The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	934815	985232	6257473	tRNA,transposase,protease	Organic_Lake_phycodnavirus(20.0%)	49	NA	NA
WP_014227023.1|934815_935781_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_032751514.1|936109_936850_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_014227021.1|936986_937868_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_032751512.1|937879_939331_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_004125848.1|939320_939563_-	YhdT family protein	NA	NA	NA	NA	NA
WP_004125846.1|939673_941023_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_004125844.1|941033_941507_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_014227019.1|941900_942500_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_014227018.1|942499_943501_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_032751507.1|943578_944553_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032751505.1|944772_946713_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|947018_948062_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004106252.1|948132_949119_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004125830.1|949118_949607_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_047722867.1|949614_950196_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_004125826.1|950198_951668_+	ribonuclease G	NA	NA	NA	NA	NA
WP_009651883.1|951747_955545_+	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_004854666.1|955633_957079_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_025108485.1|957137_957884_+	L-fucose operon activator	NA	NA	NA	NA	NA
WP_004854659.1|957880_958810_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|958941_959145_+	AaeX family protein	NA	NA	NA	NA	NA
WP_032751502.1|959152_960085_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_014227012.1|960090_962058_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_004854654.1|962197_962473_+	barstar family protein	NA	NA	NA	NA	NA
WP_004106229.1|962523_962790_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_004106226.1|962892_963156_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_004106225.1|963510_963981_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_032751499.1|964394_965333_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_032751944.1|965494_965932_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
WP_047722868.1|966098_966743_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227009.1|966714_967380_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839648.1|967590_968859_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	4.0e-60
WP_047722870.1|968891_969791_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_014227006.1|969790_970408_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_071846058.1|970754_971006_+	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_047722872.1|971021_972779_+	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_014839646.1|972794_974096_+	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_047722873.1|974309_975011_+	membrane protein associated with oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_009651894.1|975038_976100_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_014226999.1|976186_977554_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
WP_004854637.1|977726_978125_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_032751487.1|978315_979449_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004106200.1|979668_980097_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829815.1|980112_980505_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_148675737.1|980562_980847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014226997.1|980816_981455_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_014226996.1|981458_981947_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
WP_000019450.1|983051_984032_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_000019450.1|984251_985232_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	1238517	1279208	6257473	transposase,integrase	Erysipelothrix_phage(36.36%)	28	1258929:1258942	1280056:1280069
WP_171972742.1|1238517_1238742_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	55.2	2.7e-12
WP_052958991.1|1239116_1240673_-	hypothetical protein	NA	A0A2K5B2C2	Erysipelothrix_phage	30.9	5.2e-62
WP_013815099.1|1240864_1241833_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_077258068.1|1241874_1243284_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.0	1.1e-50
WP_047722917.1|1243280_1243967_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_047722918.1|1243959_1245066_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	24.8	1.2e-17
WP_047722919.1|1245075_1246971_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.3	1.2e-108
WP_047722920.1|1247010_1247709_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_047722921.1|1247705_1250999_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B253	Erysipelothrix_phage	42.6	6.8e-237
WP_028016388.1|1253780_1254749_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032425611.1|1256276_1257308_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_047722922.1|1257592_1260241_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
1258929:1258942	attL	GCATTAATACGCTG	NA	NA	NA	NA
WP_047722923.1|1260230_1262138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722924.1|1262134_1263523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047663486.1|1264552_1265095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047663485.1|1265091_1265364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047663484.1|1265407_1266466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722925.1|1266845_1268438_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.6e-175
WP_004189161.1|1268468_1268819_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004189163.1|1268815_1269256_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_047663483.1|1269794_1270988_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_047663482.1|1270980_1273371_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_047722926.1|1273370_1273592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047663481.1|1273595_1274354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047663480.1|1274971_1275859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044346295.1|1275933_1276713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040216727.1|1276947_1277109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044346284.1|1277939_1279208_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.6	9.4e-78
1280056:1280069	attR	CAGCGTATTAATGC	NA	NA	NA	NA
>prophage 3
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	1761209	1823615	6257473	transposase,integrase	Paramecium_bursaria_Chlorella_virus(12.5%)	58	1775371:1775386	1806337:1806352
WP_000019450.1|1761209_1762190_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_032425611.1|1762766_1763798_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_047724922.1|1763858_1764443_+	fimbrial protein	NA	NA	NA	NA	NA
WP_032750940.1|1764592_1765252_+	molecular chaperone	NA	NA	NA	NA	NA
WP_047723046.1|1765279_1767814_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032750938.1|1767832_1768927_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014226484.1|1769062_1769857_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	28.6	3.5e-06
WP_004853415.1|1769892_1770666_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_047723048.1|1770705_1771626_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025107304.1|1771771_1772548_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
WP_014839275.1|1772611_1773805_+	MFS transporter	NA	NA	NA	NA	NA
WP_047723049.1|1774210_1775605_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
1775371:1775386	attL	GAATGTGACGAAAGAG	NA	NA	NA	NA
WP_032751934.1|1775612_1776254_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	5.3e-13
WP_086074038.1|1776253_1776910_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_032750933.1|1777007_1777745_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_032750932.1|1777741_1777945_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_014839268.1|1777941_1778421_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_032750931.1|1778417_1780355_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_014226473.1|1780351_1780909_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_047723050.1|1780905_1781964_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_032751932.1|1781960_1782893_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_004853394.1|1782898_1783627_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_032750929.1|1783627_1785148_-	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.1e-32
WP_009652546.1|1785172_1785976_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009652534.1|1785985_1787062_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_032750928.1|1787074_1787923_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_014226466.1|1787933_1788884_-	agmatinase	NA	NA	NA	NA	NA
WP_004135102.1|1789000_1789912_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047723051.1|1790207_1790612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723052.1|1790608_1792468_+	cell envelope integrity/translocation protein TolA	NA	NA	NA	NA	NA
WP_032750925.1|1793517_1795092_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_032751930.1|1795193_1795673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723053.1|1796193_1796457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142988957.1|1796509_1797542_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032680458.1|1797685_1798612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187116901.1|1798608_1799811_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000019450.1|1799842_1800823_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_047724925.1|1801000_1802041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723055.1|1802169_1802772_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	29.4	1.3e-05
WP_047723056.1|1802921_1803539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723057.1|1803901_1805209_-	McrC family protein	NA	NA	NA	NA	NA
WP_047723058.1|1805205_1807119_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	41.7	4.6e-36
1806337:1806352	attR	GAATGTGACGAAAGAG	NA	NA	NA	NA
WP_047723059.1|1807696_1809376_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047723060.1|1809598_1811125_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_047723061.1|1811121_1811964_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_052959012.1|1811963_1812527_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_047723062.1|1812550_1813186_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_047723063.1|1813366_1814167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723064.1|1814445_1815078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723065.1|1815437_1816460_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_047723066.1|1816470_1817451_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_047723067.1|1817447_1817822_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_047723068.1|1817818_1818340_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_047723069.1|1818711_1819122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148675610.1|1819172_1819445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723070.1|1819898_1821968_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.3	3.5e-74
WP_047723071.1|1822003_1822219_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013815099.1|1822646_1823615_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
>prophage 4
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	1827618	1874517	6257473	tail,protease,holin,terminase,integrase,transposase,portal	Enterobacterial_phage(28.21%)	49	1824922:1824937	1860752:1860767
1824922:1824937	attL	AAGGATTTTGTTTTAT	NA	NA	NA	NA
WP_047723075.1|1827618_1828866_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.0	3.2e-139
WP_071846078.1|1829192_1829816_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_047723077.1|1829819_1830509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|1831502_1832507_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_047723078.1|1833249_1833816_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	72.6	7.6e-80
