The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	320063	331472	5262013	tRNA	Enterobacteria_phage(75.0%)	11	NA	NA
WP_002898206.1|320063_321464_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
WP_047718124.1|322959_325293_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_014837515.1|325304_325625_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_044525237.1|325621_325849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255391.1|325845_326403_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	4.0e-33
WP_039102774.1|326399_326666_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	4.4e-30
WP_044525236.1|327216_327954_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.8	9.9e-72
WP_044525235.1|327950_328196_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	3.8e-20
WP_044525234.1|328213_328780_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	3.3e-59
WP_047718125.1|329440_329752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|329984_331472_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 2
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	387470	396944	5262013	tRNA,protease	Bacillus_phage(16.67%)	8	NA	NA
WP_016532437.1|387470_389192_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
WP_002898014.1|389236_389938_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|390291_390510_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|390640_392920_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|392950_393268_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|393593_393815_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004147781.1|393891_395832_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_040088746.1|395828_396944_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 3
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	852945	910213	5262013	tRNA,coat,terminase,protease,holin,head	Cronobacter_phage(20.37%)	78	NA	NA
WP_053003096.1|852945_854067_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	45.9	1.3e-67
WP_077257693.1|854079_856116_-	CotH kinase family protein	NA	A0A286S1P0	Klebsiella_phage	55.4	6.0e-18
WP_047718148.1|856204_858682_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	3.6e-198
WP_047718150.1|858668_859064_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_032419293.1|859060_859531_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_047718152.1|859530_860007_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_047718153.1|860633_864074_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	45.4	8.9e-147
WP_047718155.1|864168_864672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023297299.1|864771_865152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718157.1|865268_865799_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	67.2	3.9e-62
WP_047718159.1|865979_866657_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.0	5.3e-72
WP_004151263.1|866709_867462_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_040229586.1|867530_867923_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	3.9e-35
WP_004151265.1|867919_868345_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_047718161.1|868347_868710_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	4.3e-20
WP_016528892.1|868709_868883_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	5.4e-13
WP_047718163.1|868882_869263_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_029884066.1|869265_869505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040027496.1|869537_870593_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_016529582.1|870589_871051_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_047718166.1|871050_872406_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	3.0e-130
WP_053003098.1|872458_872803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718168.1|872803_873814_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.2	4.0e-116
WP_047718169.1|873740_875210_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.3	2.0e-148
WP_047718171.1|875222_876695_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	5.9e-249
WP_047718173.1|876694_877210_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	75.3	9.7e-66
WP_023301669.1|877237_877447_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_032443192.1|877494_877731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880211.1|878686_878962_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|878958_879303_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004184488.1|879299_879839_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_031280382.1|879835_880135_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_047718176.1|880874_881564_-	antiterminator	NA	I6PDF8	Cronobacter_phage	57.1	4.2e-64
WP_023301665.1|881560_881701_-	YlcG family protein	NA	NA	NA	NA	NA
WP_047718179.1|881697_882060_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	9.5e-52
WP_004146340.1|882056_882347_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.8e-45
WP_004223230.1|882555_883152_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_047718181.1|883308_883614_-	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	2.3e-14
WP_187145478.1|883606_884074_-	DUF551 domain-containing protein	NA	A0A192Y6F5	Salmonella_phage	70.4	6.4e-24
WP_165821554.1|884835_885012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718183.1|885011_885701_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	36.9	8.2e-20
WP_023328761.1|885697_885904_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	100.0	1.6e-32
WP_047718185.1|885900_886383_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	82.2	2.5e-71
WP_047719141.1|886379_886973_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.0	1.8e-07
WP_004218528.1|887209_887512_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004178817.1|887511_888288_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
WP_040227123.1|888284_889013_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_001548453.1|889146_889368_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004194000.1|889407_889635_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_032429930.1|889703_890426_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_032442364.1|890805_891090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048980368.1|891334_891631_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	45.2	9.9e-15
WP_099728887.1|891943_892132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|892124_892331_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_032426276.1|892412_892697_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	2.5e-39
WP_047718188.1|892712_893558_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_004223153.1|893554_894235_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	2.3e-123
WP_023283323.1|894231_894390_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_047718190.1|894386_894914_+	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	61.6	2.4e-56
WP_047718192.1|894910_895132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718193.1|895128_895665_+	hypothetical protein	NA	J9Q748	Salmonella_phage	73.1	4.2e-72
WP_025269983.1|895661_895853_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_047718195.1|895849_896068_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	58.0	8.1e-14
WP_004151317.1|896069_896405_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|897875_898742_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|898743_898956_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_040088581.1|899001_900387_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|900562_901057_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004893764.1|901060_901783_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032423671.1|901890_902229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040088579.1|902325_902835_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|902831_903899_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151323.1|904010_905087_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004142997.1|905194_906340_-	porin	NA	NA	NA	NA	NA
