The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	629352	678195	5402147	terminase,tail,portal,head,capsid,tRNA,protease	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|629352_629847_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|629850_630489_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|630458_630743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|630800_631193_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|631208_631637_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|631902_633030_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|633220_633619_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|633792_635160_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|635247_636306_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|636442_637381_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|637795_638266_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|638641_638905_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|639003_639270_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|639320_639596_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|639675_641643_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|641648_642581_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|642588_642792_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|642923_643853_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|643888_645334_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|645422_649220_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|649257_650727_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|650729_651311_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|651318_651807_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|651806_652799_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|652869_653913_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|654218_656159_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|656238_656430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|656658_657660_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|657659_658268_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|658491_658944_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|658966_659434_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|659444_660794_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|660904_661147_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|661136_662588_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|662599_663481_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|663838_664804_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|664828_665125_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|665278_665470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|665472_667134_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|667117_667474_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|667604_667757_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|667749_668193_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|668192_668492_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|668488_668824_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|668820_670062_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|670063_670624_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|670675_671842_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|672105_672618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|672666_673002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|673344_675480_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|675479_675845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|675841_676210_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|676206_676521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|676513_676702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|676694_676964_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|677415_678195_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 2
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	1770392	1776217	5402147		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|1770392_1770959_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|1770976_1771222_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|1771218_1771956_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|1772516_1772783_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|1772779_1773328_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|1773324_1773552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|1773548_1773869_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|1773883_1776217_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 3
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	2244087	2255738	5402147	integrase	Enterobacteria_phage(70.0%)	13	2232221:2232235	2255275:2255289
2232221:2232235	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|2244087_2246421_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|2246432_2246753_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|2246749_2246977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257658.1|2246973_2247528_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	67.6	4.1e-30
WP_002889915.1|2247524_2247791_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|2248332_2249070_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|2249066_2249312_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|2249329_2249896_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|2250464_2250890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|2250889_2251840_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|2251827_2253018_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|2253370_2254624_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|2254634_2255738_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2255275:2255289	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 4
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	2465293	2511874	5402147	transposase,lysis,head,holin,tRNA	Escherichia_phage(25.0%)	65	NA	NA
WP_004143010.1|2465293_2466679_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|2466724_2466937_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|2466938_2467805_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|2469275_2469611_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|2469612_2469828_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|2469829_2470048_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|2470044_2470812_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|2470808_2471465_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|2471461_2471620_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|2471616_2472297_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|2472293_2473139_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|2473154_2473439_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|2473527_2473722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|2473714_2473825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|2473821_2474037_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|2474387_2475077_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|2475204_2475438_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|2475478_2475700_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|2475785_2475932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|2475972_2476824_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|2476828_2478244_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|2478243_2478537_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|2478533_2479040_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|2479146_2479989_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|2479988_2480165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|2480161_2480809_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|2481309_2481765_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_047718017.1|2481764_2481935_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	3.7e-14
WP_004151286.1|2481927_2482563_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|2482559_2482697_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|2482689_2483220_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|2483216_2483906_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|2484815_2485064_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151281.1|2485066_2485597_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|2485593_2486058_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|2486163_2486493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|2486863_2487466_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|2487465_2488938_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|2488950_2490372_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|2490346_2491351_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|2491392_2491869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|2492841_2494033_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004151271.1|2494636_2495065_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|2495076_2496171_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|2496181_2496421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|2496423_2496804_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|2496803_2496977_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|2496976_2497339_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|2497341_2497767_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|2497763_2498156_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|2498224_2498977_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|2499029_2499707_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|2499882_2500638_+	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|2500640_2500895_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|2501188_2501659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|2501675_2502035_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|2502134_2502305_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|2502294_2503008_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|2503073_2503859_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|2503986_2504490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|2504582_2508029_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151252.1|2508071_2508548_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|2508547_2509018_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|2509014_2509410_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|2509396_2511874_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 5
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	2950038	2997197	5402147	integrase,terminase,tail,lysis,head,capsid,transposase,plate,portal	Salmonella_phage(80.95%)	56	2959769:2959787	2997269:2997287
WP_000019473.1|2950038_2951019_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_014342958.1|2952005_2952134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151716.1|2952786_2953989_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
WP_004151717.1|2954027_2954786_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
WP_004141974.1|2954887_2955481_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004151718.1|2955808_2957041_+	multidrug efflux MFS transporter KdeA	NA	NA	NA	NA	NA
WP_004141971.1|2957078_2957891_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_004151719.1|2957890_2959093_-	MFS transporter	NA	NA	NA	NA	NA
WP_004141969.1|2959175_2959739_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
