The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	198839	264293	5477084	coat,protease,tRNA	Tupanvirus(20.0%)	59	NA	NA
WP_047727674.1|198839_201227_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.0	3.1e-05
WP_004931416.1|201241_202225_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_121626058.1|202486_202531_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931417.1|202648_203005_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004931418.1|203048_203246_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048233542.1|203344_203896_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_025159696.1|203899_205828_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_038877589.1|208501_209125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727675.1|209380_209569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038877591.1|209671_210358_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_047727676.1|210395_211529_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047727677.1|211680_212964_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_047727678.1|213221_214559_-	cytochrome c	NA	NA	NA	NA	NA
WP_025302609.1|214571_216353_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_038877597.1|216355_217081_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_025159924.1|217388_218054_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	44.4	2.9e-06
WP_038877599.1|218163_218463_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_154235551.1|218648_219539_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047727680.1|219535_220426_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.1	5.3e-11
WP_038877606.1|220425_221286_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_038877608.1|221285_222140_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004931452.1|222377_223247_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_038877612.1|223282_223843_-	membrane protein	NA	NA	NA	NA	NA
WP_047727681.1|224028_225309_+|protease	protease	protease	NA	NA	NA	NA
WP_047727682.1|225373_226039_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_047727683.1|226463_227012_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	1.1e-06
WP_110612175.1|227187_228585_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_038877622.1|228649_229459_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_047727685.1|229468_230572_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_038877627.1|230727_231447_+	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_047727686.1|231621_232632_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_154235507.1|232628_233765_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	5.7e-26
WP_047727687.1|233766_234630_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047727688.1|234632_235436_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038877637.1|235482_236274_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_047727689.1|236504_237899_+	MFS transporter	NA	NA	NA	NA	NA
WP_154235508.1|237979_239149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727691.1|239151_240351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638291.1|241224_242103_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_102779890.1|242180_242381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727692.1|242472_243564_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038877645.1|243566_244607_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_047727693.1|244603_245389_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	8.8e-10
WP_047727694.1|245376_246174_+	nicotianamine synthase	NA	NA	NA	NA	NA
WP_047727695.1|246166_247474_+	DUF2338 family protein	NA	NA	NA	NA	NA
WP_038877656.1|247470_248316_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038877658.1|248383_250432_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	2.6e-85
WP_033638287.1|250451_251162_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_038877659.1|251258_251756_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_047730736.1|252011_253259_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_038877827.1|253227_255858_+	PqiB family protein	NA	NA	NA	NA	NA
WP_047727696.1|255960_257397_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_038877665.1|257669_258206_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038877667.1|258479_259016_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_038877669.1|259018_259522_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038882152.1|259515_260058_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038877673.1|260079_260847_+	molecular chaperone	NA	NA	NA	NA	NA
WP_038877828.1|260998_263341_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_047727697.1|263360_264293_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	1276091	1281793	5477084	transposase	Clostridium_botulinum_C_phage(33.33%)	8	NA	NA
WP_038877428.1|1276091_1277159_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.7	1.1e-15
WP_047728549.1|1277160_1277589_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004940022.1|1277813_1278197_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.2	5.2e-24
WP_038877424.1|1278486_1279083_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047728551.1|1279089_1280280_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.2	1.9e-27
WP_038874510.1|1280353_1280791_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	1.8e-20
WP_038874510.1|1280976_1281414_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	1.8e-20
WP_004940030.1|1281583_1281793_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.7e-21
