The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	0	16302	4976908	protease	Bacillus_phage(100.0%)	13	NA	NA
WP_003035862.1|1701_2955_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_003836843.1|2959_4600_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_003035868.1|4596_5160_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_003035871.1|5416_5584_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_003035875.1|5691_6210_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_003035878.1|6278_8039_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_003035881.1|8224_8677_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_003836839.1|8768_9827_-	porin OmpA	NA	NA	NA	NA	NA
WP_032936288.1|10184_10694_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_003035889.1|10911_11526_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_032941200.1|11503_13657_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_003035892.1|13675_14122_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_044700756.1|14247_16302_+	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	24.0	1.8e-09
>prophage 2
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	20552	21212	4976908	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003035917.1|20552_21212_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
>prophage 3
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	26492	27308	4976908		Indivirus(100.0%)	1	NA	NA
WP_044700745.1|26492_27308_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.7	1.5e-15
>prophage 4
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	34981	35902	4976908		Klosneuvirus(100.0%)	1	NA	NA
WP_044700736.1|34981_35902_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	3.6e-10
>prophage 5
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	48716	49412	4976908		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003836817.1|48716_49412_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	3.9e-17
>prophage 6
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	54613	54787	4976908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036022.1|54613_54787_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 7
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	66937	67726	4976908		Cronobacter_phage(100.0%)	1	NA	NA
WP_003036052.1|66937_67726_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	6.0e-91
>prophage 8
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	72567	76372	4976908		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_044700709.1|72567_73506_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.5	3.2e-06
WP_003836800.1|73592_74330_+	phosphatase	NA	NA	NA	NA	NA
WP_003836798.1|74353_74908_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044700707.1|75009_75492_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_003036082.1|75538_76372_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
>prophage 9
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	80561	81104	4976908		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_003036110.1|80561_81104_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.2e-27
>prophage 10
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	89319	93101	4976908		Bacillus_phage(50.0%)	3	NA	NA
WP_032948981.1|89319_90741_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.1	3.2e-18
WP_044700699.1|90804_92025_-	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_003036136.1|92180_93101_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
>prophage 11
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	97820	98066	4976908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036157.1|97820_98066_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 12
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	113301	114252	4976908		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003836755.1|113301_114252_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 13
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	128990	130117	4976908		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_003036255.1|128990_129725_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
WP_000103754.1|129880_130117_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 14
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	133403	139415	4976908		Pseudomonas_phage(33.33%)	5	NA	NA
WP_003846791.1|133403_134045_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.5	7.6e-28
WP_044700671.1|134041_135046_+	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	34.8	8.1e-08
WP_003036276.1|135056_135854_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003836725.1|136147_137581_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_032936192.1|137636_139415_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.3	4.1e-79
>prophage 15
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	144528	145296	4976908		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003036301.1|144528_145296_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	1.9e-12
>prophage 16
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	180050	180308	4976908		Erwinia_phage(100.0%)	1	NA	NA
WP_003030810.1|180050_180308_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 17
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	187592	195303	4976908		Mycoplasma_phage(50.0%)	8	NA	NA
WP_044700614.1|187592_188294_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	4.9e-36
WP_003030804.1|188293_189538_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_003030802.1|189627_190539_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_003030799.1|190554_191376_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	36.1	3.3e-23
WP_003030797.1|191475_192522_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_003030794.1|192549_193329_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_044700611.1|193325_194183_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
WP_003030791.1|194166_195303_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
>prophage 18
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	200304	291214	4976908	holin,capsid,portal,tail,transposase,terminase,protease,tRNA,head	Enterobacteria_phage(23.38%)	108	NA	NA
WP_044700610.1|200304_201591_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	50.4	5.5e-110
WP_032943036.1|201590_201806_-	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	56.3	5.7e-20
WP_052739229.1|201872_204344_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.6	3.3e-111
WP_003832304.1|204485_204812_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_044700608.1|205184_205451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003832307.1|205787_206168_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
WP_003832309.1|206273_206486_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
WP_044700607.1|206489_207044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072213458.1|207993_208665_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.9e-67
WP_044700602.1|208788_209142_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_038641374.1|209189_209552_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_044700601.1|209569_211321_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_038641369.1|211367_212657_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	9.6e-171
WP_038641366.1|212669_213095_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
WP_038641364.1|213162_213459_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044700597.1|213558_214650_+	permease	NA	NA	NA	NA	NA
WP_044700595.1|214936_215170_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	6.0e-31
WP_071681812.1|215215_215461_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.0	2.9e-20
WP_044700593.1|215590_215791_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	1.2e-16
WP_044700591.1|215793_216153_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.4e-42
WP_044700635.1|217203_217818_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	76.9	1.0e-85
WP_044700589.1|218570_218945_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_044700587.1|219089_219278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700586.1|219431_219710_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	96.7	1.2e-43
WP_044700584.1|219681_220230_+	lysozyme	NA	K7PM52	Enterobacteria_phage	93.4	1.0e-97
WP_044700581.1|220226_220742_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_044700579.1|220738_220969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700634.1|221359_221557_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	3.7e-26
WP_079938067.1|221594_221750_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_000066494.1|222128_222341_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
WP_057069020.1|222351_222540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000756041.1|222613_222844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700578.1|223048_223222_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_044700576.1|223594_224134_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	79.0	6.4e-44
WP_047715729.1|224409_224772_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	86.7	3.7e-56
WP_044700575.1|225005_225503_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	93.3	8.4e-83
WP_016150031.1|225499_227227_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	92.8	0.0e+00
WP_003832363.1|227220_227400_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	71.2	3.3e-13
WP_044700572.1|227399_228659_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.0	7.1e-219
WP_044700569.1|228695_229616_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.7	6.0e-135
WP_044700568.1|229688_230975_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	8.0e-210
WP_044700565.1|231072_231450_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
WP_003832371.1|231430_231748_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
WP_044700562.1|231744_232095_+|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	73.9	1.6e-43
WP_044700560.1|232063_232453_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	63.7	1.6e-41
WP_044700558.1|232449_232851_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	85.0	1.1e-56
WP_044700555.1|232884_233367_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	81.2	4.7e-62
WP_044700554.1|233428_233791_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	2.5e-28
WP_071681837.1|233805_234039_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	66.2	8.3e-25
WP_044700552.1|234038_237329_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.3	0.0e+00
WP_044700550.1|237329_237662_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.0	2.0e-40
WP_044700547.1|237670_238366_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.0	1.8e-94
WP_044700545.1|238377_239112_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.9	1.9e-115
WP_071681833.1|239009_239687_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	71.1	2.0e-71
WP_044700543.1|239759_243161_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.4	0.0e+00
WP_044700540.1|245157_245742_+	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	47.9	1.1e-46
WP_044700539.1|245977_246706_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.8	7.8e-45
WP_044700535.1|246909_247344_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044700533.1|247340_248060_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044700531.1|248056_249313_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044700528.1|249314_250037_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_044700526.1|250033_251254_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044700524.1|251250_251736_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_044700522.1|251732_252260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700520.1|252256_252787_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_044700519.1|252800_253760_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_042922212.1|254403_254781_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_042922210.1|254780_255128_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922208.1|255177_256716_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_044700360.1|256940_257429_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	94.4	8.9e-77
WP_047499052.1|257428_259531_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	87.3	0.0e+00
WP_001082414.1|259527_259743_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
WP_047715730.1|259739_261248_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.1	6.6e-256
WP_047715731.1|261192_263217_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.6	0.0e+00
WP_047499162.1|263309_263636_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	59.3	1.2e-29
WP_047715732.1|263628_263904_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	61.5	6.8e-26
WP_044700352.1|263913_264492_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	96.4	1.2e-93
WP_044700350.1|264488_264890_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	89.5	9.8e-66
WP_044700348.1|264899_265643_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	85.8	8.1e-114
WP_047715733.1|265653_266085_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	74.1	7.1e-54
WP_071845155.1|266093_266408_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	91.3	2.4e-51
WP_047715734.1|266391_269535_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	85.9	0.0e+00
WP_047715735.1|269538_269886_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	9.5e-41
WP_047715736.1|269882_270638_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.5	2.5e-131
WP_047715737.1|270639_271350_+	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	91.5	1.6e-135
WP_047715738.1|271356_271800_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	60.7	4.9e-34
WP_071698655.1|271919_272087_+	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	72.7	6.6e-16
WP_080964717.1|272160_272742_+	Bro-N domain-containing protein	NA	H6WRU8	Salmonella_phage	38.8	7.7e-27
WP_047715739.1|272819_273563_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	53.1	7.9e-61
WP_008322436.1|273673_274099_+	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	36.9	6.6e-12
WP_047715740.1|274154_274745_+|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	79.0	2.4e-76
WP_047715741.1|274798_277984_+	host specificity protein J	NA	O64335	Escherichia_phage	87.5	0.0e+00
WP_047715743.1|277983_278298_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	56.9	4.6e-26
WP_047715745.1|278298_278973_+	hypothetical protein	NA	O64337	Escherichia_phage	50.7	2.5e-53
WP_046155137.1|279081_279321_+	hypothetical protein	NA	K7PLZ0	Enterobacterial_phage	57.1	7.0e-19
WP_047715746.1|279379_280453_+|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	52.1	3.8e-88
WP_047715748.1|280520_280763_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	8.4e-28
WP_044700301.1|281128_281695_-	hydrolase	NA	NA	NA	NA	NA
WP_003034862.1|281983_283756_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003034863.1|283757_284201_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034865.1|284229_284973_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034867.1|285007_285529_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|285609_286221_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|286229_287240_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034874.1|287318_288104_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034877.1|288100_288856_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_003841677.1|288934_289879_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034883.1|289894_291214_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
>prophage 19
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	295147	296623	4976908		Cyanophage(100.0%)	1	NA	NA
WP_003034896.1|295147_296623_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
>prophage 20
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	304372	308859	4976908		Klebsiella_phage(33.33%)	7	NA	NA
WP_003034918.1|304372_305035_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	7.0e-08
WP_003841657.1|305058_305715_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|305821_306052_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003034928.1|306195_306570_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034931.1|306573_307446_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_044700293.1|307466_307805_+	YebY family protein	NA	NA	NA	NA	NA
WP_003034937.1|308217_308859_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
>prophage 21
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	316305	318354	4976908		Moraxella_phage(100.0%)	1	NA	NA
WP_003034960.1|316305_318354_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
>prophage 22
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	337083	338204	4976908	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087451024.1|337083_338204_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 23
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	342814	343465	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_044700253.1|342814_343465_+	lytic transglycosylase domain-containing protein	NA	U5PVY0	Bacillus_phage	36.1	6.0e-12
>prophage 24
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	350456	350666	4976908		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|350456_350666_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 25
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	358163	359723	4976908		Moraxella_phage(100.0%)	1	NA	NA
WP_003844070.1|358163_359723_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 26
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	363591	370942	4976908	tRNA	Pandoravirus(25.0%)	7	NA	NA
WP_044700240.1|363591_364953_-	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	2.9e-40
WP_003020986.1|365036_365216_+	YoaH family protein	NA	NA	NA	NA	NA
WP_003020984.1|365222_365567_-	RidA family protein	NA	NA	NA	NA	NA
WP_003020980.1|365708_367619_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
WP_044700237.1|367677_368373_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
WP_003020975.1|368467_369052_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_003020970.1|369256_370942_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.4e-35
>prophage 27
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	394300	395062	4976908		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_044700223.1|394300_395062_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	2.8e-13
>prophage 28
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	409135	409867	4976908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003841536.1|409135_409867_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	2.4e-54
>prophage 29
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	422774	428514	4976908		Klosneuvirus(33.33%)	4	NA	NA
WP_008784983.1|422774_424160_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.3e-27
WP_044700197.1|424175_425639_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003020797.1|425759_427442_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.5	1.3e-21
WP_001518537.1|427566_428514_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 30
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	431761	435768	4976908		Pseudomonas_phage(50.0%)	5	NA	NA
WP_044700189.1|431761_432844_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
WP_044700188.1|432843_433677_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003020779.1|433673_434066_+	SirB family protein	NA	NA	NA	NA	NA
WP_003020775.1|434068_434878_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003020772.1|434913_435768_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
>prophage 31
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	448990	459411	4976908		Escherichia_phage(25.0%)	10	NA	NA
WP_016150347.1|448990_450529_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
WP_016150346.1|450525_451236_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003020743.1|451235_451913_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003020737.1|453039_453882_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
WP_003841307.1|453937_454393_-	YchJ family protein	NA	NA	NA	NA	NA
WP_003020732.1|454504_455416_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_003841305.1|455506_456520_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003020727.1|456724_457633_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
WP_003020723.1|457769_458183_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_044700177.1|458793_459411_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	8.6e-53
>prophage 32
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	467842	470739	4976908		Planktothrix_phage(33.33%)	3	NA	NA
WP_003833364.1|467842_468856_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