2959769:2959787	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|2959861_2960842_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|2961329_2962817_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|2962915_2963860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|2963871_2964750_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|2964895_2965117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|2965149_2965659_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|2965666_2965867_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|2965830_2966172_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|2966239_2966473_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|2966472_2966700_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|2966696_2967554_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|2967550_2969965_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|2970118_2970307_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|2970317_2970551_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|2970665_2971343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|2971618_2973361_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|2973422_2974448_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|2974447_2976214_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|2976356_2977190_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|2977206_2978265_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|2978268_2978919_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|2979014_2979479_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|2979478_2979682_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|2979685_2979901_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|2979881_2980391_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|2980395_2980779_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|2980775_2981204_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|2981190_2981337_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|2981299_2981731_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|2981723_2982170_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|2982166_2982859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|2982953_2983526_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|2983522_2983885_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|2983871_2984780_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|2984772_2985372_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|2987590_2988325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|2988328_2989060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|2989056_2989260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|2989289_2990366_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|2990504_2991677_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|2991686_2992202_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|2992254_2992554_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|2992568_2992688_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|2992680_2995308_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|2995304_2995790_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|2995786_2996887_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|2996978_2997197_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
2997269:2997287	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 6
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	3031613	3041077	5402147	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3031613_3032729_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3032725_3034666_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3034742_3034964_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3035289_3035607_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3035637_3037917_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3038037_3038256_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3038609_3039311_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|3039355_3041077_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 7
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	3465715	3537469	5402147	integrase,terminase,holin,transposase,plate	uncultured_Caudovirales_phage(35.29%)	83	3463796:3463810	3472736:3472750
3463796:3463810	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|3465715_3466477_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|3466693_3468226_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|3468424_3468973_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|3469169_3470351_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|3470331_3470574_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|3470533_3470680_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|3470752_3470986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|3471228_3471441_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|3471437_3471662_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|3471651_3472362_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|3472367_3472886_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
3472736:3472750	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|3472990_3473818_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|3473814_3474009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|3474005_3474431_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|3474427_3474646_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|3474617_3474872_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|3474864_3475230_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|3475399_3475588_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|3475580_3475895_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|3476065_3476734_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|3476831_3477053_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|3477629_3479288_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|3479289_3480252_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|3480248_3480725_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|3480721_3481504_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|3481909_3482158_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|3482160_3482691_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|3482687_3483077_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|3483311_3483632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|3483997_3484486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|3484436_3485837_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|3486074_3487526_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|3487581_3488130_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|3488181_3489384_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|3489387_3489882_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|3489893_3490835_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|3490874_3491156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3491124_3491544_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|3491540_3492047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|3492046_3492433_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|3492527_3492968_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|3492971_3494117_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|3494127_3494418_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|3494358_3495551_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|3495877_3496303_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|3496338_3496491_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|3496480_3498484_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|3498483_3499083_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|3499158_3499386_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|3499388_3500411_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|3500410_3500752_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|3500801_3500984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|3501026_3501593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|3501646_3502300_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|3502301_3502655_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|3502654_3503851_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|3503847_3504621_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|3504620_3505487_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|3505486_3505684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|3508034_3508763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|3508773_3509505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|3509501_3509711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|3509815_3510100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|3510322_3510571_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902144.1|3511416_3511908_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|3511950_3513495_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004218490.1|3513504_3514848_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004151603.1|3514844_3515534_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004151602.1|3515530_3517237_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|3517241_3517733_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_002902163.1|3517997_3520652_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_004228410.1|3520653_3523023_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902169.1|3523023_3523803_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_002902172.1|3523866_3524397_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|3524465_3524996_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|3525063_3525594_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|3525662_3526193_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902180.1|3526260_3526791_+	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004151601.1|3526778_3529196_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902252.1|3529240_3529498_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902254.1|3529494_3530634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151599.1|3530617_3534043_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004151598.1|3535714_3537469_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 8
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	3728038	3738925	5402147		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|3728038_3728659_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|3728651_3729917_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|3729928_3730831_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|3731091_3731853_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|3731873_3732734_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|3733031_3733292_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|3733378_3734467_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|3734497_3735763_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|3735817_3738925_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 9
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	4393158	4436257	5402147	tRNA,plate,transposase	Microcystis_virus(25.0%)	42	NA	NA
WP_002910404.1|4393158_4394415_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|4394685_4395297_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|4395296_4396145_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|4396328_4397276_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|4397400_4399080_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|4399080_4400127_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|4400349_4400625_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|4400897_4401482_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|4401599_4402691_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|4402773_4402983_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|4403184_4404099_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|4404230_4405646_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|4405665_4406109_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|4406111_4406648_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|4406628_4407645_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|4407674_4409438_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|4409571_4412982_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|4412965_4414123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|4414126_4414393_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|4414690_4414876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815252.1|4415136_4415439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|4415496_4416477_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|4416813_4417704_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|4417879_4418773_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_038435084.1|4418794_4418923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|4418948_4419842_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004217423.1|4419863_4419980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|4420025_4420919_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|4420940_4421246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093244.1|4421269_4422301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|4422760_4423267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|4423263_4423593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|4423589_4423772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|4423913_4424882_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|4426487_4426997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|4426986_4427139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|4427233_4427740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|4427736_4428246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|4428246_4429602_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004152317.1|4432565_4434263_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|4434266_4434920_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|4434916_4436257_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	4771650	4779275	5402147		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|4771650_4772652_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|4772845_4774012_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|4774192_4774747_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|4774761_4775652_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|4775683_4776553_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|4776579_4777644_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|4777868_4779275_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 11
