sequence	109688	1155	51997	109688	tail,terminase	Salmonella_phage(98.28%)	62	NA	NA
WP_082636818.1|1155_1401_-	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	1.2e-37
WP_023180886.1|1543_1759_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	98.6	3.1e-34
WP_016051705.1|1769_1988_+	hypothetical protein	NA	J9Q804	Salmonella_phage	100.0	4.9e-35
WP_047722182.1|2083_2398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722183.1|2474_2786_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	90.3	5.7e-45
WP_000218787.1|2914_3307_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
WP_006812528.1|3427_3715_+	hypothetical protein	NA	J9Q753	Salmonella_phage	98.9	1.6e-49
WP_120714887.1|3674_3908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722184.1|3920_4403_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.2	2.7e-86
WP_047722185.1|5047_5251_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	97.0	5.4e-28
WP_047722186.1|5301_5952_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	1.2e-113
WP_073849444.1|6273_6582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722187.1|6585_7113_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	95.9	3.5e-79
WP_000683475.1|7117_7540_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_001291547.1|7599_7878_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_047722188.1|7880_9440_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.6	5.7e-295
WP_047722189.1|9504_10206_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.1	6.2e-124
WP_047722190.1|10205_10874_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	98.6	5.6e-114
WP_006812519.1|10870_11509_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_047722191.1|11501_11756_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.6e-40
WP_002228789.1|11752_12652_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
WP_000176291.1|12661_12928_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_047722192.1|13123_13765_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	7.5e-108
WP_002211787.1|13767_15024_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_047722193.1|15057_16632_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	7.1e-301
WP_047722195.1|16654_17551_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	2.3e-147
WP_040110313.1|17577_18453_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	1.9e-162
WP_001115046.1|18527_19451_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
WP_000801184.1|19494_19929_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_047722196.1|19928_20762_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	1.3e-152
WP_001027662.1|20859_21204_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_047722198.1|21194_21668_+	hypothetical protein	NA	J9Q711	Salmonella_phage	98.7	5.7e-81
WP_000469441.1|21669_22053_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_006812510.1|22127_22874_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
WP_000163862.1|22933_23251_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002228782.1|23331_23601_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
WP_047722199.1|23608_28192_+	tape measure protein	NA	J9Q712	Salmonella_phage	92.0	0.0e+00
WP_000440566.1|28233_28569_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_155404702.1|28625_29360_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
WP_047722201.1|29349_30147_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	95.8	7.0e-156
WP_001293197.1|30134_30722_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
WP_052941152.1|30736_35125_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	86.8	0.0e+00
WP_120714888.1|35515_38113_+|tail	tail fiber domain-containing protein	tail	A0A2H4P6K4	Salmonella_phage	49.5	1.3e-155
WP_000064174.1|38226_38550_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
WP_047722203.1|38563_39256_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	95.7	8.6e-126
WP_082636819.1|39324_39669_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	82.1	1.0e-26
WP_001287064.1|39719_40271_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
WP_023180946.1|40601_41267_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	1.0e-112
WP_047722206.1|41266_41626_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	1.9e-44
WP_047722207.1|41670_42390_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	41.6	2.9e-44
WP_052941154.1|42456_43629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722208.1|43824_44550_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.8	1.4e-139
WP_006812582.1|44610_45951_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_082636815.1|46012_47224_+	DNA primase	NA	J9Q720	Salmonella_phage	96.8	5.0e-214
WP_000209842.1|47225_48278_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
WP_000642525.1|48461_49256_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
WP_047722276.1|49556_49814_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	8.9e-36
WP_047722211.1|49848_51171_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.3	2.8e-258
WP_023180936.1|51170_51347_+	hypothetical protein	NA	J9Q729	Salmonella_phage	98.3	3.1e-24
WP_011011092.1|51336_51543_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
