The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	178400	185905	4849467	integrase	Enterobacteria_phage(85.71%)	10	174547:174559	180551:180563
174547:174559	attL	AATAGTGTCCAGT	NA	NA	NA	NA
WP_032620849.1|178400_179663_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.4	8.2e-74
WP_080288371.1|179698_180760_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
180551:180563	attR	ACTGGACACTATT	NA	NA	NA	NA
WP_032620851.1|180756_181896_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_017692853.1|182234_182798_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_023323621.1|182826_183045_-	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_032620852.1|183047_183791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026094409.1|184353_184620_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_032620854.1|184616_185171_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.1	1.5e-35
WP_032620855.1|185163_185463_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
WP_032620857.1|185455_185905_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
>prophage 2
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	1407689	1466231	4849467	portal,protease,capsid,tRNA,head,terminase,holin,tail,integrase	Enterobacterial_phage(33.33%)	77	1410448:1410463	1446100:1446115
WP_032103856.1|1407689_1408802_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_032619915.1|1408842_1409316_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032619914.1|1409315_1409978_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|1410095_1411346_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
1410448:1410463	attL	TGCGTCAGGAACTGGA	NA	NA	NA	NA
WP_015570796.1|1411421_1411667_+	YmjA family protein	NA	NA	NA	NA	NA
WP_023296321.1|1411671_1413171_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_071524166.1|1413295_1413388_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|1413757_1414006_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1414059_1414134_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|1414134_1414233_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032619912.1|1414278_1415307_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.4	2.5e-12
WP_015570791.1|1415618_1415873_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|1415953_1416259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570789.1|1416259_1416604_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_032619911.1|1416755_1417463_+	CTP synthase	NA	NA	NA	NA	NA
WP_017384696.1|1417494_1418682_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_017384695.1|1418781_1419573_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|1419556_1420003_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_032619910.1|1420109_1422146_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_015570785.1|1422161_1423493_-	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
WP_015570783.1|1423901_1424402_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032619909.1|1424621_1425764_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_022650818.1|1425738_1426002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619908.1|1426034_1426304_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	1.5e-30
WP_032620364.1|1426383_1426728_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
WP_032619906.1|1427325_1428153_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	85.6	1.5e-121
WP_032620361.1|1428152_1428566_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.2	5.2e-54
WP_032103842.1|1429285_1429495_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	75.0	3.0e-18
WP_032620359.1|1429522_1429732_-	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	6.6e-13
WP_032619905.1|1429831_1430266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619903.1|1430313_1431066_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	70.1	4.5e-80
WP_071842884.1|1431100_1431352_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_023315870.1|1431380_1431935_+	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_032619902.1|1432098_1432278_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_032634002.1|1432267_1433146_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	81.4	1.7e-38
WP_032619901.1|1433142_1433637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619900.1|1433636_1434296_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	77.9	2.3e-96
WP_032619899.1|1434292_1434616_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	90.4	4.1e-46
WP_032619898.1|1434612_1435002_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.9	2.9e-62
WP_050595702.1|1435017_1435743_+	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	1.1e-54
WP_032619897.1|1435739_1436729_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	92.1	4.2e-182
WP_032619895.1|1436743_1437106_+	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	90.8	3.4e-57
WP_032619892.1|1437142_1437946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032264642.1|1438173_1438578_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_000220248.1|1438574_1438856_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_032619887.1|1438852_1439395_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
WP_032619884.1|1439391_1439667_+	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	96.0	9.3e-07
WP_047715785.1|1439617_1439812_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	1.3e-18
WP_032619880.1|1440060_1440321_-	hypothetical protein	NA	A0A089FW14	Salmonella_phage	40.2	2.5e-09
WP_032619877.1|1440407_1441865_+	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.2	2.0e-278
WP_032619873.1|1441846_1442437_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	77.6	9.3e-89
WP_032619870.1|1442436_1442787_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_032619868.1|1442944_1443418_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619866.1|1443417_1445175_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
WP_032619865.1|1445174_1446479_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
1446100:1446115	attR	TCCAGTTCCTGACGCA	NA	NA	NA	NA
WP_032619863.1|1446492_1447341_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_023296252.1|1447350_1448562_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619860.1|1448605_1448932_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_022648888.1|1448940_1449279_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_022648886.1|1449721_1450069_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_006809155.1|1450128_1450572_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_001549114.1|1450580_1450964_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_032619858.1|1450972_1451251_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_032619857.1|1451306_1451648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620356.1|1451705_1455008_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	84.9	0.0e+00