WP_003020696.1|468852_469857_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
WP_003020693.1|469902_470739_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
>prophage 33
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	479730	486203	4976908		Acinetobacter_phage(66.67%)	5	NA	NA
WP_047715754.1|479730_481203_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.8	4.1e-16
WP_044700166.1|481235_482042_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_044700164.1|482041_483235_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003841280.1|483245_484604_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.0e-37
WP_003020639.1|484607_486203_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
>prophage 34
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	491181	496569	4976908	protease	Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_003843987.1|491181_491943_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	3.0e-07
WP_003843986.1|492164_493211_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_044700155.1|493321_493573_-	YciN family protein	NA	NA	NA	NA	NA
WP_046155113.1|493971_496569_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.5e-85
>prophage 35
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	501413	502004	4976908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003020601.1|501413_502004_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 36
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	509908	511843	4976908		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_044700145.1|509908_511843_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.5	5.9e-07
>prophage 37
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	515233	517034	4976908		Bacillus_virus(50.0%)	2	NA	NA
WP_003020558.1|515233_516040_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
WP_003020556.1|516041_517034_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
>prophage 38
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	534992	536075	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_044700116.1|534992_536075_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-23
>prophage 39
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	548359	551471	4976908		Escherichia_phage(50.0%)	4	NA	NA
WP_003843948.1|548359_549130_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	6.6e-18
WP_044700105.1|549250_549634_+	VOC family protein	NA	NA	NA	NA	NA
WP_044700102.1|549967_550375_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_044700101.1|550418_551471_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.4	3.5e-86
>prophage 40
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	555141	567621	4976908	tRNA	Streptococcus_phage(12.5%)	11	NA	NA
WP_032935619.1|555141_555657_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.2e-23
WP_032935621.1|555882_556446_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_003020387.1|556458_557691_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	9.0e-17
WP_044700095.1|557758_559861_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.0	2.0e-16
WP_044700094.1|560272_561382_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	2.8e-09
WP_003020379.1|561536_562520_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_003843930.1|562991_564365_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	8.6e-53
WP_003833209.1|564458_565394_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	1.1e-139
WP_003020369.1|565592_566027_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_003020366.1|566108_566321_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_032935630.1|566466_567621_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.7	1.5e-114
>prophage 41
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	572597	573587	4976908		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003020354.1|572597_573587_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.8	3.3e-70
>prophage 42
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	578528	582431	4976908		Klosneuvirus(100.0%)	1	NA	NA
WP_044700087.1|578528_582431_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 43
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	587233	589627	4976908		Escherichia_phage(33.33%)	3	NA	NA
WP_044700084.1|587233_587764_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	1.4e-19
WP_003020321.1|587936_588356_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	3.9e-33
WP_047715763.1|588358_589627_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.4	2.6e-197
>prophage 44
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	596395	599372	4976908		Synechococcus_phage(50.0%)	2	NA	NA
WP_003020293.1|596395_597514_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
WP_003836088.1|597683_599372_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	1.4e-15
>prophage 45
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	621230	623198	4976908		Phage_TP(100.0%)	1	NA	NA
WP_044702349.1|621230_623198_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.8	1.6e-23
>prophage 46
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	629571	630588	4976908		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003020210.1|629571_630588_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
>prophage 47
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	650228	651770	4976908		Salmonella_phage(100.0%)	1	NA	NA
WP_044702330.1|650228_651770_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	54.1	1.3e-36
>prophage 48
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	658120	658894	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_044702321.1|658120_658894_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.7e-18
>prophage 49
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	669255	670800	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_003020103.1|669255_670800_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 50
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	678890	679973	4976908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003836220.1|678890_679973_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	70.4	4.2e-143
>prophage 51
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	686327	688725	4976908		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_032935729.1|686327_686930_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.6e-22
WP_032935731.1|687009_688725_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.9	1.2e-35
>prophage 52
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	698520	700435	4976908		Planktothrix_phage(100.0%)	2	NA	NA
WP_032949300.1|698520_699456_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	9.2e-14
WP_003836252.1|699448_700435_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	3.2e-17
>prophage 53
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	706324	708268	4976908		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_044702437.1|706324_708268_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.0e-11
>prophage 54
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	713725	715465	4976908		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_044702443.1|713725_715465_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.8	7.7e-14
>prophage 55
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	735658	737236	4976908		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_044699822.1|735658_737236_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.6	3.8e-12
>prophage 56
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	742538	747036	4976908		Streptococcus_phage(33.33%)	6	NA	NA
WP_003032424.1|742538_742922_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
WP_003032422.1|742952_743171_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_003032420.1|743201_744101_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_044699830.1|744299_745487_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_003032416.1|745530_746229_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.6e-13
WP_032935768.1|746238_747036_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	27.5	2.1e-11
>prophage 57
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	751863	752790	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_044699837.1|751863_752790_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	4.2e-19
>prophage 58
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	757388	769290	4976908		Escherichia_phage(42.86%)	13	NA	NA
WP_003032393.1|757388_757592_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_044699842.1|757667_759134_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	2.4e-45
WP_044699843.1|759297_760632_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003032386.1|760692_761907_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.9	2.5e-48
WP_044699845.1|762015_762342_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	9.9e-24
WP_003032382.1|762495_762837_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_003032379.1|762872_763433_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_044699847.1|763440_764187_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_086538958.1|764253_764562_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_047715781.1|764710_767149_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	7.8e-214
WP_044699855.1|767159_767777_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	7.3e-76
WP_044699858.1|767778_768633_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_003028918.1|768675_769290_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.0	4.0e-26
>prophage 59
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	775947	783195	4976908		Bacillus_phage(50.0%)	6	NA	NA
WP_003028927.1|775947_777438_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.3	3.1e-24
WP_003028928.1|777434_778157_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.1e-35
WP_044699866.1|778346_779351_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003843582.1|779350_779977_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_047715784.1|780243_781029_-	hypothetical protein	NA	A0A291AY49	Shigella_phage	70.0	2.7e-91
WP_047715787.1|781122_783195_-	tape measure protein	NA	A0A0D4DAK9	Salmonella_phage	29.1	2.4e-38
>prophage 60
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	788023	790121	4976908	transposase	Mycobacterium_phage(50.0%)	2	NA	NA
WP_047715799.1|788023_788575_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.3	3.3e-27
WP_087451024.1|789001_790121_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 61
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	811735	813037	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_003028962.1|811735_813037_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.8	5.2e-15
>prophage 62
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	838148	839423	4976908	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_003029168.1|838148_839423_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	6.5e-87
>prophage 63
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	846341	846866	4976908		Salmonella_phage(100.0%)	1	NA	NA
WP_003029187.1|846341_846866_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 64
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	851968	863011	4976908		Streptomyces_phage(16.67%)	11	NA	NA
WP_044699906.1|851968_852799_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	3.2e-18
WP_003029205.1|852926_853508_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_044699907.1|853547_854717_-	MFS transporter	NA	NA	NA	NA	NA
WP_003029209.1|854893_854983_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_003029211.1|855280_856306_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	8.2e-32
WP_047715818.1|856302_857235_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003843529.1|857348_858554_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_044699909.1|858844_859993_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.9	1.6e-84
WP_044699911.1|860034_860682_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.8	6.8e-24
WP_044699913.1|860899_862273_+	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_044699916.1|862312_863011_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.0	2.3e-09
>prophage 65
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	869629	876424	4976908	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_044699924.1|869629_870112_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.7	3.3e-23
WP_044699926.1|870277_871387_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_044699928.1|871506_873291_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.8e-19
WP_044699929.1|873492_874497_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003029256.1|874917_875664_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	32.4	1.5e-06
WP_003836487.1|875734_876424_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	3.1e-11
>prophage 66
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	887368	893189	4976908		Tupanvirus(33.33%)	5	NA	NA
WP_003836510.1|887368_888121_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	6.7e-07
WP_003029283.1|888117_889122_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032935872.1|889108_890164_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032935874.1|890344_891607_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.4	6.1e-21
WP_044699937.1|891713_893189_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.8	2.0e-15
>prophage 67
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	903122	907669	4976908		Planktothrix_phage(33.33%)	6	NA	NA
WP_003029322.1|903122_903941_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.6	2.3e-37
WP_003029324.1|903940_904726_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032935888.1|904715_905393_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003836540.1|905402_906215_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	32.5	6.8e-05
WP_003029330.1|906218_907004_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_003029332.1|907000_907669_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.1e-24
>prophage 68
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	914560	924793	4976908		Escherichia_phage(50.0%)	9	NA	NA
WP_044699953.1|914560_915295_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	1.1e-22
WP_044699954.1|915295_916318_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_044699957.1|916310_919376_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	4.7e-06
WP_044699958.1|920713_921682_+	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	24.2	1.2e-16
WP_003836560.1|921650_922067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155404704.1|922106_922253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016150148.1|922275_923088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003029361.1|923109_923778_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016150147.1|923770_924793_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	3.8e-13
>prophage 69
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	933581	938672	4976908		environmental_halophage(33.33%)	5	NA	NA
WP_044699968.1|933581_934802_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	43.1	8.7e-97
WP_003836582.1|934798_936070_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_044699970.1|936044_936791_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.8	5.1e-07
WP_003836585.1|936807_938295_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003029385.1|938303_938672_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 70
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	950006	951023	4976908	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_087121885.1|950006_951023_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.1e-185
>prophage 71
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	960344	966762	4976908		Staphylococcus_phage(33.33%)	4	NA	NA
WP_044699981.1|960344_961982_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.7	7.7e-32
WP_003030548.1|962049_964428_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.2	2.0e-169
WP_003030553.1|964755_965589_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_003030555.1|965715_966762_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
>prophage 72
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	972058	985646	4976908	tRNA	Tupanvirus(22.22%)	15	NA	NA
WP_003836641.1|972058_972838_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
WP_044699989.1|972834_974277_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	4.5e-52
WP_003836643.1|974338_975052_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|975368_975833_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003030567.1|975910_976660_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030569.1|976659_977211_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|977271_978252_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|978405_978705_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|978709_981097_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|981112_982096_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_152659856.1|982295_982427_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|982465_982822_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|982877_983075_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|983171_983714_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|983717_985646_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
>prophage 73
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	990912	996662	4976908		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_003840907.1|990912_991674_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
WP_086551139.1|991757_992357_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.6	1.0e-05
WP_003843455.1|992492_993884_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_071524328.1|993947_994211_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_003843454.1|994403_996662_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	47.6	1.7e-138
>prophage 74
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1002811	1003642	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_003840899.1|1002811_1003642_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 75
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1011188	1012409	4976908		Klosneuvirus(100.0%)	1	NA	NA
WP_003840894.1|1011188_1012409_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.2e-27
>prophage 76
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1017943	1018576	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_044700015.1|1017943_1018576_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.3	3.4e-12
>prophage 77
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1023599	1025546	4976908		Streptococcus_phage(100.0%)	1	NA	NA
WP_044700023.1|1023599_1025546_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 78
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1030374	1034434	4976908		Tupanvirus(50.0%)	4	NA	NA
WP_155267879.1|1030374_1031019_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.2	9.4e-18
WP_003840879.1|1031056_1032415_-	MFS transporter	NA	NA	NA	NA	NA
WP_003030679.1|1032555_1033314_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_044700027.1|1033450_1034434_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.4	7.4e-06
>prophage 79
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1040096	1041350	4976908		Tupanvirus(100.0%)	1	NA	NA
WP_044700031.1|1040096_1041350_+	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	30.7	4.1e-25
>prophage 80
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1049299	1053073	4976908		Bacillus_phage(100.0%)	3	NA	NA
WP_003030708.1|1049299_1050583_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	1.9e-09
WP_044700039.1|1050648_1051419_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_044700042.1|1051582_1053073_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.8	1.4e-11
>prophage 81
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1057977	1059003	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_003840865.1|1057977_1059003_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	1.8e-10
>prophage 82
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1074893	1084584	4976908	transposase	uncultured_Caudovirales_phage(44.44%)	12	NA	NA
WP_100216202.1|1074893_1076061_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_032949082.1|1076826_1077099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702845.1|1077364_1077619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032948081.1|1077629_1078115_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	2.3e-08
WP_044702844.1|1079003_1079429_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.7e-50
WP_016150088.1|1079441_1080731_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.2e-166
WP_047715979.1|1080775_1081096_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.5e-19