WP_000613550.1|51542_51695_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	98.0	8.9e-20
WP_000067984.1|51691_51997_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
NZ_CP011655	Citrobacter freundii strain CAV1741 plasmid pCAV1741-110, complete sequence	109688	55815	108770	109688	integrase,protease	Salmonella_phage(89.66%)	68	52566:52583	64722:64739
52566:52583	attL	AATGATTCCATACATCCA	NA	NA	NA	NA
WP_071845140.1|55815_56649_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.5	1.1e-90
WP_000159906.1|56659_56863_+	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
WP_000131231.1|56878_57259_+	hypothetical protein	NA	Q716B1	Shigella_phage	67.2	6.7e-40
WP_047722214.1|57258_57504_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	45.5	1.7e-12
WP_047722215.1|57531_57759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050194547.1|57733_58270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722216.1|58517_59624_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.1e-25
WP_000224608.1|59615_60002_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004110118.1|60266_60479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722219.1|60588_62961_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.1	0.0e+00
WP_047722221.1|63057_64293_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	1.9e-237
WP_047722223.1|64473_67992_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
64722:64739	attR	TGGATGTATGGAATCATT	NA	NA	NA	NA
WP_002213143.1|67988_68432_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
WP_047722224.1|68577_69003_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	63.8	2.3e-49
WP_047722225.1|69013_69313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722227.1|69354_70029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102109.1|70187_70619_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
WP_047722229.1|70738_71767_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.1	1.6e-165
WP_047722230.1|71827_72772_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	2.8e-180
WP_000920226.1|72771_73038_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_047722232.1|73040_74117_+	recombinase	NA	J9Q736	Salmonella_phage	99.4	2.7e-203
WP_000589750.1|74208_74409_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_047722234.1|74412_75243_+|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	98.9	4.2e-127
WP_047722235.1|75405_75777_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	97.6	1.1e-68
WP_032655922.1|75760_76171_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	98.5	4.8e-76
WP_004110038.1|76239_76515_+	hypothetical protein	NA	J9Q738	Salmonella_phage	97.8	4.1e-47
WP_004110036.1|76555_76735_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
WP_023180917.1|76731_77067_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	9.1e-57
WP_006812558.1|77066_77279_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_155404703.1|77501_77642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722236.1|77847_78912_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	96.6	4.0e-183
WP_047722237.1|79656_80301_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.4e-122
WP_047722238.1|80376_80871_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	95.1	7.3e-87
WP_047722239.1|81047_82133_+	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.6	2.0e-206
WP_000107766.1|82129_82366_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
WP_047722240.1|82362_84279_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.4	0.0e+00
WP_047722241.1|84268_85015_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	97.2	8.4e-135
WP_002214145.1|85026_85596_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_004110010.1|85673_87989_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.6	0.0e+00
WP_040110278.1|88096_89239_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.7	2.9e-219
WP_047722242.1|89321_90191_+	phosphoribosyl-ATP pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	99.7	7.2e-162
WP_082636817.1|90368_91484_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	2.0e-217
WP_047722244.1|91485_91899_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	98.5	1.2e-71
WP_047722245.1|91895_92372_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	98.1	2.0e-89
WP_047722246.1|92371_93016_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.5	1.2e-116
WP_047722248.1|93079_93499_+	hypothetical protein	NA	J9Q743	Salmonella_phage	97.1	2.4e-67
WP_047722249.1|93508_94051_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	97.8	5.0e-97
WP_047722250.1|94089_95196_-	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_080964707.1|95323_96250_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	91.8	9.5e-104
WP_047722252.1|96435_97029_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.0	2.3e-111
WP_047722253.1|97232_97463_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	97.4	2.3e-35
WP_004197483.1|98280_98601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052941155.1|98885_99488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722255.1|99882_100377_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	98.2	2.1e-81
WP_047722256.1|100386_100575_+	hypothetical protein	NA	J9Q800	Salmonella_phage	98.4	3.6e-26