WP_047723079.1|1833817_1834015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723080.1|1834014_1834542_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.1	9.3e-64
WP_004123001.1|1835557_1835929_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	93.5	2.8e-59
WP_047723083.1|1836594_1836816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723084.1|1837019_1837646_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	45.1	2.2e-43
WP_047723085.1|1837746_1837956_+	cell division protein	NA	NA	NA	NA	NA
WP_047723086.1|1837983_1838541_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	77.1	6.6e-76
WP_052958994.1|1838715_1839435_+	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	50.9	2.4e-46
WP_047723087.1|1839436_1839616_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047723088.1|1839612_1840494_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	57.7	6.2e-36
WP_047723089.1|1840490_1840694_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	75.9	1.2e-14
WP_047723090.1|1840690_1841752_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.1	2.2e-104
WP_047723091.1|1841768_1842131_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	72.5	1.7e-45
WP_047723092.1|1842151_1842664_-	hypothetical protein	NA	U5P455	Shigella_phage	68.3	3.7e-33
WP_047723093.1|1842678_1843767_-	hypothetical protein	NA	U5P4L0	Shigella_phage	82.8	1.2e-158
WP_012542177.1|1844862_1845039_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PD93	Moraxella_phage	56.4	1.4e-08
WP_047723094.1|1845086_1845494_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	81.1	4.4e-53
WP_032706073.1|1845598_1845847_+|holin	class II holin family protein	holin	A0A127KNH9	Pseudomonas_phage	35.1	4.9e-07
WP_047723095.1|1845848_1846382_+	lysozyme	NA	G9L6J6	Escherichia_phage	82.8	6.3e-84
WP_047723096.1|1846378_1846891_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_047723097.1|1846971_1847304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723098.1|1847303_1847723_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	54.3	8.5e-36
WP_171972765.1|1847743_1847992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004111758.1|1847954_1848443_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	85.8	2.5e-71
WP_004111760.1|1848442_1850545_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	84.6	0.0e+00
WP_004111762.1|1850541_1850754_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	79.7	1.9e-23
WP_032448882.1|1850753_1852256_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	9.6e-247
WP_071846079.1|1852206_1854228_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	82.7	0.0e+00
WP_004122973.1|1854309_1854636_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.7	1.6e-34
WP_047723100.1|1854628_1854904_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	68.8	4.9e-24
WP_047724949.1|1854907_1855486_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	80.2	5.6e-78
WP_047723101.1|1855482_1855884_+|tail	Minor tail protein U	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
WP_047723102.1|1855892_1856636_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	84.2	1.4e-113
WP_020315038.1|1856646_1857075_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.7	1.7e-36
WP_071846080.1|1857095_1857410_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	77.9	1.2e-42
WP_047723103.1|1857393_1860540_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	71.8	0.0e+00
WP_047723104.1|1860546_1860894_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	62.6	1.2e-35
1860752:1860767	attR	ATAAAACAAAATCCTT	NA	NA	NA	NA
WP_047723105.1|1860890_1861646_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.9	4.3e-131
WP_047723106.1|1861647_1862358_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	92.4	6.9e-139
WP_052958996.1|1862370_1862805_+	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	72.0	2.5e-54
WP_004122963.1|1862862_1863471_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	75.7	4.1e-79
WP_047723108.1|1863535_1872835_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	41.7	0.0e+00
WP_047723109.1|1872873_1874016_+|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	33.3	9.8e-18
WP_004122957.1|1874133_1874517_+	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	90.6	5.2e-64
>prophage 5
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	1993182	2008013	6257473	integrase	Morganella_phage(40.0%)	20	1992945:1992965	2011070:2011090
1992945:1992965	attL	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
WP_047723114.1|1993182_1994451_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.8	2.1e-146
WP_047723115.1|1994458_1995412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723116.1|1995538_1995757_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_047723117.1|1995756_1996188_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.9	2.4e-25
WP_047723118.1|1996201_1997011_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	54.5	3.5e-30
WP_004866306.1|1997042_1997615_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	59.0	8.0e-53
WP_004866303.1|1997614_1997794_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047723119.1|1997790_1998753_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	54.4	2.4e-17
WP_047723120.1|1998749_1999253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723121.1|1999249_1999459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723122.1|1999455_2000082_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.3	1.4e-26
WP_047723123.1|2000091_2000442_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	2.4e-39
WP_047723124.1|2000434_2003197_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.9	1.4e-291
WP_047723125.1|2003314_2003533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040216506.1|2003535_2003982_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_047723126.1|2003962_2004268_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_100117515.1|2004337_2004661_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.0	8.0e-18
WP_004866267.1|2004797_2004968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004848460.1|2004967_2005294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723127.1|2005301_2008013_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	31.6	3.2e-51
2011070:2011090	attR	CACATCAAGAAAAGCAAATAA	NA	NA	NA	NA
>prophage 6
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	2383349	2391744	6257473	tRNA	Planktothrix_phage(33.33%)	8	NA	NA
WP_032719918.1|2383349_2384213_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	3.0e-11
WP_014230105.1|2384223_2384997_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_032719859.1|2385413_2386214_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014230103.1|2386200_2386671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723272.1|2386671_2387565_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	3.9e-14
WP_025107782.1|2387809_2389171_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.0	1.6e-200
WP_014230101.1|2389489_2390212_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_016946933.1|2390208_2391744_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
>prophage 7
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	2449877	2458448	6257473		Enterobacteria_phage(28.57%)	8	NA	NA
WP_004122486.1|2449877_2451284_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	5.6e-39
WP_047723320.1|2451496_2452561_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.4e-103
WP_004122480.1|2452574_2453444_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	3.7e-110
WP_014230058.1|2453475_2454366_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
WP_047723323.1|2454381_2454936_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	1.2e-50
WP_032693859.1|2455109_2456276_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
WP_004138729.1|2456849_2456972_-	small membrane protein	NA	NA	NA	NA	NA
WP_047723325.1|2457443_2458448_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.8e-31
>prophage 8
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	2533890	2637668	6257473	tail,head,holin,terminase,integrase,transposase	uncultured_Caudovirales_phage(23.4%)	102	2601581:2601640	2637923:2638046
WP_000019450.1|2533890_2534871_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_047723401.1|2535791_2536133_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047724994.1|2536423_2540026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046878091.1|2540722_2541640_+	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_014229985.1|2541746_2542697_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_047723403.1|2542775_2543717_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_057174013.1|2543838_2544447_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_047723407.1|2544623_2545550_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047723408.1|2545587_2546586_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_047723410.1|2546686_2547601_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	30.2	1.5e-08
WP_047723412.1|2548547_2550005_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_047723414.1|2550968_2552423_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_014229908.1|2552555_2552813_-	histidine kinase	NA	NA	NA	NA	NA
WP_171972763.1|2552988_2554524_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014229906.1|2554515_2555448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025106074.1|2555674_2556250_+	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_160741211.1|2556284_2557208_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_047723418.1|2557246_2560309_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.3	1.5e-25
WP_047723420.1|2560308_2561394_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047723422.1|2561927_2562359_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.4	3.8e-23
WP_047723424.1|2562409_2565097_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	2.4e-70
WP_047723425.1|2565285_2566215_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_047723427.1|2566288_2566696_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_047724997.1|2566823_2567726_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047723431.1|2567785_2568706_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047723433.1|2568846_2569242_+	RidA family protein	NA	NA	NA	NA	NA
WP_047723434.1|2569284_2570244_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_162557678.1|2570620_2571421_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_013815099.1|2572152_2573121_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_000654805.1|2573748_2574717_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_047723436.1|2575628_2576621_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.5	1.3e-50
WP_000019450.1|2576774_2577755_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_047723438.1|2577793_2578207_-	GtrA family protein	NA	NA	NA	NA	NA
WP_032749742.1|2578852_2580046_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.7	1.5e-141
WP_025106098.1|2580173_2581244_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	4.0e-90
WP_004852229.1|2581872_2582154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723439.1|2582196_2582892_+	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	5.2e-06
WP_047723440.1|2582948_2584382_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	4.6e-97
WP_047723441.1|2584362_2584857_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
WP_047723443.1|2584831_2585743_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004852222.1|2585926_2586838_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_025106102.1|2586913_2587093_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_014838854.1|2587200_2588868_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
WP_014229881.1|2589197_2589413_-	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_004136599.1|2589545_2589734_+	protein DsrB	NA	NA	NA	NA	NA
WP_025106103.1|2589775_2590399_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_161505342.1|2590855_2591272_+	lipoprotein	NA	NA	NA	NA	NA
WP_047723448.1|2591321_2592809_-	alpha-amylase	NA	NA	NA	NA	NA