WP_008320415.1|1081181_1081880_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_071681874.1|1081956_1082190_-	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	80.3	6.6e-22
WP_003840850.1|1082268_1082511_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|1082685_1083195_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_003841892.1|1083333_1084584_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
>prophage 83
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1088693	1123156	4976908	holin,tRNA,transposase	Escherichia_phage(17.65%)	46	NA	NA
WP_032949068.1|1088693_1090064_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	4.7e-107
WP_044702837.1|1090500_1091169_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.3e-81
WP_044702835.1|1091473_1091710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042922208.1|1093149_1094688_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_042922210.1|1094737_1095085_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922212.1|1095084_1095462_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_044703081.1|1095625_1095829_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	62.9	2.0e-06
WP_087451024.1|1096738_1097858_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_044702995.1|1098120_1098645_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	96.0	4.9e-89
WP_044702996.1|1098836_1099073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080941989.1|1099142_1099436_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.9	1.4e-21
WP_047715857.1|1099623_1099893_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.3	9.0e-23
WP_044703002.1|1099900_1100518_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	72.2	4.4e-81
WP_046155109.1|1100517_1100799_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	88.2	5.5e-39
WP_008323296.1|1100785_1101181_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
WP_044703006.1|1101280_1101859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047715860.1|1102455_1103034_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-47
WP_047715863.1|1103048_1104038_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	71.7	1.1e-142
WP_080964714.1|1104034_1104760_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	54.0	2.0e-56
WP_047715865.1|1104776_1105166_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	66.7	7.9e-44
WP_047715867.1|1105162_1105483_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	57.7	2.2e-28
WP_047715870.1|1105484_1105703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047715872.1|1105689_1106358_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.1	9.9e-95
WP_047715874.1|1106357_1106801_-	hypothetical protein	NA	U5P0U0	Shigella_phage	31.1	4.8e-13
WP_047715876.1|1106803_1107787_-	hypothetical protein	NA	S5FM81	Shigella_phage	71.9	2.6e-59
WP_047715878.1|1108119_1108674_-	hypothetical protein	NA	U5P4K1	Shigella_phage	51.9	2.2e-47
WP_047715881.1|1108702_1108954_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	52.2	2.7e-13
WP_165919942.1|1109033_1109741_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	55.8	2.4e-75
WP_047715886.1|1109757_1110192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047715889.1|1110191_1110542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047715892.1|1110580_1110787_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	7.4e-17
WP_047715894.1|1111956_1112784_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	84.4	6.9e-122
WP_052941164.1|1112780_1113272_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	40.5	4.7e-09
WP_047715896.1|1113268_1113760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052941163.1|1113756_1114173_+	hypothetical protein	NA	A0A125RNQ8	Pseudomonas_phage	31.1	6.3e-07
WP_047715899.1|1114174_1114597_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.0	2.5e-67
WP_047715901.1|1114593_1115028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034696.1|1115067_1115304_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	92.3	2.1e-39
WP_047715903.1|1115362_1116676_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	89.9	3.9e-236
WP_044701478.1|1116654_1117428_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	1.0e-55
WP_003034689.1|1117480_1117876_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_003034686.1|1117916_1118660_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003839177.1|1118656_1119625_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_044701481.1|1119868_1120615_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003034677.1|1120617_1121184_-	VOC family protein	NA	NA	NA	NA	NA
WP_003034673.1|1121422_1123156_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
>prophage 84
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1131169	1142164	4976908		Bacillus_thuringiensis_phage(40.0%)	7	NA	NA
WP_003034656.1|1131169_1131559_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_044701490.1|1131576_1132626_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_003034649.1|1132622_1133495_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_044701491.1|1133514_1135116_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
WP_003833879.1|1135159_1136815_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.6e-08
WP_044701493.1|1137221_1138493_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_044701495.1|1138603_1142164_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	25.4	1.8e-30
>prophage 85
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1152557	1154072	4976908		Cedratvirus(100.0%)	1	NA	NA
WP_044701499.1|1152557_1154072_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.7	1.3e-12
>prophage 86
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1172678	1173431	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|1172678_1173431_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 87
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1200148	1204404	4976908		Burkholderia_phage(50.0%)	4	NA	NA
WP_003839067.1|1200148_1200616_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	8.9e-34
WP_032933152.1|1200596_1202027_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.2	4.3e-103
WP_003839062.1|1202103_1202796_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.1	8.0e-07
WP_032936822.1|1203237_1204404_+	porin	NA	Q1MVN1	Enterobacteria_phage	57.0	1.9e-109
>prophage 88
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1209477	1210161	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_003844224.1|1209477_1210161_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.0e-27
>prophage 89
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1215130	1215946	4976908		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_003839037.1|1215130_1215946_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 90
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1229440	1230250	4976908		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003030258.1|1229440_1230250_-	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 91
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1249907	1252562	4976908		Stx2-converting_phage(50.0%)	3	NA	NA
WP_044701552.1|1249907_1251080_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.4	3.4e-199
WP_044701554.1|1251219_1251987_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_003844270.1|1251983_1252562_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
>prophage 92
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1262583	1263483	4976908		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003030161.1|1262583_1263483_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 93
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1271066	1278691	4976908		Enterobacteria_phage(42.86%)	7	NA	NA
WP_044701936.1|1271066_1272071_+	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	32.2	1.9e-17
WP_044701934.1|1272129_1273296_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	1.5e-114
WP_032936740.1|1273494_1274901_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.4e-37
WP_044701931.1|1275233_1276106_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	1.7e-107
WP_044701929.1|1276144_1277044_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	3.0e-30
WP_003844298.1|1277043_1278132_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.0	4.1e-98
WP_003844299.1|1278148_1278691_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.7	3.3e-56
>prophage 94
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1285575	1288029	4976908		Bacillus_phage(50.0%)	2	NA	NA
WP_003844310.1|1285575_1286469_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.7	3.6e-44
WP_044701921.1|1286634_1288029_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.6	4.0e-21
>prophage 95
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1293490	1300228	4976908		Bacillus_phage(25.0%)	6	NA	NA
WP_044701918.1|1293490_1294861_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.3	5.4e-31
WP_044701916.1|1294997_1296434_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.5	5.9e-52
WP_044701914.1|1296436_1297660_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_044701913.1|1297656_1298136_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_003841801.1|1298138_1299104_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.6	6.9e-89
WP_003036748.1|1299106_1300228_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	2.4e-133
>prophage 96
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1303974	1314613	4976908		Streptococcus_virus(20.0%)	9	NA	NA
WP_003844327.1|1303974_1304463_-	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	1.2e-09
WP_003841790.1|1304465_1305308_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_044701908.1|1305380_1307543_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	2.9e-18
WP_003036763.1|1307539_1307989_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_003036765.1|1307994_1309134_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_044701906.1|1309790_1311374_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.3e-38
WP_044701904.1|1311418_1313272_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_003036774.1|1313298_1313880_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	3.2e-33
WP_003841777.1|1313971_1314613_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 97
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1319231	1320584	4976908		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_044701901.1|1319231_1320584_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.5	3.9e-05
>prophage 98
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1325391	1385295	4976908	capsid,transposase,integrase,protease,tRNA	Bacillus_phage(14.29%)	55	1369995:1370042	1385379:1385426
WP_044701897.1|1325391_1328472_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.7	3.4e-65
WP_003036790.1|1328468_1329881_+	MFS transporter	NA	NA	NA	NA	NA
WP_003844344.1|1329880_1331284_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
WP_003036797.1|1331280_1332003_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003841759.1|1332138_1332471_+	YegP family protein	NA	NA	NA	NA	NA
WP_044701894.1|1332630_1333992_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	5.3e-204
WP_003036804.1|1334261_1336538_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003036810.1|1336568_1336889_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036813.1|1337212_1337437_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003840216.1|1337511_1339458_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
WP_016150621.1|1339454_1340570_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_016150622.1|1340729_1341677_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_003036822.1|1341673_1343332_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_003840208.1|1343703_1344399_+	aquaporin Z	NA	NA	NA	NA	NA
WP_044701893.1|1344543_1345443_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_044701892.1|1345598_1347251_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_003027256.1|1347261_1348230_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_044701891.1|1348429_1350043_+	FAD-NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_044701888.1|1350118_1350553_-	DoxX family protein	NA	NA	NA	NA	NA
WP_003027264.1|1350705_1352424_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	8.9e-31
WP_044701886.1|1352460_1353462_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_044701955.1|1353472_1354903_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003840192.1|1355000_1356014_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044701884.1|1356119_1356950_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_001160725.1|1356946_1357270_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044701881.1|1357396_1357912_+	lipoprotein	NA	NA	NA	NA	NA
WP_003027295.1|1358137_1358866_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
WP_044701878.1|1358882_1359614_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003027301.1|1359620_1360337_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_003840185.1|1360336_1361005_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_003834417.1|1361266_1361998_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003027310.1|1362129_1363029_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	2.8e-12
WP_003027312.1|1363051_1364104_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003027315.1|1364356_1365634_+	MFS transporter	NA	NA	NA	NA	NA
WP_044701877.1|1365630_1366635_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	4.1e-12
WP_044701874.1|1366631_1367597_+	sugar kinase	NA	NA	NA	NA	NA
WP_003027325.1|1367570_1368317_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044701870.1|1368359_1369160_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_044701867.1|1369162_1369945_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
1369995:1370042	attL	CCCTACGCTGGCATTATCCAGATCAGGTGGTACGGGTATTTCTCAGCC	NA	NA	NA	NA
WP_044701866.1|1370439_1370682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044701865.1|1370707_1371382_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	76.1	6.3e-73
WP_100216202.1|1372047_1373215_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_044702135.1|1374859_1375891_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_044702134.1|1375907_1376270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702132.1|1376266_1376491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702129.1|1377218_1377557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080942041.1|1377549_1377813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702126.1|1378060_1378342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702123.1|1378350_1378797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838206.1|1379548_1379725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702121.1|1381551_1382112_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044702119.1|1382117_1382306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702117.1|1382371_1383187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127791446.1|1383193_1383910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702114.1|1383993_1385295_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1385379:1385426	attR	CCCTACGCTGGCATTATCCAGATCAGGTGGTACGGGTATTTCTCAGCC	NA	NA	NA	NA
>prophage 99
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1392979	1401398	4976908	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_003844377.1|1392979_1395013_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
WP_003840158.1|1395219_1395678_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
WP_003027346.1|1395720_1396191_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003840155.1|1396237_1396957_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027348.1|1396953_1398639_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003844381.1|1398864_1399596_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027354.1|1399647_1399755_+	protein YohO	NA	NA	NA	NA	NA
WP_032936682.1|1399735_1400467_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044702103.1|1400450_1401398_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	2.2e-07
>prophage 100
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1412163	1412898	4976908		Streptococcus_phage(100.0%)	1	NA	NA
WP_016150648.1|1412163_1412898_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.4	7.1e-54
>prophage 101
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1427279	1428800	4976908		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027396.1|1427279_1428800_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 102
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1432504	1433173	4976908		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003027410.1|1432504_1433173_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
>prophage 103
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1438873	1440859	4976908		Acinetobacter_phage(100.0%)	1	NA	NA
WP_044702069.1|1438873_1440859_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
>prophage 104
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1444769	1445627	4976908		Catovirus(100.0%)	1	NA	NA
WP_003027428.1|1444769_1445627_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	4.4e-23
>prophage 105
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1459313	1461230	4976908		Burkholderia_virus(100.0%)	1	NA	NA
WP_032936654.1|1459313_1461230_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	29.9	9.0e-32
>prophage 106
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1470030	1472343	4976908	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_042922212.1|1470030_1470408_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_042922210.1|1470407_1470755_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922208.1|1470804_1472343_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
>prophage 107
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1484260	1488564	4976908		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_044701134.1|1484260_1485727_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.2e-39
WP_044701137.1|1485846_1486833_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_003840063.1|1486867_1487581_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003027474.1|1487994_1488564_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
>prophage 108
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1494330	1506524	4976908		Vibrio_phage(28.57%)	12	NA	NA
WP_044701144.1|1494330_1495920_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.8	3.6e-18
WP_085951589.1|1495923_1496268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003027494.1|1496601_1497792_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.4	1.4e-19
WP_003027496.1|1497807_1498515_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_044701147.1|1498665_1500426_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	9.3e-100
WP_003027502.1|1500550_1500835_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_003027504.1|1500955_1501963_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
WP_003027506.1|1502097_1502325_+	YejL family protein	NA	NA	NA	NA	NA
WP_016150675.1|1502356_1504117_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_032936622.1|1504469_1504691_-	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	74.0	2.3e-24
WP_044701152.1|1504939_1505182_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	1.1e-27
WP_044701153.1|1505666_1506524_+	protein YibB	NA	A0A292GL11	Xanthomonas_phage	23.0	1.1e-08
>prophage 109
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1514516	1515137	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_003027545.1|1514516_1515137_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	24.5	1.4e-10
>prophage 110
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1523937	1532486	4976908		uncultured_Caudovirales_phage(20.0%)	7	NA	NA
WP_044701223.1|1523937_1525185_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.0	8.0e-82
WP_003027576.1|1525147_1526584_-	magnesium transporter	NA	NA	NA	NA	NA
WP_003027580.1|1526689_1528333_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	2.8e-10
WP_003027582.1|1528408_1529059_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
WP_044701164.1|1529058_1530123_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	1.1e-18
WP_044701165.1|1530202_1531255_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_003027588.1|1531370_1532486_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.4	8.4e-115
>prophage 111
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1536673	1548675	4976908		Pseudomonas_phage(33.33%)	7	NA	NA
WP_044701167.1|1536673_1539520_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.8	4.1e-41
WP_044701169.1|1539641_1542278_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	2.8e-92