WP_004219504.1|906431_906545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032411673.1|906521_908936_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004146399.1|908932_909619_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
WP_004196998.1|909589_910213_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 4
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	1589595	1598108	5262013		Enterobacteria_phage(85.71%)	10	NA	NA
WP_047718124.1|1589595_1591929_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_014837515.1|1591940_1592261_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_044525237.1|1592257_1592485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255391.1|1592481_1593039_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	4.0e-33
WP_039102774.1|1593035_1593302_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	4.4e-30
WP_044525236.1|1593852_1594590_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.8	9.9e-72
WP_044525235.1|1594586_1594832_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	3.8e-20
WP_044525234.1|1594849_1595416_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	3.3e-59
WP_047718125.1|1596076_1596388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|1596620_1598108_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 5
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	1847592	1889302	5262013	tRNA,transposase	Salmonella_phage(25.0%)	34	NA	NA
WP_001101446.1|1847592_1848618_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001101446.1|1850198_1851224_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004206282.1|1851842_1852253_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002884725.1|1852446_1853337_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_023291623.1|1853351_1854896_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_047718363.1|1855013_1856204_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_047718364.1|1856574_1857684_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
WP_060613120.1|1857767_1859057_+	maltoporin	NA	NA	NA	NA	NA
WP_004151749.1|1859171_1860095_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002884807.1|1860282_1860780_+	chorismate lyase	NA	NA	NA	NA	NA
WP_002884808.1|1860792_1861659_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_047718365.1|1861707_1864131_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_004206290.1|1864259_1864628_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_004206291.1|1864750_1865359_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	39.8	4.6e-14
WP_047718367.1|1865428_1866745_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_023291626.1|1866982_1867192_+	CsbD family protein	NA	NA	NA	NA	NA
WP_023291627.1|1867287_1867803_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_023291628.1|1868051_1868540_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_072199093.1|1868640_1869639_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004206297.1|1869779_1870022_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_023291630.1|1870203_1871187_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_002884942.1|1871356_1872772_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_047718370.1|1872803_1873883_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.4e-26
WP_047718372.1|1874060_1875254_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_004151745.1|1875445_1876159_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004206303.1|1876290_1876707_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_023291634.1|1876710_1877067_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_023291635.1|1877067_1879893_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|1880147_1880672_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_001101446.1|1881284_1882310_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072269292.1|1882604_1883573_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
WP_001101446.1|1883890_1884916_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047718375.1|1886068_1888102_-	alpha-amylase	NA	NA	NA	NA	NA
WP_077257696.1|1888333_1889302_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
>prophage 6
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	2863584	2912992	5262013	tRNA,terminase,capsid,tail,lysis,integrase,portal,plate,holin,transposase,head	Escherichia_phage(33.33%)	54	2871741:2871757	2873465:2873481
WP_000019450.1|2863584_2864565_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_047718524.1|2864673_2865243_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_004144810.1|2865483_2866146_+	YfdX family protein	NA	NA	NA	NA	NA
WP_040089448.1|2866236_2869479_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
WP_004174237.1|2869483_2870098_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004900718.1|2870399_2870765_+	hdeB family protein	NA	NA	NA	NA	NA
WP_009309664.1|2870833_2871106_-	hypothetical protein	NA	NA	NA	NA	NA
2871741:2871757	attL	TTTGCCAATATTTGCCA	NA	NA	NA	NA
WP_047718525.1|2871778_2872795_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	96.7	9.8e-195
WP_047719162.1|2872794_2873367_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	94.7	9.6e-99
WP_047718526.1|2873791_2874301_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.0	4.0e-88
2873465:2873481	attR	TGGCAAATATTGGCAAA	NA	NA	NA	NA
WP_047719163.1|2874308_2874509_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
WP_032454119.1|2874472_2874811_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_032454118.1|2874879_2875107_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	74.7	4.6e-20
WP_042943327.1|2875106_2875328_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	87.7	4.0e-29
WP_047718529.1|2875328_2875610_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_162492033.1|2875758_2877834_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.3	0.0e+00
WP_004178082.1|2878288_2879776_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_053003100.1|2879853_2880294_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	85.4	2.3e-60
WP_047718532.1|2880566_2881595_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	37.7	4.1e-47
WP_077257698.1|2881599_2883612_+	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	32.6	9.8e-05
WP_004195876.1|2883916_2884960_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	6.8e-167
WP_047718537.1|2884959_2886729_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	3.7e-306
WP_047718540.1|2886894_2887749_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	4.8e-126
WP_047718542.1|2887822_2888881_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	84.1	3.8e-165
WP_074187707.1|2888908_2889628_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.0	1.1e-94
WP_009309691.1|2889724_2890231_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_004175163.1|2890230_2890434_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_009309693.1|2890438_2890729_+|holin	phage holin family protein	holin	O80308	Escherichia_phage	84.7	9.1e-37
WP_047718548.1|2890715_2891213_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	86.1	1.5e-79
WP_047718549.1|2891209_2891638_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.4	1.5e-40
WP_047718550.1|2891612_2891771_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	68.0	1.2e-11
WP_047718552.1|2891733_2892201_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	77.4	5.1e-66
WP_047718553.1|2892193_2892643_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.3	1.6e-48
WP_032435911.1|2892711_2893347_+|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	84.4	1.2e-97
WP_014343405.1|2893343_2893691_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_047718554.1|2893695_2894604_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.2	4.4e-114