WP_014229877.1|2593010_2593811_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025106106.1|2593906_2594893_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_004103458.1|2594908_2595577_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_004852203.1|2595573_2596326_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
WP_014229875.1|2596627_2597350_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_004122104.1|2597417_2597642_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_004122102.1|2598105_2598762_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_047723450.1|2598758_2600591_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004122100.1|2600648_2601197_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2601581:2601640	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGG	NA	NA	NA	NA
WP_047723452.1|2601766_2602783_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.5	1.6e-125
WP_032409868.1|2602766_2603012_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	41.4	2.8e-07
WP_015365915.1|2603221_2603407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723454.1|2603408_2603975_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	62.5	7.9e-53
WP_047723456.1|2603971_2606125_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.0	1.3e-95
WP_029602739.1|2606169_2606403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723458.1|2607013_2607469_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	55.0	4.1e-36
WP_000364674.1|2607577_2607811_+	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_015365920.1|2607873_2608320_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_029602737.1|2608403_2608562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723461.1|2608564_2608936_+	HNH endonuclease	NA	K4PAA9	Pseudomonas_phage	40.0	3.5e-17
WP_047723465.1|2609962_2611351_+	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	46.6	2.6e-105
WP_047723466.1|2611389_2612058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723467.1|2612061_2612295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723469.1|2612458_2613049_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	85.7	6.7e-95
WP_009308338.1|2613051_2613282_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
WP_047723471.1|2613278_2613896_+	HNH endonuclease	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.3	8.8e-05
WP_071846091.1|2613908_2614247_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	84.7	3.5e-48
WP_041165550.1|2614429_2614621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723476.1|2614689_2615286_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	70.7	2.3e-79
WP_171972762.1|2615296_2615773_+	HNH endonuclease	NA	H2EI88	Brucella_phage	41.6	4.1e-18
WP_077258078.1|2615690_2616068_+	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	47.4	6.5e-19
WP_171972761.1|2616055_2616220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365933.1|2616223_2616520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723486.1|2616547_2617000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723487.1|2617010_2617232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723488.1|2617235_2618861_+|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.5	1.2e-173
WP_032409894.1|2618857_2619091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723489.1|2619077_2619926_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.9	8.2e-46
WP_047723491.1|2619959_2620427_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	58.6	4.5e-46
WP_047723493.1|2620462_2620756_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	69.1	2.2e-30
WP_047723494.1|2620970_2621882_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.6	1.4e-43
WP_047723496.1|2621941_2622505_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.9	1.8e-49
WP_047723497.1|2622506_2624501_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	47.9	1.7e-182
WP_047723499.1|2624503_2624953_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	1.5e-22
WP_047723501.1|2624955_2625444_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	42.0	6.7e-08
WP_047723503.1|2625449_2628164_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	60.2	3.1e-288
WP_047723505.1|2628163_2631055_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	71.5	0.0e+00
WP_047723506.1|2631058_2631493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723508.1|2631632_2631974_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	52.7	4.8e-21
WP_047723509.1|2631970_2633581_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.1	1.1e-224
WP_171972773.1|2633946_2636271_+	hypothetical protein	NA	A0A2K9VAJ3	Klebsiella_virus	33.2	4.6e-46
WP_047723513.1|2636567_2636792_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	70.1	1.2e-20
WP_047723514.1|2636775_2637312_+	lysozyme	NA	H6WRZ4	Salmonella_phage	77.3	7.2e-80
WP_047723516.1|2637308_2637668_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	42.2	1.9e-15
2637923:2638046	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGGATAAAGCAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 9
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	2985446	3030070	6257473	plate,transposase,integrase	Escherichia_phage(33.33%)	38	3008973:3008989	3036234:3036250
WP_014838714.1|2985446_2986787_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032749821.1|2986783_2987473_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032749819.1|2987469_2989182_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014839086.1|2989186_2989678_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_032749817.1|2989966_2990332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723681.1|2990328_2992680_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	9.7e-20
WP_032749811.1|2992694_2994983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749810.1|2994986_2995679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_185962836.1|2995965_2996253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749809.1|2996413_2996611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723683.1|2996852_2997599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749807.1|2997630_2998839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723685.1|2998835_3002303_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_071846096.1|3002805_3003084_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_047723689.1|3003183_3004938_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_047723691.1|3004901_3005987_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_047723692.1|3005964_3006510_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004851647.1|3007010_3008099_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025105882.1|3008170_3009940_+	iron ABC transporter permease	NA	NA	NA	NA	NA
3008973:3008989	attL	CGCTGGTGATGCTCCAG	NA	NA	NA	NA
WP_047723695.1|3009932_3011003_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	4.7e-30
WP_047723697.1|3011059_3011830_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_047723698.1|3011853_3013533_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_004851637.1|3013543_3014323_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_014229640.1|3014429_3015302_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
WP_004136705.1|3015330_3015543_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_032749742.1|3015725_3016919_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.7	1.5e-141
WP_047723700.1|3017669_3018857_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_047723702.1|3018849_3020268_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004851627.1|3020390_3020531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025105876.1|3020846_3021755_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_025105875.1|3021870_3022542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014838689.1|3022946_3023498_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_025105874.1|3023535_3024063_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_047723703.1|3024108_3025110_-	fimbrial protein	NA	NA	NA	NA	NA
WP_047723704.1|3025125_3027696_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025105871.1|3027756_3028446_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032749776.1|3028546_3029065_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032749775.1|3029521_3030070_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
3036234:3036250	attR	CTGGAGCATCACCAGCG	NA	NA	NA	NA
>prophage 10
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	3362091	3393231	6257473	tail,protease,holin,integrase,tRNA,transposase	Enterobacteria_phage(30.77%)	27	3365334:3365351	3390173:3390190
WP_032425611.1|3362091_3363123_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_008324213.1|3363282_3364143_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_008324215.1|3364150_3364669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|3365243_3366224_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
3365334:3365351	attL	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_008325196.1|3368101_3369109_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_170912124.1|3370379_3371471_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032749353.1|3371463_3372207_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.2	8.6e-15
WP_025107979.1|3372823_3373444_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004850311.1|3373786_3374770_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032749350.1|3375253_3376627_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_004850317.1|3376671_3377607_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	5.4e-139
WP_032749348.1|3377810_3378083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025107976.1|3378420_3379359_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014229121.1|3379757_3380048_-	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_004101601.1|3380236_3380671_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_004850325.1|3380753_3380966_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_009652979.1|3381119_3382226_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
WP_032750138.1|3382583_3386111_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_046877232.1|3386591_3387293_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	40.0	2.5e-32
WP_014229124.1|3387756_3388119_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
WP_009653048.1|3388195_3388588_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_032749344.1|3388577_3388850_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_004850338.1|3388857_3389400_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.7	5.2e-70
WP_004850340.1|3389455_3389875_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
WP_000019450.1|3390082_3391063_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
3390173:3390190	attR	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_000019450.1|3391282_3392263_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_047723803.1|3392478_3393231_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	75.9	1.7e-114
>prophage 11
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	3781570	3866777	6257473	capsid,tail,head,holin,terminase,integrase,plate,transposase,portal	Salmonella_phage(19.05%)	99	3820351:3820367	3874762:3874778
WP_032425611.1|3781570_3782602_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_008324210.1|3782702_3783884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023063206.1|3783880_3786109_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_004850301.1|3786281_3786704_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
WP_014229113.1|3786991_3787186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004850297.1|3787342_3787534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723940.1|3787711_3788026_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014229112.1|3788080_3788644_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_032720811.1|3788840_3789422_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014838304.1|3789547_3790177_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071532263.1|3790538_3790727_-	cold-shock protein	NA	NA	NA	NA	NA
WP_032749356.1|3791442_3792423_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_004850284.1|3792581_3793466_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838299.1|3793579_3794464_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229103.1|3794635_3795772_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162934453.1|3795915_3797103_+	MFS transporter	NA	NA	NA	NA	NA