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	4815842	4822749	5402147	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|4815842_4817321_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|4817317_4818040_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|4818358_4819720_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|4819962_4820859_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|4821101_4821875_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|4821885_4822749_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 12
NZ_CP011647	Klebsiella pneumoniae strain CAV1596 chromosome, complete genome	5402147	5230465	5310075	5402147	integrase,terminase,tail,lysis,head,capsid,tRNA,plate,portal	Salmonella_phage(72.0%)	87	5275169:5275215	5311736:5311782
WP_002914079.1|5230465_5231203_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|5231334_5232666_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|5232711_5233095_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|5233408_5234098_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|5234155_5235241_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|5235444_5235870_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|5235939_5236638_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004151994.1|5236672_5239333_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|5239453_5240809_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|5240850_5241174_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|5241177_5242476_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|5248441_5251015_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|5251144_5251876_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|5251872_5252853_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|5252984_5253722_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|5253992_5254328_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|5254434_5254482_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004150975.1|5254582_5255743_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|5255739_5256612_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|5256674_5257796_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|5257805_5258876_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|5259218_5259728_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|5259720_5260944_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|5260957_5261440_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|5261448_5262819_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|5262875_5263334_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|5263453_5263801_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|5263840_5264608_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|5264639_5265188_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|5265206_5265455_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|5265714_5267079_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|5267242_5268034_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|5268053_5269340_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|5269459_5270050_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|5270174_5271053_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|5271139_5272801_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|5272948_5273290_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|5273356_5273647_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|5273636_5274113_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|5274223_5274706_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
5275169:5275215	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|5275309_5275687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|5275714_5275933_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|5275999_5277094_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|5277090_5277576_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|5277572_5280203_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|5280195_5280315_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|5280329_5280629_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|5280681_5281197_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|5281206_5282379_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|5282527_5283601_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|5283652_5284771_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|5284780_5286730_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|5286731_5287403_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|5287395_5288304_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|5288290_5288653_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|5288649_5289222_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|5289316_5290183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|5290205_5290652_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|5290644_5291067_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|5291029_5291188_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|5291162_5291591_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|5291587_5291971_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|5291975_5292485_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|5292465_5292681_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|5292684_5292888_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|5292887_5293352_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|5293447_5294101_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|5294104_5295157_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|5295173_5296007_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|5296147_5297911_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|5297910_5298954_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|5299010_5299280_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|5299801_5300803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|5300802_5301882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|5301868_5302552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|5302647_5302881_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|5302892_5303081_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|5303243_5305628_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|5305624_5306476_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|5306472_5306700_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|5306699_5306933_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|5307000_5307339_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|5307302_5307503_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|5307510_5308020_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|5308052_5308295_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|5308417_5309047_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|5309049_5310075_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
5311736:5311782	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 1
NZ_CP011644	Klebsiella pneumoniae strain CAV1596 plasmid pCAV1596-41, complete sequence	40939	5792	15230	40939	integrase	Escherichia_phage(42.86%)	10	4363:4375	13679:13691
4363:4375	attL	TGGTCAGAGGGGA	NA	NA	NA	NA
WP_000015958.1|5792_6569_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|6626_6884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|7012_7117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|7646_8513_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|8689_8959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|9373_10579_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064119.1|10578_11553_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_001754953.1|11634_12906_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000776034.1|12905_13337_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|13742_15230_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
13679:13691	attR	TCCCCTCTGACCA	NA	NA	NA	NA
>prophage 1
NZ_CP011646	Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence	96702	2889	43556	96702	transposase,integrase	Salmonella_phage(27.27%)	42	NA	NA
WP_004197635.1|2889_3684_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_020315256.1|3881_4898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644730.1|4894_5218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017899885.1|5244_5640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568026.1|5808_6114_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|6115_6334_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_004193995.1|6886_7576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|7607_8297_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_032743927.1|8733_9003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020317495.1|8990_9566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802777.1|9596_10091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197807.1|10134_10503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|10536_10740_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197809.1|10753_10957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|11138_12143_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015065644.1|12221_15188_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|15262_15553_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|15549_15951_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|15940_16297_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|16551_16866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|17292_18474_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|19133_19739_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_020802676.1|19833_22731_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_020323165.1|23789_24791_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_046092601.1|24847_25315_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	37.6	1.7e-24
WP_032416518.1|25311_25623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020323170.1|26238_26601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323157.1|26593_27259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323154.1|27255_30474_-	conjugative relaxase	NA	A0A2R8FDQ9	Cedratvirus	30.5	2.4e-05
WP_020323171.1|30478_32011_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020323155.1|32010_32229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102765492.1|33208_33334_+	StbA	NA	NA	NA	NA	NA
WP_020323147.1|33342_34059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032416596.1|34061_34430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032416598.1|34640_34844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170167.1|34902_35085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323152.1|35158_35365_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_004152397.1|35781_37101_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|37350_38232_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|38618_39398_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|39394_40420_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|40526_43556_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