WP_003027601.1|1542436_1543165_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_003027604.1|1543653_1545939_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	6.0e-285
WP_003027605.1|1546049_1547180_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.3e-174
WP_003027609.1|1547179_1547434_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_003839410.1|1547607_1548675_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
>prophage 112
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1557776	1561881	4976908		Tupanvirus(66.67%)	3	NA	NA
WP_003027645.1|1557776_1558916_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.0	1.3e-30
WP_003027648.1|1558918_1559902_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.5	9.9e-35
WP_044701174.1|1559898_1561881_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.5	6.3e-20
>prophage 113
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1574562	1575567	4976908		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003839364.1|1574562_1575567_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.7	1.4e-28
>prophage 114
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1594484	1595084	4976908		Salmonella_phage(100.0%)	1	NA	NA
WP_044701194.1|1594484_1595084_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	3.1e-07
>prophage 115
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1608921	1609695	4976908		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003839331.1|1608921_1609695_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	3.6e-08
>prophage 116
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1614050	1615568	4976908		Mollivirus(100.0%)	1	NA	NA
WP_003028127.1|1614050_1615568_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 117
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1622065	1623202	4976908		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003028146.1|1622065_1623202_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.3	8.8e-19
>prophage 118
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1631682	1632768	4976908		Pandoravirus(100.0%)	1	NA	NA
WP_044701213.1|1631682_1632768_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.7	1.0e-88
>prophage 119
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1641906	1645724	4976908		Enterobacteria_phage(50.0%)	3	NA	NA
WP_003839292.1|1641906_1642848_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.3	7.5e-149
WP_044701716.1|1643021_1643651_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_044701718.1|1643825_1645724_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	4.9e-14
>prophage 120
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1653781	1654702	4976908		Morganella_phage(100.0%)	1	NA	NA
WP_003839269.1|1653781_1654702_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	5.4e-75
>prophage 121
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1659179	1659914	4976908		Clostridioides_phage(100.0%)	1	NA	NA
WP_032936528.1|1659179_1659914_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.6e-13
>prophage 122
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1684626	1694493	4976908		Lactobacillus_phage(25.0%)	9	NA	NA
WP_003838572.1|1684626_1685553_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	5.2e-09
WP_003038103.1|1685642_1686641_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003038102.1|1686637_1686856_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_044701746.1|1686857_1688873_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	4.2e-149
WP_003038097.1|1688944_1689952_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_003838567.1|1690182_1690944_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_003038091.1|1691107_1692079_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_003038086.1|1692462_1692720_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_044701750.1|1692765_1694493_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 123
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1698476	1708011	4976908		Streptococcus_phage(20.0%)	11	NA	NA
WP_003838552.1|1698476_1699388_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.8	4.8e-60
WP_003847288.1|1699507_1700605_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	6.3e-30
WP_003038064.1|1700594_1701470_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_003038061.1|1701469_1702303_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003038059.1|1702303_1703320_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_003038057.1|1703476_1704268_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	6.8e-18
WP_003838547.1|1704439_1705339_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_016150735.1|1705432_1706008_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_003038050.1|1706067_1706517_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_003038048.1|1706503_1706929_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_003038046.1|1707141_1708011_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
>prophage 124
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1743875	1744589	4976908		Synechococcus_phage(100.0%)	1	NA	NA
WP_003037964.1|1743875_1744589_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	2.0e-37
>prophage 125
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1754503	1760101	4976908		Enterobacteria_phage(33.33%)	5	NA	NA
WP_003037932.1|1754503_1755793_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	1.7e-63
WP_003037929.1|1755889_1756516_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044701787.1|1756699_1758130_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003838485.1|1758425_1759463_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	6.3e-72
WP_044701788.1|1759459_1760101_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
>prophage 126
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1766528	1766732	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_049002457.1|1766528_1766732_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	5.6e-17
>prophage 127
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1771647	1777929	4976908	transposase	Shigella_phage(33.33%)	4	NA	NA
WP_100216202.1|1771647_1772815_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_003037760.1|1773293_1774871_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_003037756.1|1774934_1776401_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
WP_016150751.1|1776561_1777929_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	3.4e-41
>prophage 128
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1789233	1790775	4976908		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003037736.1|1789233_1790775_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	2.4e-160
>prophage 129
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1799751	1800183	4976908		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|1799751_1800183_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 130
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1810027	1816382	4976908		Mycoplasma_phage(20.0%)	8	NA	NA
WP_044701997.1|1810027_1811311_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.4	7.6e-35
WP_003037694.1|1811372_1811573_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003037690.1|1811584_1811920_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003838439.1|1811921_1813772_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.4e-103
WP_003838436.1|1813787_1814303_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003037681.1|1814411_1814735_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	9.2e-22
WP_002913991.1|1814755_1815142_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_003037677.1|1815167_1816382_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
>prophage 131
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1822002	1823511	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_044701991.1|1822002_1823511_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	4.6e-15
>prophage 132
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1842802	1854127	4976908		Bacillus_phage(50.0%)	7	NA	NA
WP_003037627.1|1842802_1844056_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.9e-100
WP_044701974.1|1844382_1845573_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|1845674_1846013_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003838398.1|1846073_1847411_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_044701971.1|1847407_1848151_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_003847077.1|1848173_1849604_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	2.0e-12
WP_044701969.1|1850239_1854127_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	5.0e-130
>prophage 133
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1860428	1867338	4976908		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_003037590.1|1860428_1860689_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
WP_003037588.1|1860817_1861198_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_016150781.1|1861197_1861929_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_044701965.1|1861940_1862669_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003037581.1|1862696_1863602_-	GTPase Era	NA	NA	NA	NA	NA
WP_003037579.1|1863598_1864279_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
WP_003838377.1|1864548_1865523_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003037577.1|1865538_1867338_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
>prophage 134
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1873182	1878759	4976908	tRNA	Cafeteria_roenbergensis_virus(25.0%)	5	NA	NA
WP_003037569.1|1873182_1874511_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
WP_003037563.1|1875628_1876012_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_003037561.1|1876329_1877019_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	7.9e-55
WP_003838362.1|1877052_1878132_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003037559.1|1878339_1878759_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
>prophage 135
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1884058	1885357	4976908		Burkholderia_virus(100.0%)	1	NA	NA
WP_016150786.1|1884058_1885357_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	3.1e-44
>prophage 136
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1891195	1893769	4976908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003031249.1|1891195_1893769_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
>prophage 137
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1899723	1903279	4976908		Escherichia_coli_O157_typing_phage(50.0%)	4	NA	NA
WP_044699552.1|1899723_1900794_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	3.4e-89
WP_003845849.1|1901008_1901383_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003839843.1|1901541_1902060_+	YfiR family protein	NA	NA	NA	NA	NA
WP_032937960.1|1902052_1903279_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
>prophage 138
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1914613	1915096	4976908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003031211.1|1914613_1915096_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
>prophage 139
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1928387	1944622	4976908	integrase	Enterobacteria_phage(72.73%)	16	1913333:1913347	1934121:1934135
1913333:1913347	attL	AAATCACTATGCGCT	NA	NA	NA	NA
WP_044699566.1|1928387_1930574_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	7.1e-17
WP_085951585.1|1930581_1931745_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016242323.1|1932365_1933565_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	5.3e-107
WP_044699570.1|1933576_1934995_-	hypothetical protein	NA	NA	NA	NA	NA
1934121:1934135	attR	AAATCACTATGCGCT	NA	NA	NA	NA
WP_044699572.1|1935635_1936211_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	50.8	1.1e-38
WP_000984214.1|1936227_1936470_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_047715917.1|1936466_1937270_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	25.2	9.6e-12
WP_016242327.1|1937821_1938088_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	2.8e-24
WP_047715918.1|1938084_1938684_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	77.4	2.8e-48
WP_044699579.1|1938676_1938976_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	67.7	7.7e-31
WP_044699580.1|1938968_1939418_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.1e-44
WP_024173160.1|1939522_1939750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743156.1|1939746_1940067_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_044699583.1|1940078_1942412_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
WP_044699584.1|1943024_1944230_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_071681355.1|1944403_1944622_-	hypothetical protein	NA	G8C7R9	Escherichia_phage	69.1	1.2e-20
>prophage 140
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1950080	1954436	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_046155102.1|1950080_1954436_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.0	6.8e-136
>prophage 141
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1960481	1966305	4976908		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003839789.1|1960481_1962029_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	8.6e-09
WP_032949851.1|1962080_1963010_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044699607.1|1963048_1964035_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_044699610.1|1964379_1966305_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.1	1.3e-25
>prophage 142
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1976500	1979743	4976908		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_044699619.1|1976500_1979743_-	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.3	1.2e-33
>prophage 143
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	1991122	1996343	4976908		Tupanvirus(50.0%)	5	NA	NA
WP_044699629.1|1991122_1992139_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.2	3.6e-80
WP_044699632.1|1992185_1993577_-	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_032938074.1|1993607_1994015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032938077.1|1994017_1995130_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_044699634.1|1995131_1996343_-	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	31.6	1.3e-12
>prophage 144
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2022866	2023580	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_003037218.1|2022866_2023580_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	3.1e-14
>prophage 145
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2027578	2031585	4976908		Klosneuvirus(50.0%)	4	NA	NA
WP_044699659.1|2027578_2028862_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.4e-28
WP_003037233.1|2028990_2030391_+	GABA permease	NA	NA	NA	NA	NA
WP_003037236.1|2030436_2031123_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_003037241.1|2031135_2031585_-	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
>prophage 146
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2037346	2042643	4976908		Lactobacillus_phage(20.0%)	5	NA	NA
WP_003037270.1|2037346_2037592_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.5	3.8e-12
WP_003037273.1|2037588_2037999_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	6.6e-17
WP_044699668.1|2037971_2040116_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	7.6e-197
WP_016150870.1|2040126_2041086_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	5.0e-132
WP_003037282.1|2041440_2042643_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
>prophage 147
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2057148	2062569	4976908	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2057148_2057334_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_003037323.1|2057571_2060199_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	8.4e-81
WP_003037326.1|2060327_2060828_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003037330.1|2060914_2061979_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_003037333.1|2062071_2062569_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
>prophage 148
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2068129	2069095	4976908		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003037353.1|2068129_2069095_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 149
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2096921	2103259	4976908	holin	Pithovirus(33.33%)	6	NA	NA
WP_003840297.1|2096921_2097737_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	W5SAS9	Pithovirus	28.1	1.2e-12
WP_044699710.1|2097739_2098597_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_044699713.1|2098593_2099445_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_044699716.1|2100190_2100541_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_008322725.1|2100537_2100867_+	multidrug efflux SMR transporter	NA	E5EPE2	Acinetobacter_phage	33.0	4.2e-06
WP_044699720.1|2100880_2103259_+|holin	choline trimethylamine-lyase	holin	A0A2C9CWX5	Yersinia_phage	37.5	8.1e-06
>prophage 150
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2111834	2114396	4976908		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_044699723.1|2111834_2114396_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	3.2e-32
>prophage 151
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2117870	2121574	4976908		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081498.1|2117870_2118863_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_003840324.1|2118925_2120053_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
WP_003034172.1|2120192_2120819_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_044699730.1|2120812_2121574_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	1.9e-57
>prophage 152
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2124747	2126780	4976908		Tupanvirus(50.0%)	2	NA	NA
WP_003034157.1|2124747_2125353_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.9	6.1e-27
WP_003840331.1|2125352_2126780_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.8	7.9e-33
>prophage 153
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2134129	2134801	4976908		Vibrio_phage(100.0%)	1	NA	NA
WP_003034139.1|2134129_2134801_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 154
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2138163	2141187	4976908		Streptococcus_phage(50.0%)	2	NA	NA
WP_003034129.1|2138163_2139462_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
WP_003034127.1|2139549_2141187_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
>prophage 155
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2144661	2152743	4976908		Erysipelothrix_phage(25.0%)	5	NA	NA
WP_032949930.1|2144661_2145960_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	4.1e-36
WP_044699738.1|2146017_2148774_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	1.0e-52
WP_044699741.1|2148817_2149960_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	2.4e-48
WP_003034111.1|2150041_2151382_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_044699743.1|2151402_2152743_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	23.9	1.6e-06
>prophage 156
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2157268	2158117	4976908		Vibrio_phage(100.0%)	1	NA	NA
WP_003034084.1|2157268_2158117_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.3	1.8e-40
>prophage 157
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2163032	2163788	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_003840372.1|2163032_2163788_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	8.8e-07
>prophage 158
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2170539	2172039	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_003034052.1|2170539_2172039_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	4.6e-15
>prophage 159
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2180273	2182809	4976908	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_044699753.1|2180273_2181479_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.2	3.6e-71
WP_003840390.1|2181478_2181925_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_003846496.1|2182002_2182809_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	2.2e-16
>prophage 160
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2193228	2204427	4976908		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
WP_032937467.1|2193228_2194482_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
WP_003034012.1|2194715_2196047_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_032937466.1|2196174_2198004_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	34.4	1.9e-18
WP_044699761.1|2198000_2201546_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.1	3.4e-08
WP_044699762.1|2201538_2204427_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.9	4.5e-67
>prophage 161