WP_080201286.1|100740_101499_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	99.2	7.9e-133
WP_047722259.1|101607_102180_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	99.5	4.8e-98
WP_047722260.1|102321_104007_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
WP_047722261.1|104065_104755_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	96.5	1.7e-121
WP_006812541.1|104751_105033_+	hypothetical protein	NA	J9Q801	Salmonella_phage	100.0	6.5e-48
WP_047722262.1|105035_105407_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	1.6e-62
WP_000086990.1|105498_106140_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
WP_047722263.1|106136_106688_+	hypothetical protein	NA	J9Q748	Salmonella_phage	92.3	3.9e-97
WP_047722264.1|106726_107416_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	87.9	8.6e-110
WP_006812537.1|107471_107675_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
WP_047722265.1|107864_108131_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	4.0e-31
WP_047722266.1|108216_108453_+	hypothetical protein	NA	J9Q7H8	Salmonella_phage	97.4	9.3e-40
WP_052941156.1|108452_108770_+	hypothetical protein	NA	J9Q750	Salmonella_phage	81.9	3.6e-47
>prophage 1
NZ_CP011656	Citrobacter freundii strain CAV1741 plasmid pKPC_CAV1741, complete sequence	129196	4707	61879	129196	transposase,integrase	Escherichia_phage(26.32%)	50	28617:28632	69172:69187
WP_032420248.1|4707_5475_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.7	2.0e-14
WP_002353184.1|6088_6478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353195.1|6728_6920_-	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	55.6	7.8e-05
WP_002353175.1|7081_7405_-	ccdB family protein	NA	NA	NA	NA	NA
WP_002353172.1|7404_7653_-	post-segregation antitoxin CcdA family protein	NA	NA	NA	NA	NA
WP_032420243.1|7750_8215_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	41.5	9.5e-20
WP_002353166.1|8614_8983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032420263.1|9218_9584_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	3.7e-11
WP_032420262.1|9615_10152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032420241.1|10189_10648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020316842.1|10644_11472_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_020316825.1|11474_13460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020316827.1|14537_15251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316829.1|15265_16288_+	CpaF family protein	NA	NA	NA	NA	NA
WP_002353183.1|16986_17262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353162.1|17268_17628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032420234.1|17640_20220_+	ATPase AAA	NA	NA	NA	NA	NA
WP_020316841.1|20216_21029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032420232.1|21028_21487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316822.1|21533_22508_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_020316826.1|22518_23244_+	VirB8 protein	NA	NA	NA	NA	NA
WP_032420230.1|23248_24082_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_020316837.1|24084_25461_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_002353202.1|25441_25978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002396882.1|25983_26175_+	lipoprotein	NA	NA	NA	NA	NA
WP_032420226.1|26171_26858_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.1	4.6e-23
WP_043053774.1|26858_27209_+	trbM family protein	NA	NA	NA	NA	NA
28617:28632	attL	ATATTGCAGGCTTCAG	NA	NA	NA	NA
WP_004152397.1|29962_31282_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|31531_32413_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|32799_33579_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|33575_34601_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|34707_37737_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|37846_39562_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001217881.1|40675_41233_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|41415_42276_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_004206935.1|44067_44721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187496.1|44794_45025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316718.1|45309_46377_+	RepA protein, IncFII family	NA	NA	NA	NA	NA
WP_000845048.1|48624_49638_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_047715654.1|49723_50356_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_047715652.1|50425_51217_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|51380_51728_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|51721_52561_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|52965_54507_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032491313.1|54862_55342_+	trimethoprim-resistant dihydrofolate reductase DfrA3b	NA	A0A0N9RSY5	Escherichia_phage	30.7	1.8e-10
WP_023279823.1|55442_56366_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_032491180.1|56531_57392_+	class A extended-spectrum beta-lactamase SHV-30	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|57412_58174_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004206881.1|58281_61179_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
WP_000509966.1|61273_61879_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
69172:69187	attR	CTGAAGCCTGCAATAT	NA	NA	NA	NA