>prophage 3
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	3060237	3124375	5477084	integrase,transposase,tail,tRNA	uncultured_Caudovirales_phage(20.0%)	55	3109061:3109097	3126616:3126652
WP_038874320.1|3060237_3061248_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_047729738.1|3061405_3061624_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_038874319.1|3061924_3062908_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_025160134.1|3063075_3064500_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	77.0	6.2e-195
WP_047729739.1|3064517_3065597_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	2.2e-27
WP_047729740.1|3065641_3066409_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038874314.1|3066624_3067098_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_047729741.1|3067175_3068369_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004936779.1|3068495_3068912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038874311.1|3068916_3069270_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_038874310.1|3069421_3069979_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_047729742.1|3070009_3071062_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.8	1.4e-79
WP_038874306.1|3071291_3074120_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	7.4e-309
WP_004936793.1|3074397_3074928_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	85.8	1.1e-56
WP_038874510.1|3075013_3075451_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	1.8e-20
WP_047729743.1|3075614_3076364_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_038874302.1|3076511_3076772_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_047729744.1|3076968_3077412_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_038874300.1|3077408_3078077_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_038874298.1|3078124_3078532_+	VOC family protein	NA	NA	NA	NA	NA
WP_004936819.1|3078864_3080226_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.5	2.7e-163
WP_025304430.1|3080423_3082073_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_038874296.1|3082147_3083035_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_028127545.1|3083174_3083597_+	murein hydrolase regulator LrgA	NA	NA	NA	NA	NA
WP_047729745.1|3083589_3084279_+	LrgB family protein	NA	NA	NA	NA	NA
WP_047729746.1|3084890_3102743_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.5	7.1e-163
WP_071845341.1|3102796_3104002_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_047730831.1|3104110_3104806_-	CTP synthase	NA	A0A0R6PHX8	Moraxella_phage	27.1	7.5e-21
WP_071845343.1|3104895_3106101_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_047729749.1|3106242_3107163_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	52.3	2.4e-75
WP_038879755.1|3107460_3108366_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	38.4	8.8e-38
WP_016930249.1|3108613_3108955_+	hypothetical protein	NA	NA	NA	NA	NA
3109061:3109097	attL	TCAACACGTTAACTGACTAGTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_047729750.1|3109270_3110497_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	61.7	2.3e-150
WP_154235525.1|3110588_3111377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071845345.1|3111491_3111776_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_047729753.1|3111919_3112696_+	anti-repressor protein	NA	A0A0R6PHG7	Moraxella_phage	54.5	5.6e-25
WP_071845347.1|3112937_3113117_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	55.2	3.4e-10
WP_154235526.1|3113247_3113520_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	79.5	5.5e-36
WP_047729754.1|3113509_3113710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047729755.1|3113702_3113939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047729756.1|3113931_3114120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047729757.1|3114112_3114367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047729758.1|3114363_3114702_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	58.0	4.9e-26
WP_080346936.1|3114962_3116429_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.7	4.1e-125
WP_047729760.1|3117013_3118156_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.9	1.4e-08
WP_080346897.1|3118365_3119154_+	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_023279823.1|3119199_3120123_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_154235527.1|3120369_3120543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730834.1|3120657_3121113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235528.1|3121225_3121567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730835.1|3121659_3122346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047729762.1|3122367_3122862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235529.1|3122854_3123280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235530.1|3123338_3123842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047729763.1|3123844_3124375_+|tail	tail fiber assembly protein	tail	A0A0F7LBP0	Escherichia_phage	45.3	9.7e-37
3126616:3126652	attR	TCAACACGTTAACTGACTAGTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 4
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	3550028	3560577	5477084		Pseudomonas_phage(16.67%)	9	NA	NA
WP_047729939.1|3550028_3552581_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	44.9	6.2e-206
WP_146220580.1|3552594_3553056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235532.1|3553327_3553552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235533.1|3553561_3554002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047729942.1|3554058_3554922_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	65.3	8.0e-105