WP_071846167.1|3797200_3797545_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_032693666.1|3797645_3798371_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
WP_047723942.1|3798612_3799047_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_038424404.1|3799043_3799763_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032749366.1|3799759_3801019_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047723943.1|3801020_3801743_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_047723944.1|3801739_3802963_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032749369.1|3802959_3803493_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_014229093.1|3803507_3804467_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_032749371.1|3804530_3805913_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_187116904.1|3806794_3806971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013815099.1|3806996_3807965_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_000019450.1|3810914_3811895_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_071846113.1|3812042_3814415_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.6	4.0e-21
WP_047723945.1|3814411_3817054_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.6	2.2e-97
WP_014229074.1|3817300_3817792_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_032749392.1|3817936_3819625_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014229072.1|3819621_3820287_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_047723946.1|3820283_3821627_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
3820351:3820367	attL	CAACTGCCTTCCAGCAG	NA	NA	NA	NA
WP_025108179.1|3821640_3823176_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014229069.1|3823216_3823708_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_047723947.1|3824406_3824613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705237.1|3824746_3824995_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_047723949.1|3825901_3826450_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	92.3	9.6e-88
WP_148675741.1|3826570_3827032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171972736.1|3827063_3827240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723951.1|3827247_3829677_-	hypothetical protein	NA	A0A2K9VAJ3	Klebsiella_virus	33.0	3.8e-43
WP_047723952.1|3829700_3830279_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	51.6	1.2e-48
WP_047723953.1|3830278_3831034_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	52.8	1.0e-26
WP_047723954.1|3831101_3831767_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_047723955.1|3831763_3832912_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	24.9	6.8e-19
WP_047723956.1|3832901_3833351_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	45.1	1.6e-19
WP_117254196.1|3833347_3833887_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	41.7	2.5e-11
WP_047723958.1|3833922_3835002_-|tail	tail protein	tail	Q8SBG7	Shigella_phage	31.9	1.8e-37
WP_047723959.1|3834998_3836399_-	DNA circularization protein	NA	NA	NA	NA	NA
WP_142988938.1|3836467_3836857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723961.1|3836929_3838699_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	48.5	1.2e-27
WP_047723962.1|3838843_3839122_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_047723963.1|3839125_3839494_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_047723964.1|3839497_3841015_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	43.8	1.4e-104
WP_047723965.1|3841015_3841195_-	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	57.1	7.8e-07
WP_047723966.1|3841197_3841743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723967.1|3841739_3842099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042944986.1|3842104_3842473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723968.1|3842474_3843524_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	2.1e-51
WP_047723969.1|3843621_3844026_-|head	head decoration protein	head	NA	NA	NA	NA
WP_047723970.1|3844025_3844604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723971.1|3844605_3845475_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.7	5.5e-53
WP_047723972.1|3845471_3847109_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.8	5.2e-89
WP_025713573.1|3847108_3847369_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_052959003.1|3847377_3849501_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	34.2	7.5e-96
WP_047723973.1|3849442_3850006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723974.1|3850326_3850599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723975.1|3850724_3851363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723976.1|3851414_3851699_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	62.2	3.0e-24
WP_047723977.1|3851924_3852314_-	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	50.0	2.2e-22
WP_047723978.1|3852463_3853018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723979.1|3853077_3853575_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.4	2.8e-78
WP_047723980.1|3853552_3853822_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	81.5	2.1e-35
WP_025714746.1|3854183_3854966_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	88.8	1.8e-132
WP_031592532.1|3854962_3855331_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.1e-38
WP_047723981.1|3855317_3856697_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	65.4	9.6e-161
WP_047723982.1|3856693_3857572_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.9	1.9e-85
WP_047723983.1|3857583_3858513_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	74.1	1.0e-113
WP_047723984.1|3858606_3858900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164880234.1|3858896_3859349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077258083.1|3859350_3859587_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	55.7	9.7e-13
WP_047723986.1|3859710_3860412_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.0	1.1e-56
WP_047723987.1|3860592_3860784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723988.1|3860780_3860969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723989.1|3860965_3861193_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	53.4	9.0e-08
WP_071846116.1|3861143_3861383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723990.1|3861445_3861709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723991.1|3861851_3862046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723992.1|3862002_3862383_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	50.9	1.3e-22
WP_020803898.1|3862431_3862596_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	74.1	7.2e-15
WP_020805575.1|3862567_3862789_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	91.3	1.5e-28
WP_047723993.1|3862785_3863226_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	87.4	5.7e-67
WP_047723996.1|3863269_3863788_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	81.4	4.1e-80
WP_171972734.1|3863793_3864510_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	94.9	4.6e-122
WP_047719113.1|3865066_3865288_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	84.9	1.1e-26
WP_004198241.1|3865423_3865615_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
WP_047719115.1|3865595_3866777_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	83.5	1.8e-200
3874762:3874778	attR	CAACTGCCTTCCAGCAG	NA	NA	NA	NA
>prophage 12
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	4022656	4088239	6257473	capsid,tail,head,terminase,integrase,tRNA,plate,transposase,portal	Enterobacteria_phage(59.38%)	73	4024811:4024828	4078509:4078526
WP_032749533.1|4022656_4023157_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004138309.1|4023320_4023767_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_162934470.1|4023750_4024545_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025106946.1|4024642_4025827_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
4024811:4024828	attL	CTGCCGCTGCTGGCCTTT	NA	NA	NA	NA
WP_032749536.1|4025864_4026557_-	CTP synthase	NA	NA	NA	NA	NA
WP_032749537.1|4026719_4027229_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014228940.1|4027215_4027560_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_025106943.1|4027554_4027794_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004213128.1|4028056_4028308_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_047724046.1|4028351_4029491_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.7	2.7e-145
WP_047724047.1|4029645_4030818_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	9.3e-157
WP_047724048.1|4030817_4031333_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	62.4	1.3e-57
WP_047724049.1|4031378_4031696_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	46.8	2.2e-12
WP_053086776.1|4031716_4031854_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_047724050.1|4031840_4034816_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.5	6.8e-220
WP_000019450.1|4035388_4036369_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_047724052.1|4039393_4040317_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	42.9	1.9e-51
WP_024359484.1|4040318_4040669_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	55.7	2.7e-27
WP_032437020.1|4040665_4041253_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	9.1e-60
WP_047724053.1|4041249_4041885_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	1.3e-56
WP_047724054.1|4041881_4042349_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	3.5e-46
WP_128316295.1|4042349_4042541_-	peptidase	NA	NA	NA	NA	NA
WP_049070297.1|4042530_4042860_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_047724055.1|4042871_4043417_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	2.8e-31
WP_047724056.1|4043413_4043698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724057.1|4043688_4043889_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	61.5	7.9e-16
WP_047724058.1|4043888_4044404_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	4.8e-41
WP_047725084.1|4044516_4045374_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.0	3.4e-71
WP_047724059.1|4045423_4046458_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.1	1.5e-94
WP_047724060.1|4046467_4047307_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	67.0	1.3e-96
WP_047724061.1|4047463_4049191_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.7	1.9e-227
WP_047724062.1|4049184_4050246_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.7	1.2e-142
WP_047724063.1|4050855_4052466_+	AAA family ATPase	NA	Q2P9X8	Enterobacteria_phage	22.3	7.9e-13
WP_047724064.1|4052467_4053574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258085.1|4053689_4054289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425611.1|4054229_4055261_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_047724066.1|4055679_4056096_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000019450.1|4056141_4057122_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_047724067.1|4057179_4057473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|4057513_4058494_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_171972748.1|4058475_4058913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047724068.1|4059026_4059545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724069.1|4059547_4062097_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	59.2	2.0e-249
WP_047724070.1|4062113_4063070_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	53.8	1.5e-83
WP_004213098.1|4063865_4064090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724071.1|4064158_4064431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032432798.1|4064446_4064824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131515.1|4064839_4065058_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
WP_023339925.1|4065078_4065357_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	87.8	2.4e-42
WP_048024533.1|4065478_4065778_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
WP_047724072.1|4065893_4066877_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.4	6.4e-151
WP_047724073.1|4067139_4068153_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_004101234.1|4068210_4068312_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_142988940.1|4068311_4068386_+	protein YoaJ	NA	NA	NA	NA	NA