WP_077257705.1|2894611_2895271_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	54.1	7.8e-52
WP_053003101.1|2895273_2897433_+	CotH kinase family protein	NA	NA	NA	NA	NA
WP_053003102.1|2897442_2898564_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	47.5	1.9e-74
WP_047718557.1|2898579_2898825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718558.1|2898886_2899960_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	45.2	2.5e-31
WP_047718559.1|2900069_2901251_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	6.7e-195
WP_014343412.1|2901264_2901780_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|2901840_2902116_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343413.1|2902148_2902268_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_047718560.1|2902260_2904699_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	72.7	8.4e-293
WP_015959003.1|2904715_2905195_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	82.8	1.9e-71
WP_009308675.1|2905194_2906361_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.9	2.8e-177
WP_032420109.1|2906428_2906647_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|2907002_2907509_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|2907608_2909450_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|2909668_2911414_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|2911525_2911741_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|2911978_2912992_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 7
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	3449258	3460476	5262013	transposase,integrase	Enterobacteria_phage(75.0%)	12	3450892:3450914	3460526:3460548
WP_072269358.1|3449258_3450227_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	1.7e-172
3450892:3450914	attL	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
WP_023307272.1|3451521_3453855_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
WP_002889897.1|3453866_3454187_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_047718632.1|3454183_3454411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077254401.1|3454407_3454959_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	67.5	3.7e-31
WP_004132554.1|3454955_3455222_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_047718634.1|3455761_3456499_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.8	8.4e-71
WP_032699000.1|3456495_3456741_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	4.2e-19
WP_047718635.1|3456758_3457325_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.4e-57
WP_052455064.1|3457694_3458594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437170.1|3458593_3459253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437168.1|3459282_3460476_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.1	1.4e-104
3460526:3460548	attR	GTGTACCTAAACGTGTACCAATT	NA	NA	NA	NA
>prophage 8
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	3576665	3640975	5262013	terminase,tail,integrase,protease,holin,transposase	Salmonella_phage(44.68%)	67	3577660:3577677	3643723:3643740
WP_004151980.1|3576665_3578132_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
3577660:3577677	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|3578199_3579777_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_047718652.1|3579969_3581220_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	5.2e-206
WP_004243823.1|3581236_3581428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718654.1|3581424_3582018_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	1.3e-109
WP_047718656.1|3582014_3582671_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	64.0	2.2e-70
WP_047718657.1|3582667_3582826_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_009485475.1|3582818_3583112_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|3583221_3583470_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_047718660.1|3583518_3584454_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.7	1.2e-141
WP_047718662.1|3584450_3585272_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	82.8	4.6e-134
WP_047718663.1|3585268_3585568_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	4.7e-20
WP_004164037.1|3585564_3585714_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_047718665.1|3585934_3586516_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	1.2e-64
WP_004152538.1|3586670_3586904_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_032413843.1|3587250_3588309_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	66.2	9.7e-145
WP_004200565.1|3588298_3589069_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
WP_047718668.1|3589194_3589542_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	84.3	1.7e-50
WP_047718670.1|3589734_3590286_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	65.2	1.5e-08
WP_047718671.1|3590278_3590956_+	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	41.0	2.8e-36
WP_047718673.1|3590955_3591474_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	90.9	5.7e-90
WP_047718674.1|3591470_3592130_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	28.9	5.7e-10
WP_017896964.1|3592536_3592866_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.0e-28
WP_047718678.1|3592923_3593514_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	78.5	1.5e-78
WP_047718680.1|3593510_3594986_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	1.6e-278
WP_053003103.1|3594982_3595768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|3596517_3596721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718682.1|3596724_3598404_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.1	1.4e-193
WP_004152470.1|3598400_3598706_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_177951787.1|3598708_3599386_+	peptidase	NA	Q858G9	Salmonella_phage	62.8	9.8e-50
WP_004197367.1|3599398_3600406_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|3600415_3600808_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|3600800_3601079_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|3601127_3601739_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_047718685.1|3601738_3604216_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.2	1.5e-265
WP_047718687.1|3604217_3604688_+	hypothetical protein	NA	Q858G2	Salmonella_phage	54.6	1.2e-43
WP_047718688.1|3604680_3605178_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	42.3	6.8e-24
WP_047718689.1|3605190_3607935_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	39.7	1.5e-96
WP_047718691.1|3607934_3611324_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.1	4.8e-121
WP_047718693.1|3611325_3612177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141317.1|3612451_3612997_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_047718695.1|3613385_3614075_-	Bro-N domain-containing protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_148639112.1|3614546_3615134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310076.1|3615234_3616215_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_142996750.1|3616240_3616453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146394.1|3616548_3616953_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_047718701.1|3616939_3617245_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_047718703.1|3617234_3617864_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.9	1.3e-91
WP_047718705.1|3617860_3618343_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	81.9	1.1e-63
WP_032421624.1|3618563_3620432_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_040089533.1|3620415_3621594_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|3621887_3623120_-	MFS transporter	NA	NA	NA	NA	NA
WP_162492017.1|3623193_3624105_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174861.1|3624201_3624375_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_002913841.1|3624745_3626974_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|3627027_3628560_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|3628563_3630624_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004145656.1|3630804_3631446_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