WP_022648882.1|1455010_1455349_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032619855.1|1455345_1456104_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	3.9e-95
WP_022648880.1|1456106_1456817_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_032619853.1|1456816_1457404_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	3.6e-48
WP_032619850.1|1457456_1461302_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	62.7	0.0e+00
WP_022651029.1|1461345_1461660_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_032619848.1|1461660_1462332_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	9.9e-87
WP_017382566.1|1462439_1462673_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_032636446.1|1462731_1464045_+	hypothetical protein	NA	K7PH95	Enterobacterial_phage	52.6	2.7e-112
WP_154232874.1|1464139_1464379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650865.1|1464366_1464687_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
WP_032619843.1|1464947_1466231_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	2.5e-09
>prophage 3
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	2336591	2431548	4849467	portal,protease,coat,plate,tRNA,tail,terminase,holin,integrase	Salmonella_phage(12.77%)	103	2387927:2387942	2432765:2432780
WP_032619517.1|2336591_2338325_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	8.8e-87
WP_026080697.1|2338359_2339499_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_017693238.1|2339503_2341087_-	MFS transporter	NA	NA	NA	NA	NA
WP_023303901.1|2341347_2341740_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_023303902.1|2341739_2343818_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006811100.1|2343810_2344959_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_003859718.1|2345109_2345754_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763862.1|2345764_2346154_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_014884341.1|2346171_2347221_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_017384409.1|2347217_2348084_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_017693235.1|2348103_2349705_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_023303904.1|2349749_2351417_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
WP_017384412.1|2351502_2352465_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303905.1|2352461_2354846_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032619515.1|2354821_2355583_-	molecular chaperone	NA	NA	NA	NA	NA
WP_015570265.1|2355599_2356148_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303908.1|2356155_2356728_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_023303909.1|2357155_2358415_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003859699.1|2358511_2359015_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017384416.1|2359034_2361044_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_017693230.1|2361048_2361978_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003859696.1|2361974_2362862_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003859695.1|2362985_2363564_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006811111.1|2363566_2363926_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_017384418.1|2364713_2365142_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_015570257.1|2365157_2366582_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_023303910.1|2366556_2367360_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003859689.1|2367513_2368494_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_032619514.1|2368508_2370023_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.2	6.9e-11
WP_017384422.1|2370094_2371084_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_017384423.1|2371401_2371959_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_032619513.1|2372462_2372966_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_017693227.1|2373107_2374451_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003859683.1|2374531_2374783_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_003859682.1|2374889_2374973_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_017384426.1|2375187_2376606_+	MFS transporter	NA	NA	NA	NA	NA
WP_003859680.1|2376648_2377287_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_015570249.1|2377532_2377871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859676.1|2378071_2378569_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_003859673.1|2378605_2378842_-	YecH family protein	NA	NA	NA	NA	NA
WP_032620305.1|2379033_2380245_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859671.1|2380561_2381230_-	YecA family protein	NA	NA	NA	NA	NA
WP_003859669.1|2381641_2382763_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859667.1|2382831_2383746_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023303913.1|2383757_2385032_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_015570244.1|2385028_2385904_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_032619512.1|2385900_2386617_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.1e-11
WP_017384432.1|2386782_2387253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619511.1|2387258_2388185_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2387927:2387942	attL	TGCGAAATACCCGGCA	NA	NA	NA	NA
WP_017384434.1|2388214_2388538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619510.1|2390197_2390731_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032619509.1|2390727_2392002_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012906750.1|2392285_2392465_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032619507.1|2392486_2392891_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_032619506.1|2392931_2394002_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032619505.1|2394078_2394657_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_050019395.1|2394656_2396834_-	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.9	3.9e-55
WP_032619504.1|2396836_2397388_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_032619503.1|2397380_2398295_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	1.6e-58
WP_032619502.1|2398278_2398632_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_032619501.1|2398668_2399787_-	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	7.8e-36