WP_086074258.1|4068526_4068652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004131510.1|4068700_4068964_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_025106941.1|4069093_4069732_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004138325.1|4069822_4070737_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
WP_047724074.1|4071280_4072069_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014838169.1|4072328_4072850_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_047724075.1|4072846_4073794_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_047724076.1|4073892_4076229_+	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_047724077.1|4076287_4077190_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228931.1|4077186_4078185_+	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
WP_047724078.1|4078181_4079135_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
4078509:4078526	attR	CTGCCGCTGCTGGCCTTT	NA	NA	NA	NA
WP_047724079.1|4079135_4079903_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.7	8.9e-15
WP_047724080.1|4079939_4080983_-	type II asparaginase	NA	NA	NA	NA	NA
WP_047724081.1|4081262_4082453_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_025106933.1|4082530_4084315_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	7.3e-20
WP_004131480.1|4084459_4085710_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_047724082.1|4085946_4086597_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_025106932.1|4086617_4087094_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032749565.1|4087132_4088239_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	4339802	4451933	6257473	capsid,protease,holin,terminase,tRNA,plate,transposase	Enterobacteria_phage(14.06%)	112	NA	NA
WP_004100829.1|4339802_4340462_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
WP_004849563.1|4340550_4340880_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004849561.1|4340876_4341158_-	acylphosphatase	NA	NA	NA	NA	NA
WP_047725097.1|4341207_4341996_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014228676.1|4342012_4342567_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_009651924.1|4342758_4343961_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_009651933.1|4344021_4344339_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_032749730.1|4344797_4345499_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047724145.1|4345512_4346451_-	peptidase	NA	NA	NA	NA	NA
WP_047724146.1|4346493_4349637_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004849542.1|4349834_4351040_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046877472.1|4351036_4353184_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
WP_025106164.1|4353180_4354617_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_047724147.1|4354784_4366208_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_032749742.1|4366892_4368086_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.7	1.5e-141
WP_014228669.1|4368130_4368544_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_014228668.1|4368698_4369157_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_032695058.1|4369185_4371240_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
WP_004849527.1|4371362_4371809_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_032749744.1|4371826_4373962_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_046878167.1|4373949_4374573_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_032749745.1|4375035_4375545_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_004849520.1|4375898_4376969_+	porin OmpA	NA	NA	NA	NA	NA
WP_014228663.1|4377071_4377524_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_032749746.1|4377709_4379467_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_004849514.1|4379536_4380055_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_004100764.1|4380119_4380287_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_004849513.1|4380542_4381106_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_004849511.1|4381105_4382743_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_014228659.1|4382732_4384001_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_004849507.1|4384015_4385923_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
WP_014228658.1|4385935_4388041_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_047724148.1|4388139_4389249_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_004849504.1|4389245_4389788_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_004130996.1|4389956_4390967_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_009653287.1|4391215_4391791_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_004849501.1|4391847_4392639_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_014837971.1|4392635_4393409_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
WP_014228655.1|4393474_4396090_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_047724149.1|4396348_4396657_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	44.9	4.5e-18
WP_047724150.1|4396822_4397080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171972745.1|4397109_4397286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187116899.1|4397293_4399831_-	hypothetical protein	NA	A0A2K9VAJ3	Klebsiella_virus	33.0	3.9e-43
WP_047724152.1|4399839_4400883_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	38.2	3.8e-16
WP_047724153.1|4400884_4401472_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	5.0e-34
WP_032693643.1|4401464_4402697_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	51.0	3.0e-105
WP_001518114.1|4402704_4403061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032749742.1|4403118_4404312_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.7	1.5e-141
WP_171972755.1|4404449_4405388_-	hypothetical protein	NA	A0A0P0ZBT0	Stx2-converting_phage	71.8	6.7e-81
WP_165795128.1|4405494_4405671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052959005.1|4405767_4406409_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	30.2	3.8e-11
WP_000019450.1|4406872_4407853_+|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_187116900.1|4407891_4408344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724156.1|4408343_4408931_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	24.8	1.7e-05
WP_047724157.1|4408920_4409790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724158.1|4409786_4410092_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	4.7e-20
WP_047724159.1|4410093_4410933_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.9	4.5e-28
WP_047724160.1|4410936_4412853_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	38.1	3.9e-43
WP_001518122.1|4413054_4413531_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_019724823.1|4413582_4413837_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	74.6	2.3e-20
WP_047724161.1|4413839_4414595_-	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.4	4.7e-61
WP_047724162.1|4414775_4415219_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	33.1	1.9e-17
WP_047724163.1|4415218_4416700_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.2	8.7e-59
WP_047724164.1|4416703_4417255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032453636.1|4417236_4417605_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	9.5e-07
WP_014342915.1|4417601_4418165_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.4	2.4e-17
WP_047724165.1|4418167_4418611_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	41.2	6.7e-15
WP_047724166.1|4418610_4418937_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	3.6e-10
WP_047724167.1|4418938_4419976_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	3.2e-84
WP_001518133.1|4419975_4420458_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	50.3	4.5e-33
WP_077258087.1|4420459_4422316_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	4.6e-57
WP_047724168.1|4422378_4423068_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	50.9	2.8e-60
WP_047724169.1|4423120_4424641_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.3	6.1e-100
WP_001518137.1|4424641_4426318_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	5.1e-249
WP_009308024.1|4426319_4426805_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	77.6	1.3e-64
WP_009652631.1|4427912_4428089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724170.1|4428102_4428552_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	69.8	8.5e-58
WP_047724171.1|4428535_4428880_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	63.6	1.5e-33
WP_047725108.1|4429708_4430398_-	antiterminator	NA	I6PDF8	Cronobacter_phage	57.1	4.9e-65
WP_047724172.1|4430533_4430764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724173.1|4430760_4430985_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	62.2	2.6e-23
WP_047724174.1|4430981_4431626_-	recombination protein NinG	NA	S4TSR3	Salmonella_phage	64.5	4.3e-55
WP_071846128.1|4431618_4431789_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	67.3	3.7e-14
WP_047724175.1|4431781_4432231_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.7	6.3e-37
WP_047724176.1|4432482_4432797_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	35.0	2.6e-05
WP_047724177.1|4433575_4433767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047725114.1|4433766_4434324_-	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	65.0	1.2e-58
WP_009308001.1|4434325_4434910_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	46.0	2.0e-30
WP_047725119.1|4434906_4435365_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	33.5	1.4e-07
WP_187116903.1|4435655_4437071_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.3	2.2e-184
WP_047724179.1|4437075_4437975_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	54.8	4.9e-81
WP_004194002.1|4437967_4438114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047684216.1|4438200_4438422_-	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_047684213.1|4438462_4438696_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	52.7	1.3e-17
WP_047684208.1|4438823_4439513_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	1.5e-61
WP_047724180.1|4439759_4440389_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	52.4	7.7e-57
WP_162487899.1|4440508_4440634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|4440626_4440821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071846130.1|4441409_4441805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162934436.1|4441798_4441942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047724182.1|4441935_4442595_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	32.9	1.0e-19
WP_047724183.1|4442596_4443265_+	AAA family ATPase	NA	G9L667	Escherichia_phage	44.7	6.3e-49
WP_047724184.1|4443276_4443981_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	40.2	3.0e-25
WP_032748397.1|4443992_4444169_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	50.0	7.7e-07
WP_047724185.1|4444165_4444822_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	2.5e-114
WP_047724186.1|4444818_4445226_+	DUF2591 family protein	NA	A0A1J0GUX1	Halomonas_phage	39.0	4.0e-06
WP_047724187.1|4445443_4445683_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	50.0	8.3e-12
WP_015584784.1|4445696_4445945_+	excisionase family protein	NA	S4TND0	Salmonella_phage	64.6	9.5e-27
WP_047724188.1|4445987_4447277_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	65.0	1.2e-168
WP_025107499.1|4447534_4448737_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
WP_004849497.1|4449040_4450441_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
WP_000654805.1|4450964_4451933_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
>prophage 14
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	4506846	4519265	6257473	tRNA,transposase,protease	Bacillus_phage(22.22%)	11	NA	NA
WP_047724202.1|4506846_4507815_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	6.1e-61
WP_014228628.1|4507929_4509696_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	7.0e-23
WP_025108297.1|4509696_4511418_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.4	2.8e-16
WP_025108296.1|4511456_4512161_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|4512440_4512659_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032751944.1|4512830_4513268_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