WP_002913836.1|3631442_3632480_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|3632743_3633637_+	ROK family protein	NA	NA	NA	NA	NA
WP_040089530.1|3633646_3635080_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|3635297_3635924_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|3636019_3637306_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|3637404_3638106_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|3638102_3639014_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|3639142_3639502_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|3639511_3640975_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
3643723:3643740	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 9
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	3947641	3954546	5262013	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_032429748.1|3947641_3948505_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_047669696.1|3948515_3949289_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|3949529_3950426_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|3950668_3952030_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|3952348_3953071_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|3953067_3954546_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 10
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	4227512	4271417	5262013	terminase,lysis,tail,plate,holin,transposase	Salmonella_phage(34.88%)	63	NA	NA
WP_047718826.1|4227512_4228775_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	94.5	1.1e-232
WP_016244760.1|4228817_4229063_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_047718829.1|4229437_4229629_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	2.3e-12
WP_047718830.1|4229625_4230249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718832.1|4230241_4230586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714702.1|4230582_4230807_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	54.1	1.0e-16
WP_123640128.1|4231038_4231260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718833.1|4231330_4231624_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_071844745.1|4232098_4232293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158874.1|4232258_4232477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714806.1|4232687_4232897_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	9.4e-28
WP_025714807.1|4232925_4233330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042930084.1|4233474_4233876_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	47.0	1.8e-11
WP_042930083.1|4233984_4234236_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025714803.1|4234239_4234665_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047718836.1|4234929_4236024_+	hypothetical protein	NA	U5P0A0	Shigella_phage	39.9	5.3e-21
WP_047718837.1|4236050_4236446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|4236445_4236667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718838.1|4236659_4237445_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.3	1.1e-63
WP_047718839.1|4237572_4237842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718841.1|4238417_4238798_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	93.6	1.9e-63
WP_023312767.1|4239749_4240019_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	81.8	1.2e-35
WP_047718843.1|4240253_4240847_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.4	1.2e-43
WP_047718844.1|4240843_4241614_+	hypothetical protein	NA	D5LH17	Escherichia_phage	51.6	1.2e-64
WP_074189202.1|4241610_4242270_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	1.1e-101
WP_047718845.1|4242266_4242845_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	1.6e-48
WP_012542609.1|4243438_4243708_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_047719186.1|4243685_4244183_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	1.3e-78
WP_047718847.1|4244179_4244647_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	74.2	8.8e-58
WP_047718848.1|4244798_4245227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|4245561_4246050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021312714.1|4246000_4247401_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_047718851.1|4247638_4249090_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	4.2e-191
WP_047719187.1|4249145_4249694_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.5e-48
WP_047718852.1|4249746_4249944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718854.1|4249940_4251143_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.2	2.5e-112
WP_000528476.1|4251146_4251641_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_047718855.1|4251652_4252594_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	3.5e-138
WP_000725700.1|4252633_4252915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718857.1|4252883_4253303_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	1.5e-40
WP_047718859.1|4253299_4253806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047718861.1|4253805_4254210_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	68.5	1.7e-41
WP_077257707.1|4254202_4254754_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	2.0e-40
WP_047718862.1|4254755_4255907_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	80.9	1.8e-176
WP_025269949.1|4255917_4256358_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
WP_047718864.1|4256361_4256811_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	54.6	2.8e-37
WP_047719190.1|4256852_4257005_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	5.4e-17
WP_047718865.1|4256994_4258920_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	71.1	2.8e-182
WP_023158909.1|4258919_4259519_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	5.8e-54
WP_074183180.1|4259594_4259822_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	54.7	1.7e-19
WP_040181225.1|4259824_4260856_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	3.5e-99
WP_004199300.1|4260956_4261190_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.6	5.8e-18
WP_047718867.1|4261236_4261602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718869.1|4261824_4262478_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	51.2	4.1e-61
WP_047718870.1|4262756_4263110_+	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.1e-49
WP_047718872.1|4263109_4264306_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	74.4	1.9e-160
WP_047718874.1|4264302_4265076_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	53.7	1.8e-76
WP_053003105.1|4265714_4266182_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	35.8	1.1e-12
WP_158414558.1|4266197_4269107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142996742.1|4269248_4269662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714799.1|4269858_4270176_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	6.9e-22
WP_158414559.1|4270189_4270408_+	hypothetical protein	NA	A0A286S1P3	Klebsiella_phage	74.5	1.8e-13
WP_072269358.1|4270448_4271417_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	1.7e-172
>prophage 11
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	4928167	4939055	5262013		Escherichia_phage(87.5%)	9	NA	NA
WP_021440086.1|4928167_4931275_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|4931329_4932595_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|4932625_4933714_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004183954.1|4933800_4934061_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|4934358_4935219_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|4935239_4936001_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|4936262_4937165_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|4937176_4938442_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|4938434_4939055_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 12