WP_032620301.1|2399789_2400005_-|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619500.1|2399979_2400450_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_032619498.1|2402693_2402981_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032619497.1|2403032_2403539_-|tail	tail protein	tail	NA	NA	NA	NA
WP_032619495.1|2403535_2405005_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
WP_032619493.1|2405043_2405667_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
WP_023303465.1|2405659_2406214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023299864.1|2406222_2406885_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.9e-21
WP_023303463.1|2406886_2407243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619492.1|2407242_2407578_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_103848174.1|2407646_2409704_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
WP_032619491.1|2409696_2411217_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.3e-153
WP_023299859.1|2411225_2411441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619490.1|2411437_2413558_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	9.2e-304
WP_032619489.1|2413561_2414065_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_032619488.1|2414340_2414601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619487.1|2414789_2415017_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
WP_020690713.1|2415089_2415293_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_032619486.1|2415441_2415699_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
WP_032620296.1|2415824_2416100_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	1.6e-22
WP_032619484.1|2416107_2416737_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	5.1e-101
WP_044489029.1|2416733_2417030_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_032619483.1|2417026_2417431_-	exported phage-related protein	NA	NA	NA	NA	NA
WP_032619482.1|2417769_2418375_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	1.2e-75
WP_032619481.1|2418371_2418728_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.3	9.1e-39
WP_032619479.1|2420536_2420833_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	59.1	2.6e-23
WP_164474158.1|2420972_2421140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619477.1|2421318_2421642_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	7.0e-30
WP_032620293.1|2421827_2422181_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	92.5	5.4e-52
WP_032619476.1|2422711_2422945_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	2.8e-12
WP_032619475.1|2423140_2423797_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	26.9	3.2e-13
WP_032619474.1|2423814_2424555_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.3	1.1e-99
WP_032619473.1|2424557_2425475_-	hypothetical protein	NA	U5P0A0	Shigella_phage	40.0	2.4e-51
WP_032620290.1|2425497_2425950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619472.1|2425949_2426219_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.2e-08
WP_032619471.1|2426291_2426783_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	55.0	1.4e-16
WP_155858306.1|2427068_2427239_+	hypothetical protein	NA	A0A1I9SEJ3	Klebsiella_phage	50.9	4.7e-09
WP_032619469.1|2427625_2427898_+	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.2	2.7e-14
WP_032619468.1|2428120_2430025_+	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	29.8	7.3e-18
WP_032619467.1|2430011_2430254_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_032619466.1|2430313_2430535_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_032619465.1|2430534_2431548_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	69.0	5.6e-134
2432765:2432780	attR	TGCGAAATACCCGGCA	NA	NA	NA	NA
>prophage 4
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	2531435	2540720	4849467		Bodo_saltans_virus(14.29%)	8	NA	NA
WP_017693103.1|2531435_2532047_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_032619360.1|2532086_2533067_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_032619359.1|2533261_2534266_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	1.9e-33
WP_032619358.1|2534315_2535482_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
WP_017693099.1|2535720_2536602_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_032619357.1|2536602_2537688_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	8.2e-99
WP_032619355.1|2537777_2539184_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
WP_032619354.1|2539349_2540720_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
>prophage 5
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	3005995	3030485	4849467	integrase,transposase	Enterobacteria_phage(40.0%)	30	3023545:3023558	3031594:3031607
WP_003860714.1|3005995_3007801_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_164474130.1|3008038_3008179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3008429_3009576_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_155858305.1|3009578_3009731_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	100.0	4.4e-19
WP_032619262.1|3009939_3010539_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	87.3	2.9e-98
WP_032619259.1|3010945_3011179_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	79.2	1.2e-28
WP_032619258.1|3011442_3012201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489041.1|3012248_3014324_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.6e-199
WP_032619256.1|3014320_3014578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619254.1|3014579_3015059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619253.1|3015055_3015316_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	62.5	7.9e-24
WP_032619252.1|3015302_3016034_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_032619251.1|3016045_3016738_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
WP_032619250.1|3016721_3017714_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032619249.1|3018149_3018692_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	55.6	4.3e-48
WP_017693529.1|3019045_3019459_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.2e-07
WP_032619247.1|3019650_3019836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651662.1|3019955_3020141_+	YebW family protein	NA	NA	NA	NA	NA
WP_022651663.1|3020150_3020309_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
WP_022651664.1|3020392_3020680_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_032619246.1|3020802_3023862_+	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.5	0.0e+00
3023545:3023558	attL	AGCCTGCGCGCCAG	NA	NA	NA	NA