WP_047729943.1|3555561_3555801_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	50.0	1.2e-13
WP_047729944.1|3556514_3557477_+	abortive phage infection protein	NA	A3QSC6	Clostridium_virus	31.6	1.3e-23
WP_047729945.1|3557504_3557936_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	67.4	5.5e-46
WP_047729946.1|3558579_3560577_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.4	2.0e-21
>prophage 5
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	3757834	3786219	5477084	capsid,terminase,integrase,head,tail,holin,portal	Cronobacter_phage(76.67%)	31	3757713:3757760	3789420:3789467
3757713:3757760	attL	TATTTGGTGGAGCTGGGGGGATTTGAACCCCCGTCCGAAATTACTACA	NA	NA	NA	NA
WP_047730021.1|3757834_3758902_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	79.9	2.1e-163
WP_047730022.1|3758905_3759469_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	42.3	1.5e-32
WP_047730856.1|3759625_3759886_+	hypothetical protein	NA	F1BUS7	Erwinia_phage	46.0	5.9e-11
WP_047730023.1|3759918_3760428_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	51.3	2.2e-38
WP_047730024.1|3760437_3760641_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_047730025.1|3760643_3761063_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.9	1.3e-31
WP_047730027.1|3761593_3761833_+	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	61.1	5.6e-08
WP_053056881.1|3761936_3763985_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	66.8	2.7e-260
WP_060437276.1|3764263_3764590_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	77.5	4.4e-40
WP_047730029.1|3764586_3765639_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.9	3.0e-154
WP_047730030.1|3765635_3767408_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	81.1	1.5e-286
WP_047730031.1|3767567_3768365_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	53.5	1.4e-71
WP_047730032.1|3768420_3769443_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.1	2.5e-153
WP_047730033.1|3769446_3770148_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	1.3e-84
WP_047730034.1|3770244_3770697_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	79.3	9.7e-62
WP_047730035.1|3770693_3771197_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	45.5	2.3e-35
WP_047730036.1|3771193_3771904_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	66.5	1.6e-82
WP_047730037.1|3771900_3773025_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	66.0	1.0e-139
WP_047730038.1|3773021_3773477_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	64.2	9.2e-52
WP_047730039.1|3773486_3773789_+|holin	holin	holin	C7BGD7	Burkholderia_phage	52.1	7.5e-18
WP_047730040.1|3773775_3774117_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	77.2	2.1e-40
WP_047730041.1|3774116_3774461_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	56.8	1.2e-24
WP_047730043.1|3774608_3774878_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	58.5	5.5e-20
WP_047730045.1|3777596_3777944_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.7	5.2e-31
WP_047730046.1|3777921_3779106_+	phage protein	NA	F1BUK6	Cronobacter_phage	67.3	2.4e-152
WP_047730047.1|3779098_3779704_+	protein phage	NA	F1BUK5	Cronobacter_phage	69.3	2.4e-71
WP_080346904.1|3779709_3782889_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	65.9	4.1e-106
WP_047730048.1|3782891_3783320_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.3	1.3e-23
WP_047730049.1|3783309_3784032_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	39.8	2.9e-39
WP_047730050.1|3784006_3784567_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	58.8	1.3e-50
WP_047730051.1|3784563_3786219_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	54.1	4.7e-170
3789420:3789467	attR	TATTTGGTGGAGCTGGGGGGATTTGAACCCCCGTCCGAAATTACTACA	NA	NA	NA	NA
>prophage 6
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	4250521	4311454	5477084	integrase,transposase,tail,holin	Enterobacteria_phage(29.63%)	59	4285582:4285604	4311657:4311679
WP_023279823.1|4250521_4251445_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_038876356.1|4251711_4252842_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.3	5.7e-103
WP_047730203.1|4252991_4253408_+	glyoxalase	NA	NA	NA	NA	NA
WP_038876352.1|4253401_4253980_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025303631.1|4254087_4254555_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_025303630.1|4254682_4255012_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_047730204.1|4255438_4256116_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	45.7	6.0e-07
WP_047730873.1|4256325_4256688_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
WP_019453678.1|4257702_4258023_+|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	2.5e-40
WP_047730205.1|4258009_4258450_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	62.3	8.9e-44
WP_047730206.1|4258507_4258897_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.1	1.1e-24
WP_047730207.1|4258893_4259286_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	46.8	2.7e-20
WP_016926946.1|4259326_4259782_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	74.8	1.2e-56
WP_025160180.1|4259905_4260271_+|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	45.0	6.5e-24
WP_080280890.1|4260288_4260510_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	47.9	1.0e-11
WP_047730208.1|4260502_4262833_+|tail	phage tail length tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.9e-16
WP_004935824.1|4262832_4263171_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.1e-33