NZ_CP011624	Klebsiella pneumoniae strain CAV1344 chromosome, complete genome	5262013	5107884	5210949	5262013	tRNA,terminase,capsid,tail,integrase,portal,plate,holin,transposase,head	Klebsiella_phage(20.45%)	111	5165047:5165106	5208605:5209653
WP_002902422.1|5107884_5108820_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004176400.1|5108865_5110239_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
WP_004148192.1|5110764_5111748_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_040088882.1|5112026_5112770_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	1.0e-15
WP_047719043.1|5112732_5113851_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004176404.1|5114087_5114282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902411.1|5114394_5115141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902408.1|5115391_5116771_-	amino acid permease	NA	NA	NA	NA	NA
WP_002902405.1|5117105_5117585_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040088865.1|5117836_5118451_+	YitT family protein	NA	NA	NA	NA	NA
WP_002902399.1|5118489_5119689_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002902397.1|5119717_5120386_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004152912.1|5120378_5121392_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
WP_002902393.1|5121400_5122207_-	methionine-binding protein	NA	NA	NA	NA	NA
WP_004148182.1|5122427_5123603_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_025368191.1|5123647_5124682_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004179582.1|5124770_5125319_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040088864.1|5125375_5126287_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_020324664.1|5126279_5127149_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_052455031.1|5127845_5128160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190483.1|5128179_5129085_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002902287.1|5129225_5130155_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_004176413.1|5130180_5130387_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004151595.1|5130437_5131316_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040088862.1|5132234_5132828_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176415.1|5132901_5133615_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004176416.1|5133681_5134176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176417.1|5134303_5134846_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004176418.1|5134823_5135909_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|5135872_5137627_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023283611.1|5137706_5139299_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_040088860.1|5139298_5142724_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_047719047.1|5142707_5143847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|5143843_5144101_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_047719049.1|5144121_5146575_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_040242777.1|5146562_5147093_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|5147160_5147691_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|5147759_5148290_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_047719052.1|5148357_5148888_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_004224359.1|5148951_5149731_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_162492041.1|5149731_5152101_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_047719053.1|5152102_5154757_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.3	9.4e-96
WP_002902160.1|5155021_5155513_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_004151602.1|5155517_5157224_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|5157220_5157910_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_162492029.1|5157906_5159250_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|5159259_5160804_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|5160846_5161338_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|5162183_5162432_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_047719055.1|5162642_5162939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142996742.1|5163046_5163460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719057.1|5163601_5164807_-	hypothetical protein	NA	NA	NA	NA	NA
5165047:5165106	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
WP_077257689.1|5165102_5166071_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	2.5e-184
WP_158414560.1|5166092_5167646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053003106.1|5167732_5168695_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.7	1.6e-08
WP_142996751.1|5168712_5169597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719060.1|5169628_5170306_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_047719063.1|5170302_5171451_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	35.3	8.6e-22
WP_047719064.1|5171440_5171890_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	40.5	3.6e-16
WP_047719066.1|5171886_5172468_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_047719068.1|5172464_5173550_-|tail	tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.1e-39
WP_047719069.1|5173546_5174947_-	DNA circularization protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_047719071.1|5174993_5176847_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
WP_047719073.1|5176988_5177267_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896639.1|5177268_5177640_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_047719075.1|5177643_5179155_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.4	1.5e-103
WP_047719076.1|5179151_5179337_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047719077.1|5179339_5179885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719078.1|5179881_5180241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719079.1|5180245_5180656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719080.1|5180627_5181677_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	34.0	1.2e-51
WP_047719081.1|5181775_5182183_-|head	head decoration protein	head	NA	NA	NA	NA
WP_047719083.1|5182182_5182776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719084.1|5182777_5183644_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	6.2e-49
WP_047719086.1|5183640_5185275_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.1	6.8e-89
WP_000483310.1|5185274_5185538_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_047719088.1|5185546_5187673_-|terminase	phage terminase large subunit family protein	terminase	A0A0C5ABH4	Bacteriophage	34.5	1.8e-97
WP_047719090.1|5187614_5188196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719216.1|5188440_5189079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719092.1|5189160_5189364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719095.1|5189879_5190230_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	41.5	4.9e-13
WP_047719218.1|5190435_5190933_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.4	4.3e-79
WP_047719096.1|5190910_5191180_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	82.6	7.1e-36
WP_023304962.1|5191929_5193015_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_023304963.1|5193014_5194007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705426.1|5194046_5194394_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	5.2e-55
WP_040225052.1|5194386_5194767_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	5.3e-37
WP_032419906.1|5194753_5196133_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	65.0	9.6e-161
WP_040225050.1|5196129_5197008_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.5	6.5e-86
WP_032419903.1|5197019_5197850_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	67.3	8.8e-85