WP_022651666.1|3023871_3024957_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_032619244.1|3024991_3025603_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.0	1.8e-42
WP_017692869.1|3025589_3025832_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_022651668.1|3025878_3026163_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_006811608.1|3026140_3027370_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_006811609.1|3027801_3028278_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_023304255.1|3028274_3029228_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572138.1|3029227_3029878_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3029909_3030485_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
3031594:3031607	attR	CTGGCGCGCAGGCT	NA	NA	NA	NA
>prophage 6
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	3066416	3109125	4849467	transposase,protease,tRNA,integrase	Staphylococcus_phage(14.29%)	40	3071762:3071781	3112015:3112034
WP_014832949.1|3066416_3067184_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015571575.1|3067215_3067755_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3067770_3068019_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3068135_3069497_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_013098352.1|3069588_3070455_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3070474_3071761_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
3071762:3071781	attL	AATGTAGGCCGGGTAAGGCG	NA	NA	NA	NA
WP_003863126.1|3071812_3072406_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017383004.1|3072528_3073407_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015571579.1|3073492_3075154_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3075128_3075311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304267.1|3075292_3075631_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_023304268.1|3075739_3076027_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3076016_3076493_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3076610_3077093_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_032619204.1|3077669_3078941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.5	1.4e-214
WP_080288391.1|3079097_3080819_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	22.9	9.6e-17
WP_050019407.1|3080852_3082988_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_128302277.1|3083309_3084212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047685188.1|3084215_3084422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619198.1|3085149_3086511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620260.1|3086687_3087065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619196.1|3087033_3088224_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_032619194.1|3088754_3089141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619193.1|3089160_3089475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619191.1|3089511_3089937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001625709.1|3090033_3090420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619190.1|3090434_3092309_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032619187.1|3092305_3093610_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032619186.1|3093602_3094805_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001019190.1|3095100_3095400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|3095420_3095627_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001067212.1|3095907_3096753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3098186_3099333_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_001618768.1|3099784_3100663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618769.1|3100788_3101001_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	4.2e-07
WP_001618770.1|3101127_3102543_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_071842894.1|3102673_3103300_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_032619182.1|3103414_3105484_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_032619181.1|3105494_3108092_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_080288382.1|3108156_3109125_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	5.1e-185
3112015:3112034	attR	CGCCTTACCCGGCCTACATT	NA	NA	NA	NA
>prophage 7
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	3487537	3524045	4849467	integrase,transposase	Stx2-converting_phage(20.0%)	25	3500538:3500552	3527972:3527986
WP_000227969.1|3487537_3488614_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016151369.1|3490153_3490504_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_022649395.1|3492667_3493636_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_007896426.1|3493789_3495115_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|3496358_3496880_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_023304425.1|3496876_3497830_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|3497916_3500241_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|3500285_3501188_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
3500538:3500552	attL	GGAACGCGCGCGCAG	NA	NA	NA	NA
WP_004118243.1|3501184_3502183_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|3502179_3503136_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|3503136_3503904_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|3504002_3504296_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|3504626_3504905_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|3505166_3506171_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032435706.1|3506574_3507567_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007851507.1|3507936_3509019_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_007894989.1|3509140_3512215_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_003846917.1|3512266_3513520_+	lactose permease	NA	NA	NA	NA	NA
WP_017384068.1|3514601_3515735_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000019450.1|3516005_3516986_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_085949497.1|3517269_3518417_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_017384060.1|3518507_3518936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|3518939_3521057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897920.1|3521044_3522811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|3522797_3524045_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3527972:3527986	attR	CTGCGCGCGCGTTCC	NA	NA	NA	NA
>prophage 8
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	3581983	3624363	4849467	portal,capsid,plate,tRNA,head,tail,terminase,integrase,lysis	Erwinia_phage(38.1%)	49	3574947:3574966	3629820:3629839