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2209907	2216730	4976908		Cronobacter_phage(33.33%)	6	NA	NA
WP_044699772.1|2209907_2210702_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	61.7	5.4e-116
WP_003846461.1|2210708_2211584_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003033984.1|2211772_2214019_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
WP_003033982.1|2214031_2214562_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003840955.1|2215246_2215942_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_003033961.1|2216016_2216730_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	5.3e-46
>prophage 162
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2223306	2224317	4976908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003846454.1|2223306_2224317_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.4	5.6e-33
>prophage 163
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2228078	2231516	4976908	transposase	Sodalis_phage(33.33%)	3	NA	NA
WP_044699781.1|2228078_2228966_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.8	4.7e-68
WP_003033926.1|2229021_2230440_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.7	5.1e-24
WP_003033923.1|2230754_2231516_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
>prophage 164
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2246816	2247422	4976908		Canarypox_virus(100.0%)	1	NA	NA
WP_003033877.1|2246816_2247422_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.9	3.2e-07
>prophage 165
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2259395	2261267	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_044699790.1|2259395_2261267_-	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	29.5	1.1e-53
>prophage 166
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2264483	2265603	4976908	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087451024.1|2264483_2265603_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 167
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2269425	2280423	4976908	tRNA,integrase	Bacillus_phage(28.57%)	13	2266997:2267010	2270582:2270595
2266997:2267010	attL	TCTTCCTTTTTCAA	NA	NA	NA	NA
WP_044700788.1|2269425_2270004_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	26.3	5.0e-10
WP_044700790.1|2270097_2270295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003838329.1|2270291_2270585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700792.1|2270660_2270930_+	hypothetical protein	NA	NA	NA	NA	NA
2270582:2270595	attR	TTGAAAAAGGAAGA	NA	NA	NA	NA
WP_044700793.1|2270992_2271490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080528468.1|2271513_2272080_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	69.4	8.0e-05
WP_016150941.1|2272776_2273535_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_032948043.1|2273701_2274256_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003026911.1|2274333_2275851_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_096878465.1|2275860_2276959_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_044700800.1|2277050_2278784_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	7.5e-62
WP_003026923.1|2278789_2279503_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_003026928.1|2279526_2280423_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
>prophage 168
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2285122	2290329	4976908		Pandoravirus(50.0%)	3	NA	NA
WP_044700805.1|2285122_2286556_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	4.8e-30
WP_032937431.1|2286650_2287394_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_044700806.1|2287455_2290329_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	2.6e-261
>prophage 169
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2298585	2299818	4976908		Catovirus(100.0%)	1	NA	NA
WP_003026984.1|2298585_2299818_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 170
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2317328	2317979	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_044700836.1|2317328_2317979_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	23.9	5.6e-10
>prophage 171
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2325092	2328041	4976908		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003027071.1|2325092_2326247_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
WP_003027074.1|2326646_2328041_+	galactose/proton symporter	NA	O13311	Aichi_virus	25.5	1.4e-26
>prophage 172
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2341407	2342493	4976908		Geobacillus_virus(100.0%)	1	NA	NA
WP_049001609.1|2341407_2342493_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
>prophage 173
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2360219	2361860	4976908		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_044700857.1|2360219_2361860_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	7.5e-11
>prophage 174
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2371559	2376805	4976908		Staphylococcus_phage(33.33%)	4	NA	NA
WP_003024520.1|2371559_2372387_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	1.1e-63
WP_016150982.1|2372575_2374030_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003024529.1|2374074_2374530_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	34.7	2.1e-19
WP_003024532.1|2374633_2376805_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
>prophage 175
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2380913	2383689	4976908		Bacillus_virus(50.0%)	2	NA	NA
WP_047715920.1|2380913_2383172_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	7.5e-86
WP_003024544.1|2383290_2383689_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
>prophage 176
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2392324	2400409	4976908		Bacillus_virus(25.0%)	8	NA	NA
WP_003024571.1|2392324_2394217_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
WP_003846314.1|2394245_2394827_-	esterase YqiA	NA	NA	NA	NA	NA
WP_003838143.1|2394826_2395654_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_003024582.1|2395678_2396101_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_047715921.1|2396097_2396730_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.7	5.2e-21
WP_085951568.1|2396929_2398408_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_003024591.1|2398565_2399243_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.0	2.6e-34
WP_003024594.1|2399248_2400409_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	5.0e-86
>prophage 177
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2406100	2406754	4976908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003838130.1|2406100_2406754_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.1e-45
>prophage 178
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2410351	2411785	4976908		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_044700899.1|2410351_2411785_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	1.3e-38
>prophage 179
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2417035	2418277	4976908		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_016150993.1|2417035_2418277_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.3	1.8e-94
>prophage 180
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2429668	2448098	4976908	tRNA	Moraxella_phage(14.29%)	20	NA	NA
WP_003024694.1|2429668_2430682_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
WP_001144069.1|2430918_2431134_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003024697.1|2431368_2433114_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_003024699.1|2433473_2435321_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_044700921.1|2435481_2436531_+	YncE family protein	NA	NA	NA	NA	NA
WP_003846276.1|2436541_2438539_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
WP_044700923.1|2438569_2439076_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_047715922.1|2439438_2439780_-	toxin	NA	NA	NA	NA	NA
WP_032666156.1|2439800_2440103_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_047715924.1|2440136_2440358_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_047715925.1|2440366_2440843_-	RadC family protein	NA	NA	NA	NA	NA
WP_032666161.1|2440858_2441317_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	36.2	7.7e-14
WP_032666162.1|2441419_2441659_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032666163.1|2441735_2442203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032666164.1|2442226_2442670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144029.1|2442669_2442906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032666165.1|2442946_2443648_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_032666166.1|2443864_2444686_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.3	3.0e-45
WP_032666167.1|2444777_2445641_-	GTPase family protein	NA	NA	NA	NA	NA
WP_032666168.1|2445959_2448098_+	DNA methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	26.0	2.9e-15
>prophage 181
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2457286	2458603	4976908	integrase	Klebsiella_phage(100.0%)	1	2456556:2456569	2459874:2459887
2456556:2456569	attL	TCTACCGCGCCGTT	NA	NA	NA	NA
WP_042998205.1|2457286_2458603_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	3.5e-35
WP_042998205.1|2457286_2458603_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	3.5e-35
2459874:2459887	attR	TCTACCGCGCCGTT	NA	NA	NA	NA
>prophage 182
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2472329	2484376	4976908	tRNA	Tupanvirus(25.0%)	9	NA	NA
WP_003846231.1|2472329_2473484_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	1.6e-84
WP_003024755.1|2473551_2474400_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016151014.1|2474396_2475179_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_164845042.1|2475415_2476093_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047715928.1|2476146_2477667_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.0	2.2e-33
WP_168150126.1|2478097_2479477_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	2.6e-33
WP_003024768.1|2479550_2479883_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_003024771.1|2480092_2481076_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_044700936.1|2481283_2484376_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	7.7e-158
>prophage 183
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2495397	2496366	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_044700964.1|2495397_2496366_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	7.7e-32
>prophage 184
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2516890	2519185	4976908		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003024871.1|2516890_2519185_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	5.3e-156
>prophage 185
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2525776	2539012	4976908	transposase	Stx2-converting_phage(42.86%)	11	NA	NA
WP_042922212.1|2525776_2526154_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_042922210.1|2526153_2526501_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922208.1|2526550_2528089_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_032219323.1|2528230_2528770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071845176.1|2528936_2529362_-	phase 1 flagellin transcriptional repressor	NA	NA	NA	NA	NA
WP_087451024.1|2529454_2530574_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000079831.1|2530755_2532027_-	flagellin FliC	NA	NA	NA	NA	NA
WP_047715930.1|2532468_2533047_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.7	8.4e-18
WP_044701292.1|2533353_2534052_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_148116659.1|2535004_2536232_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	3.5e-146
WP_044701293.1|2537866_2539012_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.2	7.0e-48
>prophage 186
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2547578	2548685	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_044701301.1|2547578_2548685_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	29.6	7.0e-13
>prophage 187
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2560538	2566627	4976908		Streptococcus_phage(33.33%)	8	NA	NA
WP_003024942.1|2560538_2561402_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
WP_044701309.1|2561465_2563517_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_003024946.1|2563474_2563870_+	YraN family protein	NA	NA	NA	NA	NA
WP_003024948.1|2563904_2564495_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_044701311.1|2564504_2565080_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003024957.1|2565173_2565809_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003839984.1|2565846_2566275_-	YhbP family protein	NA	NA	NA	NA	NA
WP_047715931.1|2566327_2566627_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	50.0	3.2e-13
>prophage 188
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2572293	2574222	4976908		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_016151048.1|2572293_2574222_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 189
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2579812	2586457	4976908		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_003844847.1|2579812_2582503_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	2.5e-24
WP_003024992.1|2582527_2584015_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003024996.1|2584043_2584496_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003024998.1|2585113_2586457_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
>prophage 190
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2592282	2595164	4976908	protease	Pandoravirus(50.0%)	2	NA	NA
WP_003025010.1|2592282_2593131_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.2	1.3e-19
WP_003025013.1|2593229_2595164_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
>prophage 191
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2601857	2603337	4976908		Indivirus(50.0%)	2	NA	NA
WP_003025033.1|2601857_2602829_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
WP_003839952.1|2603052_2603337_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
>prophage 192
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2607441	2621568	4976908		Staphylococcus_phage(25.0%)	16	NA	NA
WP_003025057.1|2607441_2608242_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	9.6e-20
WP_003839941.1|2608457_2609435_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_044701326.1|2609448_2610435_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	6.7e-39
WP_044701327.1|2610455_2611022_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	2.5e-54
WP_003025068.1|2611018_2611594_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025070.1|2611562_2612111_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025073.1|2612117_2612843_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025074.1|2612889_2614323_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025078.1|2614345_2614633_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025083.1|2614716_2615208_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_044701328.1|2615253_2616108_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025086.1|2616104_2616377_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003025087.1|2616507_2617227_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003839926.1|2617223_2617877_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_003025089.1|2618106_2620443_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.8	4.9e-40
WP_003839924.1|2620638_2621568_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	6.7e-17
>prophage 193
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2628343	2629426	4976908		Salmonella_phage(100.0%)	1	NA	NA
WP_044701329.1|2628343_2629426_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	89.3	1.8e-74
>prophage 194
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2633588	2635079	4976908		Burkholderia_virus(100.0%)	1	NA	NA
WP_044701332.1|2633588_2635079_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	2.4e-08
>prophage 195
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2638919	2688064	4976908	tRNA,protease,integrase,transposase	uncultured_Caudovirales_phage(50.0%)	49	2676013:2676037	2686922:2686946
WP_003025130.1|2638919_2639423_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
WP_003025132.1|2639428_2640067_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003025138.1|2640383_2640776_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003025141.1|2640791_2641220_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_044701335.1|2641438_2642566_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003025147.1|2642758_2643157_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_044701337.1|2643325_2644693_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	1.5e-20
WP_003025154.1|2644782_2645850_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_003025158.1|2645906_2646842_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003025162.1|2647278_2647749_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003025165.1|2648125_2648392_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_003025168.1|2648449_2648728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003025171.1|2648847_2650815_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003025174.1|2650820_2651753_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003025177.1|2651760_2651964_-	AaeX family protein	NA	NA	NA	NA	NA
WP_003839896.1|2652148_2653078_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_044701339.1|2653164_2654610_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_044701342.1|2654771_2658587_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003025190.1|2658698_2660168_-	ribonuclease G	NA	NA	NA	NA	NA
WP_003839891.1|2660157_2660751_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003025196.1|2660758_2661247_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003844819.1|2661247_2662270_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|2662336_2663380_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_153752135.1|2663357_2663678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044701343.1|2663686_2665627_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_016151069.1|2665852_2666827_+	oxidoreductase	NA	NA	NA	NA	NA
WP_044701347.1|2666946_2667951_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003839882.1|2667951_2668551_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_003025210.1|2668943_2669414_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003025213.1|2669424_2670774_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003025216.1|2670881_2671124_+	YhdT family protein	NA	NA	NA	NA	NA
WP_016151072.1|2671113_2672565_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_016151073.1|2672576_2673458_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_044701349.1|2673585_2674362_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003025224.1|2674660_2675626_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2675651_2675948_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
2676013:2676037	attL	AAACTGACTGCACCACTGACTGCAC	NA	NA	NA	NA
WP_100216202.1|2676254_2677422_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_044067013.1|2678756_2678951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047715934.1|2679102_2679816_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_047715935.1|2680011_2681385_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	67.7	6.4e-173
WP_047715937.1|2681381_2681750_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	89.3	1.7e-56
WP_024153894.1|2681746_2681971_-	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	75.9	2.3e-16
WP_047715939.1|2681963_2682236_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	76.7	6.1e-35
WP_047715942.1|2683418_2683619_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	83.3	2.7e-24
WP_131935741.1|2683713_2684148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|2684169_2685289_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_052941160.1|2685316_2685670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047715943.1|2685666_2686890_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	88.0	1.1e-219
WP_016151075.1|2687179_2688064_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	2.8e-28
2686922:2686946	attR	AAACTGACTGCACCACTGACTGCAC	NA	NA	NA	NA
>prophage 196
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2694670	2698826	4976908		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_044701355.1|2694670_2695696_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	5.3e-71
WP_044701356.1|2695765_2696947_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_044701358.1|2696956_2698060_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025300.1|2698067_2698826_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
>prophage 197