WP_032419902.1|5197846_5198035_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_019705432.1|5198110_5198338_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	60.0	1.5e-15
WP_019705433.1|5198462_5199170_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	50.2	6.9e-54
WP_047719101.1|5199329_5199638_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	57.3	6.1e-23
WP_019705435.1|5199627_5199822_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	50.0	4.5e-08
WP_004177202.1|5199992_5200217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719103.1|5200217_5200583_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.7	9.9e-57
WP_032419901.1|5200575_5200830_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	9.4e-38
WP_130944438.1|5200801_5201020_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	97.2	1.1e-31
WP_040186814.1|5201016_5201457_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
WP_032422926.1|5201497_5202016_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_047719107.1|5202021_5202723_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	87.3	4.8e-108
WP_047719108.1|5202719_5203283_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.2	1.1e-25
WP_047719113.1|5203279_5203501_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	84.9	1.1e-26
WP_004198241.1|5203636_5203828_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
WP_047719115.1|5203808_5204990_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	83.5	1.8e-200
WP_016197745.1|5205186_5205735_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_040088846.1|5205933_5207466_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_047719117.1|5207632_5208619_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	8.9e-185
WP_077257689.1|5208660_5209629_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	2.5e-184
WP_001101446.1|5209923_5210949_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
5208605:5209653	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGCCTCCGCAACCTGACCATCGTAGTCACGCAGCGTCAGTGAACCCCCGAACAGCTGTTTTACCCGGTACATCGCCGTTTCCGCTATCGAGCGACGGTTGTAATCTGTTGTCCATTTCCACCGCGCATTACTCCCGGTCATTCGCTGATTAGCCACTGCACGGTTACGGTCTGCATATTCACCGGGCCAGTAACCCGCACCTTTTCGGGGCGGGATAAGCGCGCTGATTTTCTTACGCCGCAGTTCATCGTGACAGAGCCGGGTATCGTAAGCGCCATCGGCGGCGGCTGACCTGATTTTCCGGTGGGTTTGCCGGATTAACCCGGGGAAGGCCTCTGAGTCCGTAACGTTGTTCAGCGACAGGTCAGCGCAGATGATTTCATGTGTTTTACTGTCAACGGCGAGATGCAGCTTACGCCAGATACGGCGGCGTTCCTGGCCATGCTTTTTGACTTTCCACTCGCCTTCACCGAAGACCTTCAGCCCGGTGGAATCAATTACCAGTTGTGCGATTTCACCCCGGGTGGGCGTTTTGAAACTGACATTAACCGACTTTGCCCGCCTGCTGACACAGCTGTAATCCGGGCAGCGCAACGGAACATTCATCAGTGTAAAAATGGAATCAATAAAACCCTGCGCAGCGCGCAGGGTCAGCCTGAATACGCGTTTAATGACCAGCACAGTCGTGATGGCAAGGTCAGAATAGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATAGCTTCATCATCCAGCCAGAAAGTTATGGAGCCACGGTTGATGAGGGCTTTATTGTAGGTGGGCCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCA	NA	NA	NA	NA
>prophage 1
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	0	2756	250396		Bacillus_phage(50.0%)	3	NA	NA
WP_003032875.1|100_1576_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_020803533.1|1826_2258_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004187110.1|2405_2756_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
>prophage 2
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	10921	52983	250396	transposase,protease,integrase	Macacine_betaherpesvirus(25.0%)	40	18503:18517	41465:41479
WP_009309912.1|10921_11557_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014839937.1|12885_13854_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	2.6e-181
WP_009309915.1|14720_15998_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_009309916.1|16659_17538_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_032425563.1|17578_17995_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_047718083.1|17991_18222_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
18503:18517	attL	ATATGTTGTGTCCCT	NA	NA	NA	NA
WP_006788213.1|18818_19037_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_009309918.1|19038_19344_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_162898808.1|19572_19713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309920.1|19762_20098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309921.1|20131_21148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287113.1|21345_22125_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_009310077.1|22182_22440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343462.1|22568_22682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654811.1|23213_24182_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_009310076.1|25617_26598_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_020804663.1|27161_27827_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004187025.1|28915_29164_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001189111.1|30878_32387_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000227969.1|32928_34005_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001515717.1|34960_35701_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_000200070.1|36398_37409_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_000523812.1|38159_39326_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_009309982.1|39325_40297_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_009309981.1|41579_41885_-	hypothetical protein	NA	NA	NA	NA	NA
41465:41479	attR	AGGGACACAACATAT	NA	NA	NA	NA
WP_004206783.1|41938_42190_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004206782.1|42268_43540_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_009309980.1|43539_43965_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_020803845.1|44367_45855_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032425559.1|46103_47075_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
WP_004152354.1|47077_47749_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_009309993.1|47809_48040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|48476_49178_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|49177_49399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|49408_49828_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568044.1|49881_50649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568045.1|51329_51758_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001568046.1|51800_52307_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
WP_001568047.1|52349_52541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191981.1|52728_52983_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	6.1e-13
>prophage 3
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	56021	65121	250396	transposase	Vibrio_phage(20.0%)	10	NA	NA
WP_025861951.1|56021_56585_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_021314431.1|57414_57957_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	1.0e-49
WP_001568055.1|58005_58254_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_009310025.1|58323_60381_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
WP_020804497.1|60425_60857_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001568058.1|60853_61582_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568059.1|61578_61905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280872.1|61960_62335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086937184.1|62535_63910_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_009310020.1|64080_65121_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
>prophage 4
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	81346	81873	250396		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_004196370.1|81346_81586_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
WP_000323025.1|81585_81873_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
>prophage 5
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	87042	90639	250396		Klebsiella_phage(25.0%)	7	NA	NA
WP_019706019.1|87042_87399_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