3574947:3574966	attL	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
WP_015571911.1|3581983_3582997_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
WP_001144069.1|3583233_3583449_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032618997.1|3583564_3585310_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_015571912.1|3585462_3587307_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_017384024.1|3587407_3587914_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032618996.1|3588193_3588841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063132245.1|3588863_3589082_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	5.4e-34
WP_032618995.1|3589147_3590317_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.5	2.5e-170
WP_032618994.1|3590313_3590778_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	2.1e-59
WP_032618993.1|3590788_3593239_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.1	9.3e-308
WP_032665230.1|3593228_3593351_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	7.7e-14
WP_032618991.1|3593383_3593707_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_017382996.1|3593764_3594283_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_023323582.1|3594295_3595489_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_032618988.1|3595863_3596295_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.1	7.0e-17
WP_044489085.1|3596296_3598645_-|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	49.2	3.0e-114
WP_032620226.1|3598656_3599187_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	2.4e-91
WP_032618987.1|3599179_3600088_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_032618985.1|3600093_3600444_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	6.2e-40
WP_032618984.1|3600440_3601076_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.7	8.2e-99
WP_032618983.1|3601144_3601594_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.8	4.7e-48
WP_032618981.1|3601586_3602054_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	2.3e-58
WP_032618979.1|3602149_3602566_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	2.1e-42
WP_032618978.1|3602565_3602997_-	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	78.3	2.8e-58
WP_023295248.1|3602993_3603506_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_032618977.1|3603489_3603711_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_017382979.1|3603701_3603905_-|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_023295250.1|3603904_3604411_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	4.4e-63
WP_032618975.1|3604510_3605266_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.5	9.8e-75
WP_047715936.1|3605269_3606325_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	82.8	3.8e-165
WP_032618973.1|3606380_3607235_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	1.9e-114
WP_032618972.1|3607400_3609170_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.2	6.1e-301
WP_047715938.1|3609171_3610197_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.7	7.9e-168
WP_032618970.1|3610623_3612582_+	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	NA	NA	NA	NA
WP_032618969.1|3612625_3613675_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.9	5.7e-105
WP_032665232.1|3613799_3613997_-	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	71.4	1.5e-11
WP_032618967.1|3614119_3616348_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.6	0.0e+00
WP_032618966.1|3616334_3616556_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	94.4	1.1e-31
WP_032618964.1|3616555_3616783_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	70.1	4.8e-17
WP_032618963.1|3616849_3617188_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	3.6e-53
WP_071842907.1|3617151_3617352_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	1.3e-29
WP_032618962.1|3617359_3617869_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	91.7	8.6e-83
WP_032618960.1|3617899_3618163_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	93.1	5.0e-42
WP_080288393.1|3618287_3618860_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	74.1	1.8e-76
WP_032618959.1|3618859_3619876_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	95.0	8.6e-191
WP_017692643.1|3620232_3621402_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_017692642.1|3621402_3622167_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_017382401.1|3622312_3622807_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032618958.1|3622803_3624363_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.6e-08
3629820:3629839	attR	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
>prophage 9
NZ_CP011650	Enterobacter hormaechei strain CAV1669 chromosome, complete genome	4849467	4749669	4793729	4849467	portal,protease,tRNA,tail,terminase,integrase	Enterobacteria_phage(28.26%)	55	4741256:4741271	4799172:4799187
4741256:4741271	attL	ATGTAGGCCGGGTAAG	NA	NA	NA	NA
WP_044488948.1|4749669_4750212_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.5	3.7e-07
WP_032620638.1|4750217_4750679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620635.1|4750713_4750986_-	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	9.1e-39
WP_032620634.1|4751024_4751594_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	74.6	7.6e-80
WP_032620633.1|4751593_4751791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620632.1|4751787_4752519_-	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.2	1.0e-84
WP_032620631.1|4752515_4752842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620630.1|4752838_4753039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620628.1|4753023_4753566_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.7	3.5e-74
WP_032620626.1|4753701_4754532_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	90.1	4.0e-138
WP_032620624.1|4754587_4754959_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	3.8e-56
WP_154232880.1|4755317_4755473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032665243.1|4755471_4755726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047715955.1|4755697_4755898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634275.1|4756066_4756741_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.2	1.1e-114
WP_032634276.1|4756829_4757030_+	transcriptional regulator	NA	U5P445	Shigella_phage	84.6	3.5e-24
WP_032634277.1|4757073_4757631_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.0	4.0e-65
WP_032634315.1|4757860_4758505_+	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	51.2	5.7e-47