WP_004100627.1|4513449_4513680_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_004100628.1|4514004_4514322_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_004849425.1|4514352_4516635_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.8e-165
WP_032751944.1|4516797_4517235_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	31.2	1.2e-13
WP_025108294.1|4517318_4519265_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
>prophage 15
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	5038308	5048816	6257473	tRNA,integrase	Morganella_phage(28.57%)	11	5036681:5036694	5046503:5046516
5036681:5036694	attL	CTTGAGCGTTACAA	NA	NA	NA	NA
WP_047724287.1|5038308_5041065_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.5	2.6e-290
WP_047724288.1|5041064_5041283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724289.1|5041275_5042007_-	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	56.7	2.8e-18
WP_047724290.1|5042003_5042183_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047724291.1|5042182_5042785_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	55.0	4.9e-53
WP_071846174.1|5042881_5043082_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.4	8.8e-07
WP_052959008.1|5043354_5044113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724292.1|5044257_5045472_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.4	1.2e-125
WP_004099791.1|5046055_5046922_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
5046503:5046516	attR	CTTGAGCGTTACAA	NA	NA	NA	NA
WP_025107125.1|5046923_5047136_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004848430.1|5047430_5048816_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
>prophage 16
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	5854682	5913754	6257473	tRNA,transposase,holin	Stx2-converting_phage(20.0%)	52	NA	NA
WP_047724631.1|5854682_5858069_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_016807794.1|5858125_5859073_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_016807793.1|5859085_5859514_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_047724633.1|5859510_5860131_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_047724635.1|5860143_5860830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014227744.1|5860849_5861263_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004108688.1|5861280_5861610_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004098218.1|5861851_5861947_+	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_004128455.1|5862071_5863460_+	tryptophanase	NA	NA	NA	NA	NA
WP_047724638.1|5863598_5864855_+	tryptophan permease	NA	NA	NA	NA	NA
WP_047724640.1|5865061_5866069_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_047724642.1|5866221_5867619_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
WP_000019450.1|5867894_5868875_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_004098195.1|5869352_5870420_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047724643.1|5870416_5873146_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	2.3e-20
WP_032719924.1|5873145_5874270_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014227738.1|5874309_5874627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724644.1|5881025_5882150_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014837294.1|5882218_5883094_-	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_038422856.1|5883589_5884369_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_047724645.1|5884453_5885797_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_042944202.1|5885838_5887203_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
WP_047724646.1|5887768_5889418_+	signal transduction protein	NA	NA	NA	NA	NA
WP_014227730.1|5889562_5891014_+	MFS transporter	NA	NA	NA	NA	NA
WP_047724648.1|5891066_5892170_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_025107484.1|5892193_5893021_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_047724651.1|5893014_5893926_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_047724652.1|5893912_5894344_+	heme-binding protein	NA	NA	NA	NA	NA
WP_004117622.1|5894480_5895494_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047724656.1|5895704_5896736_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_077258094.1|5897210_5897915_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_032747696.1|5898203_5898527_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_004098173.1|5898673_5899108_+	VOC family protein	NA	NA	NA	NA	NA
WP_016947617.1|5899330_5900311_-|transposase	IS5-like element ISKpn26 family transposase	transposase	NA	NA	NA	NA
WP_047724661.1|5900473_5901217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047724663.1|5901393_5902191_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047724666.1|5902334_5903180_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_047724668.1|5903266_5903656_-	toxin CbtA	NA	NA	NA	NA	NA
WP_171972752.1|5903712_5904039_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_047724679.1|5904096_5904318_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_047724681.1|5904331_5904811_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_047724684.1|5904822_5905266_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	5.7e-14
WP_047725179.1|5905345_5905594_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_047724685.1|5905599_5906424_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	35.8	3.9e-40
WP_047724687.1|5906667_5907489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724689.1|5908126_5908759_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_047724690.1|5908892_5909117_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071846147.1|5909573_5909972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142988925.1|5910027_5911256_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.0e-146
WP_004189163.1|5911343_5911784_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|5911780_5912131_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_047722925.1|5912161_5913754_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.6e-175
>prophage 17
NZ_CP011636	Klebsiella oxytoca strain CAV1374 chromosome, complete genome	6257473	5918738	5926651	6257473	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_047724695.1|5918738_5918927_+	hypothetical protein	NA	A0A140XAG6	Dickeya_phage	65.1	1.0e-09
WP_047724697.1|5918923_5920480_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.1	4.0e-163
WP_047724698.1|5920499_5920847_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	3.5e-43
WP_047724700.1|5920843_5921485_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	35.7	4.5e-12
WP_047724702.1|5921552_5924654_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
WP_047724704.1|5924685_5925822_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_071846149.1|5925955_5926651_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	1.7e-28
>prophage 1
NZ_CP011633	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence	150318	55256	102091	150318	transposase,integrase	Salmonella_phage(23.53%)	42	51037:51051	95238:95252
51037:51051	attL	CCTGCTCGCTGAAGG	NA	NA	NA	NA
WP_047722638.1|55256_56546_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	53.0	5.9e-120
WP_071846025.1|56642_57017_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.4e-26
WP_032740676.1|57886_58852_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	88.8	1.2e-154
WP_047722641.1|58851_60018_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	1.2e-223
WP_042936824.1|60727_61738_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.0	1.1e-86
WP_001515717.1|62562_63303_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_022064516.1|64446_65394_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	5.1e-12
WP_052958981.1|65420_66167_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023292103.1|67669_67927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425611.1|69865_70897_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_174805835.1|71757_72189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272716.1|73116_73365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805590.1|73361_73934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805591.1|73964_74459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197807.1|74502_74871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|74904_75108_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197809.1|75121_75325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|75506_76511_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_176392666.1|76589_76826_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	46.2	1.5e-21
WP_016236504.1|77812_78370_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.1	2.6e-48
WP_000993245.1|78499_78712_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|78777_79014_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|79010_79376_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|79393_81079_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|81117_81543_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|81570_81846_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|81861_82227_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|82298_82754_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_045270086.1|82802_83378_+	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_024196075.1|83385_84309_-	acyltransferase	NA	NA	NA	NA	NA
WP_045270087.1|84501_87558_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	2.5e-52
WP_016241530.1|87557_88643_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016241528.1|89167_89599_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.1	2.0e-24
WP_016241527.1|89649_92337_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.5	1.2e-71
WP_000509966.1|92726_93332_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|93426_96324_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
95238:95252	attR	CCTGCTCGCTGAAGG	NA	NA	NA	NA
WP_071846027.1|96339_97251_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_000948259.1|97598_98240_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000449980.1|98239_99178_-	MCE family protein	NA	NA	NA	NA	NA
WP_001325019.1|99179_99971_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_001325018.1|99976_101122_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001067855.1|101386_102091_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	0	6939	227680		uncultured_virus(50.0%)	4	NA	NA
WP_000843494.1|453_651_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001514621.1|691_3139_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	3.8e-83
WP_009654300.1|3265_3706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042946271.1|3792_6939_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	1.0e-61
>prophage 2
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	10312	13636	227680		Bacillus_phage(66.67%)	4	NA	NA
WP_000697968.1|10312_10993_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_007374412.1|10985_12461_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_009309902.1|12706_13138_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004187110.1|13285_13636_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
>prophage 3
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	20237	106755	227680	integrase,transposase	Salmonella_phage(17.24%)	96	14132:14147	80184:80200
14132:14147	attL	TTCAGTGCATTTTTTG	NA	NA	NA	NA
WP_040118529.1|20237_21020_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.2	4.9e-53
14132:14147	attL	TTCAGTGCATTTTTTG	NA	NA	NA	NA
WP_040118530.1|21064_21760_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	31.6	8.6e-25
WP_040118542.1|22551_23481_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	4.2e-75
WP_040118531.1|23581_23845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722685.1|23864_24485_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.3	2.1e-06
24415:24430	attR	TTCAGTGCATTTTTTG	NA	NA	NA	NA
WP_077250517.1|24646_24805_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
24415:24430	attR	TTCAGTGCATTTTTTG	NA	NA	NA	NA
WP_040118446.1|24783_26538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071846033.1|26725_26977_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_040118447.1|27499_28366_+	ParA family protein	NA	NA	NA	NA	NA