WP_019706020.1|87459_87672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|87682_87907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|87987_88308_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|88297_88576_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_021312979.1|88576_88990_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023316395.1|89817_90639_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	8.8e-45
>prophage 6
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	125290	129120	250396		Xanthomonas_phage(50.0%)	4	NA	NA
WP_016831060.1|125290_126016_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	27.6	5.5e-06
WP_004152380.1|126087_126681_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_162492045.1|126841_127444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064762441.1|128640_129120_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	5.4e-18
>prophage 7
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	132633	180787	250396	transposase,protease	uncultured_Mediterranean_phage(20.0%)	44	NA	NA
WP_025714249.1|132633_133629_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	7.0e-20
WP_025714251.1|134473_135625_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.9	9.5e-21
WP_047718087.1|135649_136615_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_023280941.1|136592_137090_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_023280940.1|137086_138802_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_025714252.1|138805_139246_-	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
WP_001514140.1|139235_140381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329026.1|140429_141071_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_013307890.1|141161_142049_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_013307889.1|142151_143066_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_013307888.1|143088_143547_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023205099.1|143634_143775_-|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_017146640.1|144521_144713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329025.1|144712_147562_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.9	7.6e-128
WP_004118809.1|147667_148237_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_013307885.1|148271_148553_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	6.8e-05
WP_074186025.1|148794_148929_-	phospholipase	NA	NA	NA	NA	NA
WP_074185243.1|148948_149917_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	6.5e-172
WP_023280930.1|150479_151733_-	lactose permease	NA	NA	NA	NA	NA
WP_040236942.1|151784_154859_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|154980_156063_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_000427623.1|156649_157654_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_042938035.1|158199_159318_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_038992757.1|159350_160424_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032693911.1|160423_161170_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	4.1e-25
WP_032693912.1|161171_161984_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023292122.1|162057_162879_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038992754.1|163074_164151_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042938040.1|164570_165437_-	DMT family transporter	NA	NA	NA	NA	NA
WP_050595137.1|165457_166288_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_003031954.1|166287_167028_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	4.7e-29
WP_003031955.1|167027_167690_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038992750.1|167733_168489_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023292117.1|168554_169385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023292116.1|169390_170428_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_023292115.1|170658_171756_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038992640.1|172080_172395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038992639.1|172401_172707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038992641.1|172826_174335_-	YfcC family protein	NA	NA	NA	NA	NA
WP_038992638.1|174334_175267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038992636.1|175263_176280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038992633.1|176562_178275_+	ROK family protein	NA	NA	NA	NA	NA
WP_001567369.1|178722_179355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|179383_180787_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	190574	194000	250396		Bacillus_virus(50.0%)	3	NA	NA
WP_047718091.1|190574_191573_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	7.5e-30
WP_047718107.1|191569_193216_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047718092.1|193229_194000_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.7	1.6e-16
>prophage 9
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	197117	235487	250396	transposase	Salmonella_phage(33.33%)	42	NA	NA
WP_116288038.1|197117_198345_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	5.9e-170
WP_047718095.1|199292_200201_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047718096.1|200958_202116_+	amidohydrolase	NA	NA	NA	NA	NA
WP_047718097.1|202172_203549_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_013815099.1|203810_204779_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_047718098.1|204990_206325_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_047718099.1|207983_209219_+	MFS transporter	NA	NA	NA	NA	NA
WP_176756570.1|209397_209688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040225645.1|209783_210038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040225648.1|210101_210347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162492046.1|210381_211350_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	6.1e-186
WP_032744126.1|211697_214379_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_017900604.1|214881_215430_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017900603.1|215413_215737_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_047718110.1|217108_217306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654805.1|217327_218296_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_001067855.1|219177_219882_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001247892.1|220368_220659_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|220655_221057_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003465043.1|221046_221403_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|221657_221984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|221980_222481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|222477_222849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|222842_223400_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427623.1|223478_224483_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004197809.1|224664_224868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|224881_225085_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197807.1|225118_225487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805591.1|225530_226025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718100.1|226055_226631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718101.1|226618_226888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196907.1|227177_228716_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|228764_229112_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_003031976.1|229108_229513_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_004118349.1|229663_229843_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_004118688.1|229829_229928_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_009309894.1|230306_230741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152084.1|230956_232357_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|232353_233034_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_023157117.1|233088_234018_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|234022_234403_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000654805.1|234518_235487_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