WP_047715956.1|4758506_4758686_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	55.1	1.0e-06
WP_047715957.1|4758682_4759546_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	80.0	1.8e-56
WP_047715965.1|4759548_4760886_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	6.3e-117
WP_032620607.1|4760878_4762810_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	5.6e-199
WP_032620605.1|4762806_4763874_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	1.4e-106
WP_032620604.1|4763890_4764496_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.9	7.6e-70
WP_014832171.1|4765458_4765761_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_032620601.1|4765760_4766297_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	7.7e-90
WP_032620598.1|4766293_4766815_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	3.7e-73
WP_032620596.1|4766844_4767069_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.1	1.1e-18
WP_080288384.1|4767425_4768103_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	54.9	2.3e-35
WP_020884621.1|4768287_4768776_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	98.1	6.5e-80
WP_032620593.1|4768775_4770878_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	99.3	0.0e+00
WP_032620591.1|4770874_4771090_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	9.4e-31
WP_032620589.1|4771086_4772586_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.4	2.5e-287
WP_158650950.1|4772530_4774537_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	98.8	0.0e+00
WP_032620588.1|4774619_4774946_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	96.3	2.5e-51
WP_032620586.1|4774938_4775214_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	97.5	1.2e-38
WP_020884618.1|4775223_4775802_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_001704117.1|4775798_4776200_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_032620582.1|4776209_4776953_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_032620580.1|4776963_4777404_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_071842901.1|4777412_4777727_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_032620577.1|4777710_4780971_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	97.7	0.0e+00
WP_032620574.1|4780967_4781306_+|tail	tail protein	tail	E4WL34	Enterobacteria_phage	99.1	5.2e-60
WP_032620573.1|4781361_4782099_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	6.1e-146
WP_032620572.1|4782101_4782821_+	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	97.9	9.8e-141
WP_032620570.1|4782813_4783431_+|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.0	2.6e-105
WP_128754879.1|4783516_4783996_+	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.0	7.9e-78
WP_032620567.1|4784060_4787990_+|tail	phage tail protein	tail	M9P0D8	Enterobacteria_phage	89.4	0.0e+00
WP_162269496.1|4788185_4788413_-	hypothetical protein	NA	E4WL44	Enterobacteria_phage	89.3	2.9e-30
WP_103848176.1|4788705_4789287_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.3	4.3e-46
WP_032620566.1|4790135_4790687_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	67.0	2.7e-66
WP_128754880.1|4790794_4791061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620563.1|4791044_4791290_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.2e-20
WP_032620560.1|4791509_4792604_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	83.7	1.4e-178
WP_032620558.1|4792691_4793729_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4799172:4799187	attR	ATGTAGGCCGGGTAAG	NA	NA	NA	NA
>prophage 1
NZ_CP011649	Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence	90452	0	43328	90452	integrase,transposase	Escherichia_phage(25.0%)	38	17972:17987	43871:43886
WP_023302476.1|0_867_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
WP_006797591.1|1792_2998_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_023302473.1|2997_3972_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
WP_023302472.1|4053_5325_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
WP_006796638.1|5324_5756_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_074144872.1|6087_7056_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.1e-178
WP_032413487.1|7117_7453_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_017900922.1|7625_7904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805503.1|8166_9120_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
WP_023302470.1|9289_9910_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
WP_074142348.1|10748_11717_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	92.2	1.0e-172
WP_004152397.1|14862_16182_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|16431_17313_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|17511_18291_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
17972:17987	attL	ATCAGCACCACGTTCT	NA	NA	NA	NA
WP_004199214.1|18287_19313_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|19419_22449_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|22558_24274_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001235713.1|25388_25946_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|26128_26989_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_003032490.1|27151_27541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493700.1|28566_28776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|29253_30258_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_010981353.1|30336_30771_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_077269372.1|30700_31054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761850.1|31068_31707_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|31818_32184_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_005413392.1|32180_32417_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010981356.1|32432_32753_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_010981357.1|32791_33406_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_011405615.1|33466_34684_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|34680_35589_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010791757.1|35591_37274_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_031623923.1|37689_38703_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	5.2e-71
WP_001206316.1|38848_39640_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|39803_40151_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|40144_40984_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|41111_41612_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047715681.1|41789_43328_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	7.9e-47
43871:43886	attR	ATCAGCACCACGTTCT	NA	NA	NA	NA