WP_047730874.1|4263184_4263934_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.9	4.5e-96
WP_047730209.1|4263943_4264648_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	74.5	1.5e-106
WP_019453668.1|4264685_4265036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730210.1|4265078_4265705_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.5	2.6e-49
WP_047730211.1|4265758_4268926_+	host specificity protein J	NA	F1C571	Cronobacter_phage	66.3	0.0e+00
WP_071845376.1|4269262_4269910_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	37.1	1.1e-39
WP_047730212.1|4270003_4271290_+|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	47.3	1.1e-46
WP_071845377.1|4271293_4272568_+	hypothetical protein	NA	Q7Y3Z0	Yersinia_phage	51.3	1.0e-23
WP_023279823.1|4272613_4273537_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_047730213.1|4274195_4274438_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	82.3	2.6e-29
WP_038876342.1|4275306_4275960_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038876340.1|4275960_4276449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730214.1|4276441_4277173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038876336.1|4277190_4277853_-	VUT family protein	NA	NA	NA	NA	NA
WP_047730215.1|4278192_4278792_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080346908.1|4278763_4280518_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_047730216.1|4280714_4281452_+	tetrathionate reductase subunit TtrB	NA	NA	NA	NA	NA
WP_047730217.1|4281448_4282474_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_047730218.1|4282466_4285538_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	27.1	3.8e-08
4285582:4285604	attL	AATTTGGTCGGCATGAGAGGATT	NA	NA	NA	NA
WP_071845378.1|4286418_4287327_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	31.2	3.6e-23
WP_047730878.1|4287533_4288385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730220.1|4288485_4288692_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071845379.1|4289024_4290230_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047730221.1|4290231_4291524_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023279823.1|4291569_4292493_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_047730222.1|4292607_4294239_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_047730223.1|4294239_4294644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730224.1|4294740_4295154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071845380.1|4295549_4296920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235557.1|4296995_4297298_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_047730225.1|4297400_4298069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730226.1|4298379_4299684_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_047730227.1|4299652_4300093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063863018.1|4300344_4300707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140440698.1|4300768_4301233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154235534.1|4301429_4301966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012134294.1|4303315_4303594_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_047730229.1|4303593_4304982_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.5	6.3e-51
WP_071845381.1|4304974_4306087_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_071845382.1|4306083_4306719_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_080346909.1|4306763_4310021_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_047730231.1|4310188_4311454_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.3	1.5e-104
4311657:4311679	attR	AATTTGGTCGGCATGAGAGGATT	NA	NA	NA	NA
>prophage 7
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	4616016	4656023	5477084	plate,transposase,head,tail,protease	Shigella_phage(55.26%)	54	NA	NA
WP_071845285.1|4616016_4617222_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_047730890.1|4617504_4617705_+	protein DsrB	NA	NA	NA	NA	NA
WP_033635078.1|4617923_4618553_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_023279823.1|4619134_4620058_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_080213379.1|4620411_4621053_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047730376.1|4621462_4622173_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.4	5.0e-105
WP_080346914.1|4622123_4622330_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047730377.1|4622743_4623283_-|tail	tail fiber assembly protein	tail	Q6K1H1	Salmonella_virus	44.6	1.8e-30
WP_154235537.1|4623279_4624929_-	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	53.4	1.2e-29
WP_080346942.1|4624943_4625477_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	58.2	1.0e-54
WP_047730379.1|4625473_4626553_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	60.7	2.6e-121
WP_047730380.1|4626553_4626991_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	71.0	5.5e-54
WP_047730381.1|4626987_4627578_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	65.3	5.7e-70
WP_047730382.1|4627574_4628702_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	66.1	1.1e-138
WP_047730383.1|4628688_4630158_-	hypothetical protein	NA	A0A0C4UR32	Shigella_phage	43.4	1.7e-94
WP_047730384.1|4630171_4632205_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	48.3	2.4e-123
WP_080346915.1|4632331_4632811_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	66.2	1.5e-36
WP_047730385.1|4632820_4633183_-	hypothetical protein	NA	A0A0C4UQZ1	Shigella_phage	61.2	1.7e-32
WP_047730386.1|4633192_4634701_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	67.2	3.1e-189