>prophage 10
NZ_CP011623	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence	250396	239193	246450	250396		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_004118669.1|239193_239931_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|239964_240162_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|240202_242650_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_008322815.1|242776_243217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|243303_246450_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
>prophage 1
NZ_CP011621	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence	77808	0	10655	77808		Morganella_phage(14.29%)	14	NA	NA
WP_020804879.1|940_1366_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
WP_020314631.1|1573_1804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032744253.1|2238_2940_+	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
WP_020804418.1|2939_3161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804419.1|3206_3617_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_020804421.1|3663_4428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032744250.1|4860_5289_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
WP_020803879.1|5333_5840_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_020803881.1|5880_6072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425679.1|6272_6536_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
WP_162933722.1|6566_6881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804459.1|7728_8286_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.2	5.2e-49
WP_020804458.1|8335_8584_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020804462.1|8654_10655_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.9	6.7e-22
>prophage 2
NZ_CP011621	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence	77808	15285	17228	77808		Klebsiella_phage(50.0%)	4	NA	NA
WP_020804855.1|15285_15624_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	54.1	1.6e-21
WP_020804856.1|15679_16027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032744242.1|16117_16348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804857.1|16394_17228_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.3	2.4e-21
>prophage 3
NZ_CP011621	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence	77808	52561	57743	77808		Xanthomonas_phage(33.33%)	7	NA	NA
WP_032744225.1|52561_53287_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	3.2e-06
WP_032744221.1|53443_54037_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_072216873.1|54197_54800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803821.1|55125_55776_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004098858.1|55772_56081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072156906.1|56253_56733_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.8	1.2e-17
WP_000027057.1|56882_57743_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 4
NZ_CP011621	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence	77808	60972	64699	77808	transposase	Enterobacteria_phage(100.0%)	2	NA	NA
WP_001217881.1|60972_61530_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143760.1|61693_64699_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
>prophage 5
NZ_CP011621	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence	77808	68491	69487	77808	transposase	Thermus_phage(100.0%)	1	NA	NA
WP_020326536.1|68491_69487_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
>prophage 6
NZ_CP011621	Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence	77808	73181	76840	77808	transposase	Sodalis_phage(33.33%)	4	NA	NA
WP_020314639.1|73181_74135_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_022644719.1|74255_74522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314642.1|74541_75162_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_020804882.1|76198_76840_+	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
>prophage 1
NZ_CP011622	Klebsiella pneumoniae strain CAV1344 plasmid pKPC_CAV1344, complete sequence	176497	84281	106033	176497	integrase,transposase	Salmonella_phage(28.57%)	18	80920:80933	102304:102317
80920:80933	attL	CCTTTTTGCTCCTC	NA	NA	NA	NA
WP_000543934.1|84281_85292_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|85294_85831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|86129_86411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|90353_91079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|91192_91567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|91687_91804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|92209_93214_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_047718078.1|93292_96265_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|96267_96825_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|97130_98144_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|98289_98823_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000679427.1|98979_99327_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|99320_100160_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|100564_102106_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|102438_103095_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
102304:102317	attR	GAGGAGCAAAAAGG	NA	NA	NA	NA
WP_000259031.1|103294_104134_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|104261_104762_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|105268_106033_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP011622	Klebsiella pneumoniae strain CAV1344 plasmid pKPC_CAV1344, complete sequence	176497	109035	142702	176497	transposase	Salmonella_phage(33.33%)	27	NA	NA
WP_000427620.1|109035_110040_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|110118_110553_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004152397.1|113213_114533_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|114782_115664_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|116050_116830_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|116826_117852_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|117958_120988_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|121097_122813_+	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_001217881.1|123927_124485_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|124718_125273_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|125342_126131_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|126190_127015_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|127714_128575_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_002210513.1|129586_130348_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_020316986.1|130368_131229_-	class A extended-spectrum beta-lactamase SHV-7	NA	A0A077SL40	Escherichia_phage	99.0	6.4e-155
WP_000654805.1|131349_132318_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_001166628.1|133704_134160_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|134231_134597_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|134612_134888_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|134915_135341_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|135379_137065_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|137082_137448_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|137444_137681_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|137746_137959_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|138089_138650_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_032622532.1|138652_141619_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_000427620.1|141697_142702_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