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2709277	2710749	4976908	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_003031159.1|2709277_2709787_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_003845229.1|2709801_2710749_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
>prophage 198
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2730648	2736220	4976908		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003031109.1|2730648_2731833_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003023659.1|2731902_2734017_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
WP_003023657.1|2734113_2734584_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023654.1|2734679_2735054_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003023651.1|2735179_2735467_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	39.2	2.4e-05
WP_003837966.1|2735474_2735834_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_003023646.1|2735833_2736220_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	6.7e-19
>prophage 199
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2741982	2747270	4976908		Tupanvirus(25.0%)	4	NA	NA
WP_044701446.1|2741982_2743884_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
WP_044701444.1|2743993_2745484_-	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	2.4e-141
WP_003023622.1|2745498_2746359_-	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	40.6	5.6e-50
WP_044701441.1|2746550_2747270_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.5	5.6e-19
>prophage 200
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2751005	2755055	4976908		environmental_Halophage(33.33%)	3	NA	NA
WP_003837947.1|2751005_2753093_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	89.9	4.2e-67
WP_003847953.1|2753188_2754406_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	9.7e-32
WP_003847954.1|2754491_2755055_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	6.0e-61
>prophage 201
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2774057	2774894	4976908		Vibrio_phage(100.0%)	1	NA	NA
WP_003023558.1|2774057_2774894_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 202
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2791856	2796399	4976908		Bacillus_phage(66.67%)	5	NA	NA
WP_044701411.1|2791856_2793479_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	3.1e-142
WP_003847996.1|2793601_2793919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003837894.1|2793971_2794268_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003837891.1|2794324_2795677_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	4.3e-12
WP_135953044.1|2795673_2796399_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 203
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2809666	2812060	4976908		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_044701404.1|2809666_2812060_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	3.6e-14
>prophage 204
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2819404	2821852	4976908		Dickeya_phage(100.0%)	1	NA	NA
WP_003023492.1|2819404_2821852_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 205
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2845809	2847620	4976908		Enterococcus_phage(50.0%)	2	NA	NA
WP_044701384.1|2845809_2846553_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	6.4e-10
WP_032950429.1|2846549_2847620_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	4.4e-20
>prophage 206
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2851399	2852898	4976908		Planktothrix_phage(50.0%)	2	NA	NA
WP_003827581.1|2851399_2852113_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.1	3.7e-15
WP_003023438.1|2852130_2852898_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
>prophage 207
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2858641	2861471	4976908		Salicola_phage(50.0%)	3	NA	NA
WP_003023425.1|2858641_2859496_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
WP_003837835.1|2859751_2860810_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003023420.1|2860802_2861471_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
>prophage 208
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2866805	2870878	4976908		Dickeya_phage(50.0%)	4	NA	NA
WP_003846172.1|2866805_2867432_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.3e-29
WP_044701374.1|2867506_2869705_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.4	2.3e-116
WP_003023404.1|2869798_2870044_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_044701371.1|2870212_2870878_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.4	2.8e-57
>prophage 209
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2875470	2879695	4976908		Burkholderia_phage(50.0%)	3	NA	NA
WP_003837806.1|2875470_2875746_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	3.2e-15
WP_003837801.1|2875823_2876948_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044701369.1|2876947_2879695_-	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	1.9e-19
>prophage 210
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2882721	2887966	4976908	transposase	Stx2-converting_phage(60.0%)	6	NA	NA
WP_042922208.1|2882721_2884260_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_042922210.1|2884309_2884657_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922212.1|2884656_2885034_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_000723069.1|2885236_2885671_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001211180.1|2885888_2887289_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|2887285_2887966_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 211
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2893060	2893798	4976908		Listeria_phage(100.0%)	1	NA	NA
WP_000287501.1|2893060_2893798_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 212
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2903694	2907023	4976908		Bacillus_phage(66.67%)	4	NA	NA
WP_044702707.1|2903694_2904375_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	1.0e-30
WP_000555736.1|2904367_2905849_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|2906093_2906525_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000647570.1|2906672_2907023_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
>prophage 213
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2926187	2928230	4976908		Indivirus(100.0%)	1	NA	NA
WP_044702794.1|2926187_2928230_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	9.9e-45
>prophage 214
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2959233	2961218	4976908		Bacillus_virus(50.0%)	2	NA	NA
WP_003024319.1|2959233_2960238_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	2.5e-17
WP_032950483.1|2960234_2961218_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.5e-14
>prophage 215
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2971024	2973358	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_044700390.1|2971024_2973358_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.7	3.7e-72
>prophage 216
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2978768	2981675	4976908		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_016151146.1|2978768_2979743_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.0	6.4e-18
WP_003837709.1|2979801_2980512_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003024273.1|2980892_2981183_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000014594.1|2981462_2981675_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 217
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	2986082	2987078	4976908		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_044700501.1|2986082_2987078_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.2	4.5e-11
>prophage 218
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3016853	3018698	4976908		Tupanvirus(100.0%)	1	NA	NA
WP_044700429.1|3016853_3018698_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	3.1e-13
>prophage 219
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3036000	3045372	4976908		Rhizobium_phage(20.0%)	9	NA	NA
WP_003844542.1|3036000_3036252_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_003024148.1|3036304_3036736_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_044700439.1|3036985_3038530_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003837638.1|3038539_3039823_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_003024138.1|3039826_3040762_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_044700441.1|3040762_3041800_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003024132.1|3041992_3043018_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_003837635.1|3043027_3044224_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	4.1e-35
WP_003827312.1|3044439_3045372_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
>prophage 220
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3050766	3051711	4976908		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_032937171.1|3050766_3051711_+	glycosyl transferase family 8	NA	A0ZYL4	Archaeal_BJ1_virus	26.3	2.9e-15
>prophage 221
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3057452	3062014	4976908		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_003024099.1|3057452_3057932_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
WP_003024097.1|3057970_3058780_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.1e-26
WP_003024094.1|3058878_3059046_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003024071.1|3059066_3059303_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003837605.1|3059521_3060187_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_088169059.1|3060357_3061578_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	7.2e-43
WP_006687626.1|3061555_3062014_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
>prophage 222
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3066095	3071123	4976908		Pseudomonas_phage(33.33%)	4	NA	NA
WP_044700505.1|3066095_3067775_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.4	6.0e-24
WP_003024042.1|3068036_3068660_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_000135058.1|3068714_3068990_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003024038.1|3069008_3071123_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 223
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3075383	3076775	4976908		environmental_Halophage(100.0%)	1	NA	NA
WP_003024026.1|3075383_3076775_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 224
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3091588	3094414	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_044700471.1|3091588_3094414_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	48.4	7.9e-101
>prophage 225
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3103105	3104044	4976908	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_044700477.1|3103105_3104044_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.2	1.3e-68
>prophage 226
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3126481	3131322	4976908		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
WP_016151213.1|3126481_3128170_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	2.2e-58
WP_003827118.1|3128277_3128376_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_003840643.1|3128897_3128987_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_032937131.1|3129110_3129944_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003023905.1|3130137_3131322_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.1	5.0e-17
>prophage 227
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3139442	3140377	4976908		Synechococcus_phage(100.0%)	2	NA	NA
WP_003840609.1|3139442_3139871_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.7e-13
WP_003023882.1|3139963_3140377_-	heat shock chaperone IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
>prophage 228
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3144435	3151944	4976908		Bacillus_virus(33.33%)	7	NA	NA
WP_003023868.1|3144435_3146850_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	1.8e-114
WP_003844434.1|3146878_3147952_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003023863.1|3148090_3149191_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
WP_003023861.1|3149195_3150599_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003023858.1|3151205_3151346_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003844432.1|3151363_3151723_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023846.1|3151686_3151944_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 229
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3158919	3169528	4976908		Moraxella_phage(20.0%)	9	NA	NA
WP_003840586.1|3158919_3160257_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	38.0	9.6e-65
WP_003840584.1|3160424_3161090_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003023824.1|3161174_3161900_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003023821.1|3161914_3162688_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003023819.1|3162734_3163625_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003023817.1|3163624_3164584_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_003023814.1|3164728_3165769_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.0e-46
WP_003023813.1|3166103_3167933_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.4	1.1e-122
WP_044700491.1|3168157_3169528_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.0	4.3e-36
>prophage 230
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3181810	3182803	4976908		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003827009.1|3181810_3182803_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	3.8e-50
>prophage 231
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3186077	3190071	4976908		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_046671079.1|3186077_3187946_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	4.2e-66
WP_003023766.1|3188138_3188558_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_003023764.1|3188565_3190071_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.9	1.7e-17
>prophage 232
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3205424	3207071	4976908		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003841174.1|3205424_3207071_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.3e-65
>prophage 233
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3216196	3221625	4976908		Bacillus_phage(33.33%)	4	NA	NA
WP_003829018.1|3216196_3218218_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
WP_003017996.1|3218265_3219747_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003017994.1|3219883_3221152_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_001280776.1|3221295_3221625_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 234
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3225669	3229868	4976908		Catovirus(33.33%)	4	NA	NA
WP_032948215.1|3225669_3226800_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.8	1.9e-26
WP_016151230.1|3226796_3228059_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.7	1.2e-24
WP_032938460.1|3228055_3228733_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_044702221.1|3228737_3229868_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.1e-18
>prophage 235
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3246287	3250133	4976908		Bacillus_phage(100.0%)	3	NA	NA
WP_003841210.1|3246287_3247190_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.5	1.9e-24
WP_003017925.1|3247189_3247906_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_003017922.1|3247970_3250133_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	7.8e-117
>prophage 236
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3254051	3257488	4976908	transposase	Catovirus(50.0%)	3	NA	NA
WP_003017915.1|3254051_3255881_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	2.5e-84
WP_003828942.1|3255944_3256565_+	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_032950636.1|3256603_3257488_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	5.7e-66
>prophage 237
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3269333	3272653	4976908		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_044702239.1|3269333_3270974_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	7.4e-43
WP_003017888.1|3271052_3271307_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_003841235.1|3271310_3271859_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_003017884.1|3271861_3272653_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.5	6.8e-26
>prophage 238
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3283602	3284217	4976908		Streptococcus_phage(100.0%)	1	NA	NA
WP_003841252.1|3283602_3284217_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	2.1e-19
>prophage 239
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3296409	3299196	4976908		Enterococcus_phage(100.0%)	1	NA	NA
WP_044701808.1|3296409_3299196_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	4.9e-47
>prophage 240
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3303108	3305578	4976908		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_003028633.1|3303108_3304518_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
WP_003028636.1|3304528_3305578_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	2.6e-09
>prophage 241
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3318286	3321083	4976908		Staphylococcus_phage(50.0%)	3	NA	NA
WP_008323155.1|3318286_3319183_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	93.8	4.6e-63
WP_044701814.1|3319349_3320246_+	sugar kinase	NA	NA	NA	NA	NA
WP_003847907.1|3320279_3321083_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	4.9e-24
>prophage 242
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3324224	3325133	4976908		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_044701816.1|3324224_3325133_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	31.2	7.0e-27
>prophage 243
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3328464	3331515	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_088169089.1|3328464_3331515_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	6.5e-08
>prophage 244
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3349311	3349932	4976908		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003840480.1|3349311_3349932_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	1.0e-61
>prophage 245
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3352975	3355044	4976908		Bacillus_phage(50.0%)	2	NA	NA
WP_003840485.1|3352975_3354349_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
WP_003028763.1|3354345_3355044_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
>prophage 246
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3368527	3369373	4976908		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003028793.1|3368527_3369373_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	1.8e-16
>prophage 247
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3372755	3374087	4976908		Erwinia_phage(100.0%)	1	NA	NA
WP_003028803.1|3372755_3374087_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
>prophage 248
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3395251	3395914	4976908		Synechococcus_phage(100.0%)	1	NA	NA
WP_003847840.1|3395251_3395914_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	32.7	3.2e-29
>prophage 249
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3411921	3413760	4976908		Acinetobacter_phage(100.0%)	1	NA	NA
WP_044701858.1|3411921_3413760_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.7	6.9e-13
>prophage 250
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3422542	3443078	4976908		uncultured_Mediterranean_phage(14.29%)	17	NA	NA
WP_003031107.1|3422542_3423493_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_003031109.1|3424440_3425625_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003033128.1|3425855_3426239_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003033125.1|3426240_3426786_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_003033122.1|3426940_3427369_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_044702700.1|3427372_3428080_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_001207203.1|3428494_3428992_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003033114.1|3429058_3429424_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003033111.1|3429744_3433773_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_003033107.1|3433849_3438073_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.0e-67
WP_003033104.1|3438184_3438502_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003033102.1|3438506_3438812_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003033098.1|3439904_3440117_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
WP_003845330.1|3440248_3441370_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_003842025.1|3441366_3442137_-	thiazole synthase	NA	NA	NA	NA	NA