WP_047730387.1|4634697_4634922_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	62.8	3.6e-09
WP_047730388.1|4634893_4635433_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	62.4	9.5e-64
WP_047730389.1|4635432_4635855_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	57.9	9.1e-38
WP_152903781.1|4635851_4636253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730391.1|4636359_4636632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730392.1|4636689_4637646_-|head	head protein	head	C9DGP2	Escherichia_phage	64.3	8.5e-116
WP_047730393.1|4637645_4638755_-|protease	protease	protease	C9DGP0	Escherichia_phage	51.4	2.1e-86
WP_047730394.1|4638969_4639452_-	phage virion morphogenesis protein	NA	C9DGN8	Escherichia_phage	60.6	5.5e-47
WP_047730395.1|4639463_4640783_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	64.7	1.7e-159
WP_047730396.1|4640766_4642332_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	68.1	4.1e-200
WP_047730397.1|4642331_4643999_-	Mu-like prophage FluMu protein gp28	NA	A0A0C4UR29	Shigella_phage	80.4	4.3e-256
WP_047730398.1|4644001_4644580_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	82.3	3.5e-80
WP_047730399.1|4644589_4644877_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	84.2	4.7e-38
WP_047730400.1|4644873_4645179_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	47.2	3.0e-14
WP_047730401.1|4645171_4645390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730893.1|4645393_4645573_-	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	48.1	1.0e-06
WP_049193136.1|4645556_4645937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730402.1|4645917_4646424_-	lysozyme	NA	G0ZNC8	Cronobacter_phage	55.6	9.0e-48
WP_047730403.1|4646542_4646968_-	hypothetical protein	NA	A0A0C4UQZ9	Shigella_phage	57.8	1.6e-37
WP_047730404.1|4647050_4647473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730405.1|4647593_4648106_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	39.8	1.2e-28
WP_047730895.1|4648080_4648290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730406.1|4648283_4648637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053056862.1|4648708_4649416_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	33.0	4.2e-19
WP_047730407.1|4649412_4649844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152903779.1|4649840_4650335_-	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	37.0	2.4e-05
WP_047730408.1|4650324_4650591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730409.1|4650696_4651221_-	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	67.2	2.3e-62
WP_152903778.1|4651232_4651502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730410.1|4651494_4651761_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	54.8	5.8e-14
WP_047730411.1|4651844_4652066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730412.1|4652062_4653016_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	45.6	5.6e-67
WP_047730413.1|4653086_4655063_-	hypothetical protein	NA	A0A2I7S9A8	Vibrio_phage	50.2	4.7e-177
WP_071845387.1|4655059_4655302_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	55.1	8.1e-15
WP_055312678.1|4655534_4656023_+	hypothetical protein	NA	A0A2D1GNK9	Pseudomonas_phage	49.1	3.7e-06
>prophage 8
NZ_CP011642	Serratia marcescens strain CAV1492, complete genome	5477084	5172324	5210762	5477084	tRNA,terminase,integrase,head,tail,holin	Edwardsiella_phage(23.08%)	49	5168551:5168564	5184140:5184153
5168551:5168564	attL	GCGGTGACCGCCGA	NA	NA	NA	NA
WP_047730588.1|5172324_5173263_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	92.6	3.0e-137
WP_047730589.1|5173311_5174568_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	60.3	1.0e-148
WP_047730590.1|5174567_5174780_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	59.2	4.8e-19
WP_047730591.1|5174843_5175029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053056868.1|5175022_5176141_-	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	47.7	2.2e-62
WP_080346926.1|5176152_5179317_-	hypothetical protein	NA	H6WRX1	Salmonella_phage	39.5	2.2e-136
WP_047730592.1|5179835_5180141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080346928.1|5180515_5180953_-	HNH endonuclease	NA	A0A0S1RTH0	Acinetobacter_phage	42.0	8.6e-23
WP_047730922.1|5181227_5181611_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	61.8	8.9e-32
WP_047730593.1|5181714_5181960_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	59.2	6.7e-17
WP_047730594.1|5181970_5182432_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	44.0	1.1e-17
WP_047730595.1|5182447_5182699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730596.1|5182695_5182890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080346929.1|5183965_5184502_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	52.7	1.3e-41
5184140:5184153	attR	GCGGTGACCGCCGA	NA	NA	NA	NA
WP_047730599.1|5184539_5184791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191850.1|5184985_5185225_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	64.7	8.3e-20
WP_047730601.1|5185267_5185864_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	84.2	2.0e-94
WP_047730602.1|5185868_5186150_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	86.8	5.3e-42
WP_047730603.1|5186149_5186839_+	antitermination protein	NA	NA	NA	NA	NA
WP_047730604.1|5187008_5187731_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	68.1	3.3e-88
WP_047730605.1|5187798_5188134_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	45.2	9.8e-19
WP_047730606.1|5188137_5188776_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	61.1	6.2e-70