WP_040118448.1|28365_29397_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_004902343.1|29396_29834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118449.1|29830_30154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118450.1|30203_31583_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_040118451.1|31632_32907_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.1e-155
WP_040118452.1|32906_33332_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
WP_040118453.1|33539_33770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118454.1|34205_34907_+	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	33.8	3.4e-21
WP_020314641.1|34906_35128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118455.1|35173_35584_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_040118456.1|35631_36399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722686.1|36642_37341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052958982.1|37330_37642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722688.1|37861_38833_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040118457.1|39412_39841_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	3.4e-08
WP_040118458.1|39887_40394_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	5.3e-08
WP_000761848.1|40434_40626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118459.1|40826_41090_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	55.3	3.4e-14
WP_047722689.1|41113_41434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804459.1|42287_42845_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.2	5.2e-49
WP_047722691.1|42893_43142_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_040118463.1|43210_45211_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.8	2.1e-23
WP_086556807.1|45251_45686_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_071846034.1|45682_46411_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_040118465.1|46407_46731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118466.1|47567_47906_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	1.2e-27
WP_040118467.1|47965_48313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118468.1|48401_48632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118469.1|48678_49512_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	35.3	9.6e-23
WP_162933663.1|49797_49968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118470.1|50160_50703_+	antirestriction protein	NA	NA	NA	NA	NA
WP_065806261.1|50725_51208_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_047722692.1|51652_52057_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001166628.1|52063_52519_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|52590_52956_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|52971_53247_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|53274_53700_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|53738_55424_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|55441_55807_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|55803_56040_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|56105_56318_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|56448_57009_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_032622532.1|57011_59978_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_000427614.1|60056_61061_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_015062794.1|62471_63476_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|63554_66527_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|66529_67087_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|67392_68406_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_013263788.1|68552_69011_+	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_001007673.1|69153_69981_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_001206317.1|70017_70809_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|70972_71320_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|71313_72153_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|72280_72781_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|72749_73742_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000179844.1|73744_75424_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|75498_76167_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|76202_76439_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|76435_76798_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_047722550.1|76815_78513_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	7.4e-38
WP_000522996.1|78551_78977_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|79004_79280_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|79295_79661_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|79732_80188_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_032489431.1|80861_80939_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000078032.1|81170_81413_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_160887331.1|81544_82045_-	DUF1669 domain-containing protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	9.5e-18
WP_040118502.1|82199_82508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|82876_83737_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|83919_84477_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|84640_87646_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_032736843.1|89899_90427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425611.1|91202_92234_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_047722693.1|94435_95806_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_142988944.1|95792_96407_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_047722694.1|96342_96579_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_042946285.1|96589_97342_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_032736851.1|97362_97689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032736852.1|97735_97921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032736854.1|97917_98154_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_047722696.1|98143_98755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047722697.1|98868_100812_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_032736857.1|100808_101435_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_032736858.1|101447_102440_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_042946288.1|102450_103077_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_032736860.1|103073_103463_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_013815099.1|105786_106755_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
>prophage 4
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	116228	174831	227680	tail,integrase,transposase	Escherichia_phage(16.67%)	62	159861:159877	176502:176518
WP_004118961.1|116228_116510_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_004118963.1|116490_116820_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	3.1e-09
WP_004118966.1|117223_117952_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004118968.1|117948_118380_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_047722701.1|118423_120481_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.2	2.4e-22
WP_009654057.1|120548_120782_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_009654061.1|120830_121379_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.8	3.9e-49
WP_047722703.1|122212_122776_-	methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.7	4.8e-18
WP_032700844.1|122824_124207_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_032700845.1|124257_124488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074172513.1|125280_125526_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	49.4	1.3e-12
WP_032700847.1|125711_125903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032700848.1|125980_126409_-	antirestriction protein	NA	NA	NA	NA	NA
WP_032700849.1|126578_127364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032700850.1|127417_127837_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_032700851.1|127848_128070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032700852.1|128069_128750_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	35.5	2.4e-27
WP_032700853.1|129724_129955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032700854.1|130018_130690_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_032425559.1|130692_131664_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
WP_001568036.1|131895_132327_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_032700856.1|132326_133598_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	4.4e-152
WP_021312406.1|133679_134654_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	6.5e-87
WP_011977818.1|134653_135859_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_001568031.1|136582_137338_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
WP_162180131.1|138077_138191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032700766.1|138319_138577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722707.1|138633_139422_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	4.2e-52
WP_032700767.1|139418_139748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032700768.1|139976_140585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032700769.1|140647_141001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118819.1|141694_143227_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_047722708.1|143393_143660_-	colicin-D	NA	NA	NA	NA	NA
WP_077258057.1|143656_145807_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_047722709.1|145887_147021_-|tail	tail fiber domain-containing protein	tail	A0A1Z1LZI1	Serratia_phage	27.0	1.8e-19
WP_001166628.1|148381_148837_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|148908_149274_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|149289_149565_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|149592_150018_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|150056_151742_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|151759_152125_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|152121_152358_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|152423_152636_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|152766_153327_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_032622532.1|153329_156296_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_000427614.1|156374_157379_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_015062794.1|158789_159794_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
159861:159877	attL	AAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138073.1|159872_162845_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|162847_163405_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|163710_164724_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_013263788.1|164870_165329_+	aminoglycoside N-acetyltransferase AAC(6')-Il	NA	NA	NA	NA	NA
WP_001007673.1|165471_166299_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_001206317.1|166335_167127_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|167290_167638_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|167631_168471_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|168598_169099_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|169067_170060_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000179844.1|170062_171742_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|171816_172485_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|172520_172757_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|172753_173116_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_047722550.1|173133_174831_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	7.4e-38
176502:176518	attR	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
>prophage 5
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	177862	194617	227680	transposase	Enterobacteria_phage(37.5%)	12	NA	NA
WP_160887331.1|177862_178363_-	DUF1669 domain-containing protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	9.5e-18