WP_003033088.1|3442138_3442339_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003033085.1|3442319_3443078_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	32.1	3.5e-11
>prophage 251
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3448445	3450209	4976908		Klosneuvirus(50.0%)	3	NA	NA
WP_003033072.1|3448445_3449126_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.1	3.3e-21
WP_003842015.1|3449159_3449750_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|3449936_3450209_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
>prophage 252
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3455700	3457290	4976908		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_044702690.1|3455700_3457290_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	2.1e-66
>prophage 253
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3470705	3474389	4976908		Dickeya_phage(100.0%)	1	NA	NA
WP_044702258.1|3470705_3474389_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
>prophage 254
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3477904	3478748	4976908		Brucella_phage(50.0%)	2	NA	NA
WP_044702262.1|3477904_3478183_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	51.2	2.5e-12
WP_003841416.1|3478586_3478748_-	phage protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	52.1	3.2e-07
>prophage 255
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3496056	3496842	4976908		Pseudomonas_phage(100.0%)	1	NA	NA
WP_044702280.1|3496056_3496842_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	47.2	1.3e-50
>prophage 256
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3512679	3513789	4976908		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003031682.1|3512679_3513789_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 257
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3520972	3521581	4976908		Lactococcus_phage(100.0%)	1	NA	NA
WP_003031703.1|3520972_3521581_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 258
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3527380	3536374	4976908		Escherichia_phage(25.0%)	7	NA	NA
WP_003826610.1|3527380_3528796_+	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
WP_003031716.1|3528812_3529892_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	3.1e-29
WP_044702292.1|3530020_3531214_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_044702294.1|3531462_3532176_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_003031719.1|3532303_3532660_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003031720.1|3532775_3535598_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_003826621.1|3535849_3536374_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
>prophage 259
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3540457	3541807	4976908		Moraxella_phage(100.0%)	1	NA	NA
WP_003031735.1|3540457_3541807_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	8.8e-159
>prophage 260
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3548726	3550685	4976908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003841063.1|3548726_3550685_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	4.6e-92
>prophage 261
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3567579	3569565	4976908		Tetraselmis_virus(100.0%)	1	NA	NA
WP_044702178.1|3567579_3569565_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	7.9e-148
>prophage 262
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3575374	3576898	4976908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003844755.1|3575374_3576898_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.4e-11
>prophage 263
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3582755	3584284	4976908		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_003841104.1|3582755_3583436_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	8.4e-09
WP_003844769.1|3583525_3584284_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	1.8e-15
>prophage 264
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3590021	3590810	4976908		Pithovirus(100.0%)	1	NA	NA
WP_003841124.1|3590021_3590810_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.0	1.5e-12
>prophage 265
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3597382	3600199	4976908		Burkholderia_virus(50.0%)	3	NA	NA
WP_044702152.1|3597382_3598885_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-56
WP_008321468.1|3599042_3599132_+	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_161799280.1|3599125_3600199_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	27.2	4.4e-12
>prophage 266
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3627024	3628686	4976908		Hepacivirus(100.0%)	1	NA	NA
WP_044699204.1|3627024_3628686_-	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	24.2	1.9e-30
>prophage 267
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3637385	3639369	4976908		Cronobacter_phage(50.0%)	2	NA	NA
WP_000027827.1|3637385_3637679_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_003025464.1|3637722_3639369_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	2.9e-188
>prophage 268
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3644367	3644901	4976908		Morganella_phage(100.0%)	1	NA	NA
WP_003844984.1|3644367_3644901_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.6e-47
>prophage 269
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3650803	3651781	4976908		Tupanvirus(100.0%)	1	NA	NA
WP_016149440.1|3650803_3651781_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
>prophage 270
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3659185	3659731	4976908		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003839477.1|3659185_3659731_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.2e-28
>prophage 271
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3663740	3666947	4976908		Vibrio_phage(50.0%)	2	NA	NA
WP_044699179.1|3663740_3665072_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
WP_003844967.1|3665081_3666947_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.4	6.9e-61
>prophage 272
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3672470	3677030	4976908		Pithovirus(50.0%)	3	NA	NA
WP_003025606.1|3672470_3673769_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
WP_003025609.1|3673985_3674411_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_003025612.1|3674567_3677030_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	9.4e-66
>prophage 273
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3696420	3697974	4976908		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003844953.1|3696420_3697974_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.3e-08
>prophage 274
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3713848	3721601	4976908		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003025726.1|3713848_3714376_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
WP_003025728.1|3714685_3715642_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_044699161.1|3715745_3717248_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.4e-11
WP_008323019.1|3717261_3718284_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003025736.1|3718270_3719272_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_072213460.1|3719375_3720488_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.0	3.8e-14
WP_003025742.1|3720602_3721601_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.1e-68
>prophage 275
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3733510	3736740	4976908		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_003839576.1|3733510_3733753_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	52.5	4.3e-16
WP_044699148.1|3733742_3734027_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	70.2	6.6e-32
WP_032937736.1|3734030_3734495_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	1.1e-52
WP_003025782.1|3734601_3736740_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.0e-266
>prophage 276
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3748458	3752504	4976908		Enterobacteria_phage(50.0%)	2	NA	NA
WP_003025788.1|3748458_3749406_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.5e-13
WP_044699140.1|3749795_3752504_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.5	5.9e-45
>prophage 277
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3756902	3757838	4976908		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003025818.1|3756902_3757838_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	1.4e-51
>prophage 278
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3768750	3791064	4976908	tRNA,integrase	Enterobacteria_phage(22.22%)	20	3761176:3761193	3798894:3798911
3761176:3761193	attL	TGTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_044699129.1|3768750_3771606_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
WP_003025862.1|3771605_3772049_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_003025870.1|3772167_3773679_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
WP_003839630.1|3773945_3775046_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003025875.1|3775045_3776128_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003839633.1|3776229_3777732_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	2.0e-82
WP_044699125.1|3777879_3778899_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	1.9e-44
WP_023185880.1|3779368_3780631_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.8e-66
WP_044699122.1|3780661_3781300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044699119.1|3781669_3781900_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190569.1|3781996_3782182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|3782372_3782549_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_044699117.1|3782541_3782901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044699116.1|3782932_3783217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044699115.1|3783213_3783597_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_044699113.1|3783593_3786266_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	1.6e-58
WP_044699110.1|3786667_3787429_+	septation initiation protein	NA	NA	NA	NA	NA
WP_044699108.1|3787428_3787701_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	43.9	4.9e-08
WP_044699107.1|3787720_3788533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044699105.1|3788826_3791064_+	AAA family ATPase	NA	Q7Y4B3	Escherichia_virus	23.7	4.7e-08
3798894:3798911	attR	CGCCTTATCCGGCCTACA	NA	NA	NA	NA
>prophage 279
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3807130	3811563	4976908		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_003837172.1|3807130_3808606_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	5.8e-47
WP_003033268.1|3808738_3809512_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_008322159.1|3810160_3810364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322158.1|3810555_3811563_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.7	8.2e-85
>prophage 280
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3830860	3832522	4976908		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_044699072.1|3830860_3832522_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 281
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3835712	3838194	4976908		Tupanvirus(50.0%)	2	NA	NA
WP_003837229.1|3835712_3836735_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.0	3.9e-10
WP_016149507.1|3836748_3838194_+	tagaturonate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	26.0	3.9e-19
>prophage 282
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3841321	3842601	4976908		Shigella_phage(50.0%)	2	NA	NA
WP_003019133.1|3841321_3842059_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
WP_003019130.1|3842061_3842601_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	4.9e-28
>prophage 283
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3848942	3850019	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_003837249.1|3848942_3850019_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.5e-20
>prophage 284
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3853842	3856647	4976908		Streptococcus_phage(50.0%)	3	NA	NA
WP_003019086.1|3853842_3855432_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.8	2.7e-29
WP_003837258.1|3855740_3856358_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003019081.1|3856485_3856647_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
>prophage 285
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3862189	3863512	4976908		Geobacillus_virus(100.0%)	1	NA	NA
WP_003019040.1|3862189_3863512_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	4.4e-78
>prophage 286
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3870022	3875288	4976908		Enterococcus_phage(33.33%)	3	NA	NA
WP_003019021.1|3870022_3871252_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.5e-85
WP_003845630.1|3871351_3873019_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	2.4e-41
WP_044699047.1|3873350_3875288_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
>prophage 287
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3879246	3880671	4976908		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_044699045.1|3879246_3880671_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.4	5.1e-08
>prophage 288
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3891868	3892822	4976908		Synechococcus_phage(100.0%)	1	NA	NA
WP_003018974.1|3891868_3892822_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	1.3e-10
>prophage 289
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3897223	3906885	4976908		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_003018959.1|3897223_3899146_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.4e-146
WP_003837322.1|3899231_3900365_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	2.5e-29
WP_032941170.1|3900717_3901482_+	membrane protein	NA	NA	NA	NA	NA
WP_044699031.1|3901502_3902996_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	30.1	1.7e-30
WP_032941172.1|3903098_3904289_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_003837330.1|3904313_3905576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003018952.1|3905718_3906885_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.5	2.6e-90
>prophage 290
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3913357	3916174	4976908	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_016149528.1|3913357_3916174_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.5	3.0e-76
>prophage 291
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3920621	3921770	4976908		Halovirus(100.0%)	1	NA	NA
WP_003018918.1|3920621_3921770_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 292
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3927202	3932835	4976908		Tupanvirus(50.0%)	4	NA	NA
WP_044699019.1|3927202_3928756_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	22.3	5.4e-19
WP_044699018.1|3928817_3930035_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_003018898.1|3930140_3931283_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_044699016.1|3931317_3932835_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.1	2.5e-08
>prophage 293
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3941165	3942590	4976908		Bacillus_phage(50.0%)	2	NA	NA
WP_003018873.1|3941165_3941645_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
WP_044699010.1|3941741_3942590_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	45.3	6.4e-06
>prophage 294
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3950321	3955711	4976908		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_044699006.1|3950321_3953228_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.5	1.3e-21
WP_044699004.1|3953359_3955711_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.1	3.2e-15
>prophage 295
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3962863	3963562	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_032937527.1|3962863_3963562_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.2	8.9e-22
>prophage 296
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	3980021	3981746	4976908		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003845729.1|3980021_3981746_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.1	3.0e-34
>prophage 297
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4007765	4008809	4976908		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_044698978.1|4007765_4008809_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	2.0e-102
>prophage 298
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4013111	4013675	4976908		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_047715961.1|4013111_4013675_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	33.1	3.6e-13
>prophage 299
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4024741	4026166	4976908		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003018686.1|4024741_4026166_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 300
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4033655	4039694	4976908		Mamastrovirus(25.0%)	5	NA	NA
WP_003845765.1|4033655_4035275_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	4.3e-19
WP_003837476.1|4035459_4037115_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.8	4.3e-14
WP_003018658.1|4037366_4037903_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
WP_003018654.1|4037996_4038659_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_044698970.1|4038767_4039694_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	4.1e-22
>prophage 301
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4045142	4051965	4976908	tRNA	Bacillus_virus(50.0%)	6	NA	NA
WP_071524282.1|4045142_4046561_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
WP_016149569.1|4046611_4047508_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_003018625.1|4047578_4048034_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_003837495.1|4048211_4048916_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003018620.1|4048931_4049462_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_044698965.1|4049535_4051965_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.7	1.3e-38
>prophage 302
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4062610	4063408	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_003845793.1|4062610_4063408_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	3.5e-14
>prophage 303
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4069343	4069688	4976908		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003018581.1|4069343_4069688_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	5.9e-27
>prophage 304
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4073690	4075124	4976908	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003018567.1|4073690_4075124_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 305
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4086548	4087307	4976908		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003018543.1|4086548_4087307_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	7.2e-25
>prophage 306
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4096126	4100230	4976908		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_044698940.1|4096126_4096723_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	1.0e-26
WP_003018516.1|4096747_4100230_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	5.9e-207
>prophage 307
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4112250	4113282	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_003018468.1|4112250_4113282_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 308
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4119738	4120542	4976908		Indivirus(100.0%)	1	NA	NA
WP_044702527.1|4119738_4120542_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	6.6e-37
>prophage 309
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4124586	4128785	4976908		Lactobacillus_phage(33.33%)	5	NA	NA
WP_003031421.1|4124586_4125945_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	28.6	8.9e-10
WP_003031418.1|4126016_4126772_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003031413.1|4126805_4127528_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003031412.1|4127524_4127992_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_003031410.1|4128056_4128785_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.7	3.1e-41
>prophage 310
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4144378	4147661	4976908		Caulobacter_phage(50.0%)	4	NA	NA
WP_003031390.1|4144378_4144960_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
WP_044702507.1|4145071_4145839_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003031387.1|4145809_4146550_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032937061.1|4146899_4147661_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	2.0e-19
>prophage 311