WP_047730607.1|5188772_5189159_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_047730608.1|5189312_5189561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053056871.1|5189604_5190687_+|terminase	terminase	terminase	A0A0U2RXW9	Escherichia_phage	49.5	1.4e-50
WP_089191841.1|5190616_5192029_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.9	1.4e-186
WP_047730610.1|5192028_5193573_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	2.0e-98
WP_038875869.1|5193613_5194297_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	5.4e-56
WP_047730611.1|5194300_5195626_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	41.2	3.6e-72
WP_047730612.1|5195627_5196110_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	51.2	3.4e-28
WP_047730613.1|5196109_5197138_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	3.5e-83
WP_047730614.1|5197141_5197486_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	39.6	2.2e-13
WP_038875751.1|5197489_5197960_+	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	37.0	4.8e-11
WP_038875748.1|5197960_5198440_+	hypothetical protein	NA	I6ZXX4	Escherichia_phage	30.5	2.9e-08
WP_047730615.1|5198436_5198802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730616.1|5198786_5199338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730617.1|5199318_5200803_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.0	3.0e-91
WP_038875737.1|5200802_5201240_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	38.1	2.3e-20
WP_047730618.1|5201239_5201644_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	43.8	1.6e-18
WP_047730620.1|5201852_5203862_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	64.6	1.1e-51
WP_047730621.1|5203858_5204665_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	37.4	1.6e-27
WP_047730622.1|5204664_5204967_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.5	1.3e-25
WP_038875720.1|5204963_5205809_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.2	2.5e-34
WP_047730623.1|5205810_5206488_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	39.8	5.6e-37
WP_038875867.1|5206496_5206853_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.0	9.1e-23
WP_047730624.1|5206849_5208082_+	bacteriophage protein	NA	A0A077KGW9	Edwardsiella_phage	50.2	7.6e-101
WP_047730625.1|5208098_5208686_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	37.7	5.0e-34
WP_053056872.1|5208687_5210199_+	hypothetical protein	NA	H9C0Y2	Aeromonas_phage	51.6	2.6e-26
WP_053056873.1|5210201_5210762_+|tail	tail assembly chaperone	tail	A0A0C4UQZ5	Shigella_phage	38.0	9.0e-25
>prophage 1
NZ_CP011641	Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence	199444	12711	66730	199444	transposase	Salmonella_phage(25.0%)	39	NA	NA
WP_077253535.1|12711_14058_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|14106_14502_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_000509966.1|14683_15289_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206881.1|15383_18281_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
WP_154235503.1|19299_19992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279823.1|20016_20940_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_143722351.1|23831_24952_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	5.1e-51
WP_000019441.1|28435_29416_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_000427623.1|30806_31811_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_047062044.1|31889_34862_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
WP_001162012.1|34864_35422_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000993245.1|35551_35764_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|35726_35846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|35829_36066_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|36062_36428_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|36445_38131_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|38169_38595_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|38622_38898_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|38913_39279_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|39350_39806_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200827.1|40112_40541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200826.1|40550_40835_-	hypothetical protein	NA	A0A1S6L2Z2	Erwinia_phage	43.2	1.5e-07
WP_004099067.1|42202_43060_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_014386216.1|43052_43130_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004099069.1|43345_43624_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_009310009.1|46224_46980_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_043519709.1|46976_50261_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	3.3e-66
WP_080346869.1|50330_52115_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_014386211.1|52137_52821_-	YecA family protein	NA	NA	NA	NA	NA
WP_014386210.1|52817_54044_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014386209.1|54033_55557_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	7.0e-88
WP_047727549.1|56992_59980_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.3	9.3e-294
WP_047368866.1|60136_60553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|61416_61746_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|61726_62008_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_001067858.1|62437_63142_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_024555186.1|63188_64328_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016246540.1|64556_65159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104457020.1|65502_66730_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