WP_040118502.1|178517_178826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|179194_180055_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|180237_180795_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|180958_183964_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_047722710.1|184166_184487_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047722711.1|184476_185742_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_023307208.1|186257_189155_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|189249_189855_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_013815099.1|191257_192226_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_142988970.1|193415_193652_-	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
WP_004099053.1|193648_194617_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 6
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	200136	204341	227680		Dickeya_phage(50.0%)	2	NA	NA
WP_004197672.1|200136_202584_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	70.5	9.4e-26
WP_004197675.1|202697_204341_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
>prophage 7
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	208441	212171	227680	transposase	Enterobacteria_phage(100.0%)	2	NA	NA
WP_047722713.1|208441_208999_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.9	1.3e-39
WP_047722714.1|209159_212171_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	63.3	0.0e+00
>prophage 8
NZ_CP011634	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence	227680	220190	222268	227680		Bacillus_phage(100.0%)	2	NA	NA
WP_002436614.1|220190_221591_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_001188930.1|221587_222268_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 1
NZ_CP011630	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence	49200	26766	37735	49200	integrase	Escherichia_phage(37.5%)	11	31559:31573	40801:40815
WP_023332912.1|26766_27468_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	9.3e-27
WP_001568040.1|27904_28135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015345000.1|28197_28869_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568038.1|28871_29843_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_161952885.1|30091_31579_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
31559:31573	attL	CTTCTCCTCTCCGTA	NA	NA	NA	NA
WP_001568036.1|31985_32417_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_047722488.1|32416_33688_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.4e-152
WP_004197644.1|34099_34975_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
WP_004197649.1|35607_36234_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_006788217.1|36353_36533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|36940_37735_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
40801:40815	attR	TACGGAGAGGAGAAG	NA	NA	NA	NA
>prophage 1
NZ_CP011631	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-54, complete sequence	53596	0	53353	53596	portal,head,tail,capsid,terminase,transposase	Klebsiella_phage(83.33%)	51	NA	NA
WP_020317538.1|72_390_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_040120190.1|370_766_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.2	1.7e-17
WP_032408953.1|824_2111_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	85.0	2.4e-206
WP_014907815.1|2188_3109_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023339403.1|3145_4405_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.5	2.5e-224
WP_047722515.1|4577_6287_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	94.9	0.0e+00
WP_032408957.1|6321_6756_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_023339406.1|7257_7689_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	2.9e-39
WP_023339407.1|7685_7970_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	2.4e-05
WP_032414214.1|7966_8329_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.8e-62
WP_023339408.1|8312_9389_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	37.4	9.8e-36
WP_032408961.1|9558_9858_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_162897782.1|9866_10085_-	hypothetical protein	NA	Q6UAS5	Klebsiella_phage	97.0	2.9e-11
WP_032408962.1|10111_10588_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	2.3e-61
WP_032413535.1|10604_11096_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	1.4e-82
WP_023339388.1|11092_11404_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
WP_032413536.1|11462_12524_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
WP_032408967.1|12841_13069_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_023339391.1|13080_13302_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_023339392.1|13472_13781_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339393.1|13780_14068_+	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339395.1|14419_14647_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_032408968.1|14667_14994_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
WP_023339397.1|14986_15232_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_052958978.1|15228_15705_-	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	60.3	1.9e-15
WP_047722516.1|15832_16441_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.0	8.7e-98
WP_032414210.1|16852_17590_-	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	83.3	1.2e-117
WP_032408972.1|17579_17789_-	Cro/Cl family transcriptional regulator	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032414212.1|17869_18478_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.1	4.8e-104
WP_047722519.1|18728_22733_+	hypothetical protein	NA	A0A2I6TD01	Escherichia_phage	81.1	0.0e+00
WP_047722521.1|22725_23022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722522.1|23018_23369_+	hypothetical protein	NA	O64343	Escherichia_phage	77.6	8.6e-50
WP_155884413.1|23411_23579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722525.1|24137_24368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722527.1|24364_25144_+	Bro-N domain-containing protein	NA	O64341	Escherichia_phage	79.8	3.7e-117
WP_032408985.1|25198_27121_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	94.8	0.0e+00
WP_023339381.1|27828_28992_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_047722529.1|28994_29996_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	87.2	8.0e-157
WP_016947617.1|30096_31077_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_047722530.1|31238_32738_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	73.8	1.7e-147
WP_047722532.1|32799_44712_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.6	0.0e+00
WP_032447254.1|44774_45368_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
WP_052958979.1|45384_46212_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	1.3e-08
WP_039814703.1|46258_46969_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
WP_020803197.1|46970_47726_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
WP_017898999.1|47722_48061_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_047722543.1|48060_51417_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.1	0.0e+00
WP_014228914.1|51649_52015_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|52072_52534_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|52565_52967_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_017880258.1|52963_53353_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
>prophage 1
NZ_CP011632	Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-84, complete sequence	83652	34744	68955	83652	protease,integrase,transposase	Enterobacteria_phage(25.0%)	32	35865:35880	69681:69696
WP_001143760.1|34744_37750_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
35865:35880	attL	ATATTGCAGGCTTCAG	NA	NA	NA	NA
WP_001235713.1|37913_38471_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|38653_39514_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000845048.1|40824_41838_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|41986_42520_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_004206941.1|42599_43388_+	APH(3') family aminoglycoside O-phosphotransferase AphA16	NA	E4ZFP6	Streptococcus_phage	47.2	1.4e-60
WP_032420064.1|43511_44357_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001007673.1|44386_45214_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_000679427.1|45349_45697_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|45690_46530_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|46657_47158_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|47126_48119_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000179844.1|48121_49801_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|49875_50544_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|50579_50816_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|50812_51175_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_047722550.1|51192_52890_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	7.4e-38
WP_000522996.1|52928_53354_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|53381_53657_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|53672_54038_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|54109_54565_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000654805.1|55951_56920_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_032491180.1|57040_57901_+	class A extended-spectrum beta-lactamase SHV-30	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|57921_58683_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004206881.1|58790_61688_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
WP_000509966.1|61782_62388_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206885.1|62970_65058_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_004206886.1|65070_66021_-	DsbC family protein	NA	NA	NA	NA	NA
WP_004206887.1|66031_67294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187436.1|67338_67734_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004206889.1|67838_68222_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004206890.1|68301_68955_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
69681:69696	attR	CTGAAGCCTGCAATAT	NA	NA	NA	NA
>prophage 1
NZ_CP011635	Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence	332956	167566	205511	332956	integrase,transposase,tRNA	Enterobacteria_phage(28.57%)	28	156653:156667	169869:169883
156653:156667	attL	AGGCCTGCGCCGCAT	NA	NA	NA	NA
WP_014603550.1|167566_168766_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_022652191.1|169079_169292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063153.1|169468_170110_+	hypothetical protein	NA	NA	NA	NA	NA
169869:169883	attR	ATGCGGCGCAGGCCT	NA	NA	NA	NA
WP_023307208.1|171132_174030_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|174124_174730_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_022652193.1|175671_176064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652194.1|176473_176704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063155.1|176856_178062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063157.1|179080_179488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652195.1|179520_179724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652197.1|180950_181205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610398.1|181289_181601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|182471_183548_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012561110.1|184135_184972_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012561111.1|185036_185435_-	VOC family protein	NA	NA	NA	NA	NA
WP_017384070.1|185478_186588_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
WP_017384071.1|186622_186898_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_023280857.1|188109_189093_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023280966.1|189155_189812_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384073.1|190235_190532_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139156019.1|191390_191543_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_001254932.1|191916_193068_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_101743360.1|194119_195100_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_040113343.1|196399_197329_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_000027057.1|197942_198803_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|198985_199543_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004152391.1|200656_202372_-	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152392.1|202481_205511_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