>prophage 2
NZ_CP011641	Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence	199444	123733	174984	199444	protease,transposase,integrase	Macacine_betaherpesvirus(22.22%)	48	122802:122816	152780:152794
122802:122816	attL	CCTACCTTCTCCAGC	NA	NA	NA	NA
WP_102780076.1|123733_125103_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.7	1.2e-78
WP_038992719.1|125291_125618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727561.1|125614_126343_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_038992715.1|126339_126771_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_040196882.1|126815_128816_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	1.8e-22
WP_004206771.1|128884_129133_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004206772.1|129181_129724_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	1.0e-49
WP_032426243.1|130388_130709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727563.1|130743_130998_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	6.8e-12
WP_004206777.1|131234_131660_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004206779.1|132180_132411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040220197.1|132644_134129_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_009309980.1|134534_134960_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|134959_136231_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_047368872.1|136309_136561_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_047368871.1|136614_136920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206785.1|138245_139217_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	1.0e-148
WP_000523812.1|139216_140383_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|141133_142144_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_022064517.1|142841_143582_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_047727564.1|143614_143890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047368869.1|144230_144479_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_047727565.1|146964_147774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533745.1|147791_148154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047727566.1|148634_149909_+	RelB antitoxin	NA	NA	NA	NA	NA
WP_047727567.1|149926_150199_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047727568.1|150195_150879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011091034.1|150923_151142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|151144_151354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047727569.1|151421_151655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010466239.1|152216_153086_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
152780:152794	attR	GCTGGAGAAGGTAGG	NA	NA	NA	NA
WP_003118429.1|153079_154090_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.8e-15
WP_010466252.1|154098_154926_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_047727570.1|154934_155798_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047727571.1|155794_156622_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_016156490.1|156930_159939_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.1	0.0e+00
WP_004098989.1|160098_160668_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.8	2.0e-40
WP_004098990.1|160675_162067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098991.1|162063_164130_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000019441.1|165857_166838_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_011977761.1|167620_167995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001198018.1|168106_169060_-	cation transporter	NA	NA	NA	NA	NA
WP_085950818.1|169287_170408_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_047727572.1|170529_171081_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047727573.1|171238_171712_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_047727574.1|171714_172938_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_047727575.1|172948_173905_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_044347237.1|173904_174984_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.7	8.1e-38
>prophage 3
NZ_CP011641	Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence	199444	178569	189827	199444	transposase	Caulobacter_phage(22.22%)	13	NA	NA
WP_047727577.1|178569_179154_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.9	9.1e-12
WP_044348241.1|179150_180308_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_044348239.1|180330_180786_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_047727578.1|180809_181850_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	47.1	5.5e-76
WP_044348234.1|181888_182467_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	1.5e-06
WP_044348232.1|182547_183123_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	3.3e-30
WP_047727579.1|183210_184452_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	26.7	5.3e-09
WP_044348228.1|184479_185130_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_098141133.1|185303_186451_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	7.8e-148
WP_047727581.1|186511_186853_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	8.5e-18
WP_000790483.1|186996_187428_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_047727582.1|187678_189154_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	28.2	1.1e-26
WP_047727583.1|189146_189827_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	1.6e-31
>prophage 1
NZ_CP011640	Serratia marcescens strain CAV1492 plasmid pCAV1492-73, complete sequence	73100	9635	43775	73100	transposase,integrase,protease	Salmonella_phage(27.27%)	41	39740:39754	46135:46149
WP_000427623.1|9635_10640_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032622532.1|10718_13685_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_003124096.1|13687_14248_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_000993245.1|14378_14591_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|14553_14673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|14656_14893_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|14889_15255_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|15272_16958_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|16996_17422_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|17449_17725_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|17740_18106_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|18177_18633_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023279823.1|20019_20943_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_032491180.1|21108_21969_+	class A extended-spectrum beta-lactamase SHV-30	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|21989_22751_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004206881.1|22858_25756_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
WP_000509966.1|25850_26456_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206885.1|27038_29126_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_047727540.1|29138_30089_-	DsbC family protein	NA	NA	NA	NA	NA
WP_004206887.1|30099_31362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187436.1|31406_31802_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004206889.1|31906_32290_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004206890.1|32369_33023_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004187429.1|33114_33372_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_147810693.1|33340_33706_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187425.1|33798_34233_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_004187413.1|35607_35817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|35819_36038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206893.1|36082_36766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206894.1|36766_37024_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206895.1|37041_38316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206896.1|38843_39200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|39177_39756_+	hypothetical protein	NA	NA	NA	NA	NA
39740:39754	attL	ACGAACAGGGGGAAT	NA	NA	NA	NA
WP_004206898.1|39757_40165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|40317_40863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206900.1|41003_41474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187394.1|41460_41709_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_004206901.1|41701_42289_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187390.1|42285_42771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316874.1|42812_43016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187383.1|43034_43775_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
46135:46149	attR	ATTCCCCCTGTTCGT	NA	NA	NA	NA
>prophage 1
NZ_CP011639	Serratia marcescens strain CAV1492 plasmid pKPC_CAV1492, complete sequence	69158	11102	43241	69158	integrase,transposase	Escherichia_phage(29.41%)	27	4910:4926	43518:43534
4910:4926	attL	TAGTTACAACATTCAAC	NA	NA	NA	NA
WP_109547143.1|11102_12279_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	67.2	5.8e-122
WP_000052512.1|12940_14416_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|14471_15356_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|15439_16144_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011191341.1|16450_17725_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_080346864.1|17823_18033_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	98.6	1.1e-33
WP_047727532.1|18057_19125_-	phosphoribosyltransferase	NA	A0A0R6PHM5	Moraxella_phage	35.7	1.4e-34
WP_047727533.1|19754_20180_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	38.1	3.6e-18
WP_080346865.1|20290_20569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025367743.1|21064_22444_-	hypothetical protein	NA	D2XQ07	Bacillus_virus	23.0	3.5e-09
WP_071845218.1|22616_22913_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_047727535.1|23530_24061_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	51.2	1.8e-38
WP_001067855.1|24107_24812_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|27567_28332_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152391.1|28434_30150_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|30259_33289_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|33395_34421_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|34417_35197_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|35583_36465_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|36714_38034_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152787.1|38726_38867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|38849_39350_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|39477_40317_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|40310_40658_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000470556.1|40762_41053_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001317507.1|41161_41635_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_000845048.1|42227_43241_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
43518:43534	attR	GTTGAATGTTGTAACTA	NA	NA	NA	NA