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4150689	4204103	4976908	holin,integrase,transposase	Stx2-converting_phage(28.57%)	51	4172799:4172847	4204286:4204334
WP_001395480.1|4150689_4151721_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_003031382.1|4152162_4153218_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_044702503.1|4153318_4154776_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_003031380.1|4155037_4155496_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044702502.1|4155596_4156841_+	esterase FrsA	NA	NA	NA	NA	NA
WP_003031376.1|4156898_4157300_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_003843783.1|4157356_4158412_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	2.5e-116
WP_003031373.1|4158701_4159805_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.6e-60
WP_003031370.1|4159816_4161070_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.9e-99
WP_044702490.1|4161340_4162060_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003031365.1|4162655_4163243_+	fimbrillin MatB	NA	NA	NA	NA	NA
WP_003031363.1|4163295_4163973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008324497.1|4164031_4166524_+	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044702486.1|4166528_4168145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031358.1|4168141_4168837_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044702485.1|4168981_4169713_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044702484.1|4169687_4170161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702495.1|4170502_4171951_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044702482.1|4172142_4172607_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
4172799:4172847	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_003031349.1|4173236_4173578_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_003031347.1|4173598_4173916_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_003031346.1|4173933_4174155_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_003031345.1|4174163_4174640_-	RadC family protein	NA	NA	NA	NA	NA
WP_003031344.1|4174655_4175117_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	32.3	3.7e-08
WP_016245729.1|4175825_4177823_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.6e-21
WP_003036928.1|4177887_4179165_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_003036925.1|4179440_4179791_+	Morphinone reductase	NA	NA	NA	NA	NA
WP_003029616.1|4180889_4181330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003029614.1|4181319_4181565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003029611.1|4181605_4182307_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003029610.1|4182523_4183345_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.3	1.8e-45
WP_003029608.1|4183436_4184300_-	GTPase family protein	NA	NA	NA	NA	NA
WP_032933065.1|4184762_4185668_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003029596.1|4187137_4188289_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	8.9e-43
WP_164847251.1|4188364_4188880_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5FNT8	Shigella_phage	94.0	1.9e-90
WP_003029591.1|4189068_4190073_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003029589.1|4190102_4191503_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_000345204.1|4191502_4192873_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029587.1|4193010_4194528_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_003029584.1|4194693_4195617_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_077258089.1|4195845_4196016_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042922212.1|4196479_4196857_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.4	2.4e-58
WP_042922210.1|4196856_4197204_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_042922208.1|4197253_4198792_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.0	5.7e-271
WP_003029582.1|4198975_4199284_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_003029581.1|4199312_4199969_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_003029579.1|4200024_4200645_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_003029576.1|4201106_4201871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003847740.1|4202005_4202227_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044699238.1|4202223_4202673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044699239.1|4202795_4204103_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	29.1	3.1e-07
4204286:4204334	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 312
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4229711	4234040	4976908		Phormidium_phage(100.0%)	1	NA	NA
WP_044699269.1|4229711_4234040_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.2	4.3e-66
>prophage 313
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4238866	4239979	4976908		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_044699274.1|4238866_4239979_-	agmatine deiminase family protein	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	35.2	1.1e-53
>prophage 314
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4248074	4248980	4976908		Burkholderia_virus(100.0%)	1	NA	NA
WP_044699286.1|4248074_4248980_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.0	5.2e-14
>prophage 315
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4255713	4256541	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_032937018.1|4255713_4256541_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	7.8e-17
>prophage 316
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4270110	4278320	4976908		Staphylococcus_phage(33.33%)	5	NA	NA
WP_044699308.1|4270110_4271997_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	3.1e-53
WP_003021330.1|4272087_4272699_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_044699309.1|4272727_4273981_-	MFS transporter	NA	NA	NA	NA	NA
WP_044699310.1|4274032_4277116_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	81.2	0.0e+00
WP_044699311.1|4277237_4278320_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	82.3	3.7e-160
>prophage 317
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4289080	4291041	4976908		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_044699322.1|4289080_4290031_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	3.1e-33
WP_003021379.1|4290027_4291041_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 318
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4295029	4296076	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_044699326.1|4295029_4296076_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	4.0e-34
>prophage 319
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4304136	4304904	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_003838608.1|4304136_4304904_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	3.3e-25
>prophage 320
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4321545	4322661	4976908		Bacillus_phage(100.0%)	1	NA	NA
WP_085954043.1|4321545_4322661_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 321
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4326412	4336265	4976908		Bacillus_phage(60.0%)	7	NA	NA
WP_003021479.1|4326412_4327324_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
WP_044699335.1|4327415_4328324_+	fructokinase	NA	NA	NA	NA	NA
WP_032937081.1|4328331_4329504_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_044699338.1|4329696_4332840_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
WP_032936985.1|4332836_4334039_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.6	2.0e-08
WP_003021496.1|4334229_4334919_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	2.0e-37
WP_016149692.1|4334969_4336265_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	1.4e-28
>prophage 322
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4348511	4358119	4976908	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003021535.1|4348511_4349639_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
WP_003021544.1|4349661_4349994_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071681428.1|4350021_4351869_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003021550.1|4351879_4352851_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_044699354.1|4353019_4353385_+	VOC family protein	NA	NA	NA	NA	NA
WP_003835974.1|4353408_4354101_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	4.5e-18
WP_003021561.1|4354146_4355010_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_044699517.1|4355308_4355848_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_003021571.1|4356001_4356451_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003021573.1|4356454_4357558_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	3.4e-52
WP_003021575.1|4357648_4358119_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
>prophage 323
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4380758	4385803	4976908	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|4380758_4381382_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_003831013.1|4381508_4382783_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_003021627.1|4382967_4385322_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	5.5e-225
WP_003021629.1|4385530_4385803_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
>prophage 324
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4389084	4389780	4976908		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003835948.1|4389084_4389780_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	6.5e-89
>prophage 325
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4394190	4397734	4976908		Bacillus_phage(100.0%)	2	NA	NA
WP_003835940.1|4394190_4395963_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.1e-47
WP_032936971.1|4395955_4397734_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.5e-41
>prophage 326
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4410057	4413207	4976908		Leptospira_phage(100.0%)	1	NA	NA
WP_003021736.1|4410057_4413207_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	9.5e-55
>prophage 327
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4420126	4428756	4976908		Klosneuvirus(25.0%)	8	NA	NA
WP_003021759.1|4420126_4420678_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
WP_003021761.1|4420888_4422820_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.5	1.3e-43
WP_003021764.1|4422877_4423207_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003021767.1|4423206_4423812_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003021770.1|4423922_4425797_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.0e-113
WP_003021773.1|4426029_4426674_+	adenylate kinase	NA	NA	NA	NA	NA
WP_003021775.1|4426837_4427800_+	ferrochelatase	NA	NA	NA	NA	NA
WP_044699378.1|4427796_4428756_-	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	29.0	1.9e-14
>prophage 328
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4436940	4440360	4976908		uncultured_virus(50.0%)	2	NA	NA
WP_044699386.1|4436940_4439442_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
WP_044699387.1|4439589_4440360_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	5.2e-15
>prophage 329
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4451912	4452590	4976908		Bacillus_virus(100.0%)	1	NA	NA
WP_003835797.1|4451912_4452590_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-27
>prophage 330
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4455740	4456427	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_044699413.1|4455740_4456427_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	6.1e-31
>prophage 331
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4461323	4462340	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_003835783.1|4461323_4462340_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-33
>prophage 332
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4468831	4470060	4976908	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_148116659.1|4468831_4470060_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	3.5e-146
>prophage 333
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4478504	4479653	4976908		Streptococcus_phage(100.0%)	1	NA	NA
WP_044699430.1|4478504_4479653_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	40.6	5.0e-46
>prophage 334
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4491048	4494256	4976908	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_003831109.1|4491048_4492434_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
WP_003835753.1|4492525_4493050_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_044699447.1|4493175_4493388_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_003021887.1|4493389_4494256_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	1.2e-28
>prophage 335
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4504234	4514137	4976908		Hokovirus(25.0%)	7	NA	NA
WP_071681432.1|4504234_4507000_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.3	4.0e-33
WP_044699462.1|4507082_4508114_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_003021912.1|4508086_4508779_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.9	4.9e-20
WP_003021915.1|4508910_4510089_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_044699463.1|4510078_4512619_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.2	1.1e-72
WP_032936924.1|4512615_4513230_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_003835732.1|4513708_4514137_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.3	7.4e-27
>prophage 336
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4520515	4522640	4976908		Hokovirus(50.0%)	2	NA	NA
WP_003847479.1|4520515_4521967_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	2.5e-10
WP_003021940.1|4521956_4522640_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	6.0e-31
>prophage 337
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4525978	4531590	4976908		Leptospira_phage(50.0%)	3	NA	NA
WP_044699469.1|4525978_4529122_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	21.9	5.9e-57
WP_044699470.1|4529173_4530028_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044699473.1|4530264_4531590_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	45.8	3.8e-106
>prophage 338
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4535482	4544821	4976908		Escherichia_phage(100.0%)	1	NA	NA
WP_047715968.1|4535482_4544821_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.5	1.3e-11
>prophage 339
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4552718	4553699	4976908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003835685.1|4552718_4553699_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.5	8.4e-26
>prophage 340
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4565379	4573468	4976908		Tupanvirus(33.33%)	5	NA	NA
WP_044699489.1|4565379_4569270_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.9	1.6e-64
WP_044699491.1|4569497_4570631_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_003022023.1|4570677_4571475_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.0	6.4e-08
WP_003022026.1|4571471_4572464_-	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_003835646.1|4572460_4573468_-	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.0	2.2e-13
>prophage 341
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4585894	4587720	4976908		uncultured_marine_virus(50.0%)	2	NA	NA
WP_003847426.1|4585894_4586512_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	1.1e-52
WP_003835626.1|4586496_4587720_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	5.9e-61
>prophage 342
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4590832	4598962	4976908		Escherichia_phage(40.0%)	8	NA	NA
WP_003835619.1|4590832_4592398_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
WP_044699507.1|4592621_4593176_+	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_044699509.1|4593172_4595443_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.0	8.4e-45
WP_003022094.1|4595439_4595997_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_044700970.1|4595996_4596764_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003022101.1|4596833_4597262_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_003022104.1|4597445_4597856_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_044700974.1|4598131_4598962_+	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.7	7.1e-18
>prophage 343
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4612795	4613440	4976908		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4612795_4613005_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_016149775.1|4613056_4613440_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	5.8e-23
>prophage 344
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4617047	4619511	4976908		Stx2-converting_phage(50.0%)	2	NA	NA
WP_003022711.1|4617047_4618259_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
WP_044700988.1|4618401_4619511_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	56.5	2.1e-09
>prophage 345
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4627676	4632851	4976908	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_108961715.1|4627676_4630259_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	9.5e-186
WP_003022748.1|4630494_4630977_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_003847389.1|4631073_4632009_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003022754.1|4632125_4632851_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
>prophage 346
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4638811	4639858	4976908		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003022776.1|4638811_4639858_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 347
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4644448	4646113	4976908		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_003835552.1|4644448_4646113_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	2.1e-85
>prophage 348
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4650912	4667815	4976908	tRNA	Vibrio_phage(16.67%)	16	NA	NA
WP_016149786.1|4650912_4652862_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.1e-08
WP_003835546.1|4653048_4654716_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.0	0.0e+00
WP_003835544.1|4655151_4656558_+	chitoporin	NA	NA	NA	NA	NA
WP_003022817.1|4656607_4656940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003835542.1|4656991_4658287_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.4	9.0e-60
WP_044701000.1|4658340_4659480_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_044701001.1|4659466_4660870_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
WP_044701004.1|4660967_4661894_-	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_003022836.1|4662023_4662470_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_049259739.1|4662462_4662549_-	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
WP_003022839.1|4662759_4663290_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_003022842.1|4663445_4663733_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_044701063.1|4663861_4664635_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	37.2	3.1e-07
WP_003022848.1|4664829_4665372_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_044701007.1|4665396_4667037_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_003022856.1|4667137_4667815_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	2.6e-26
>prophage 349
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4671081	4673130	4976908		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003022864.1|4671081_4673130_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	3.7e-31
>prophage 350
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4676497	4680523	4976908	transposase	Hokovirus(33.33%)	3	NA	NA
WP_044701018.1|4676497_4677916_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.8	1.7e-64
WP_016149795.1|4678076_4678991_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.0	4.1e-67
WP_003847348.1|4679041_4680523_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	27.5	1.3e-43
>prophage 351
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4686314	4687106	4976908		Kaumoebavirus(100.0%)	1	NA	NA
WP_044701028.1|4686314_4687106_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.1	2.2e-08
>prophage 352
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4729980	4733496	4976908		Vibrio_phage(33.33%)	4	NA	NA
WP_003022990.1|4729980_4730700_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	5.8e-24
WP_003022992.1|4730696_4731638_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.5	3.7e-23
WP_003022994.1|4731751_4732126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003837108.1|4732443_4733496_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4VUY9	Pandoravirus	47.3	1.7e-80
>prophage 353
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4737791	4744357	4976908		Tupanvirus(33.33%)	7	NA	NA
WP_003837100.1|4737791_4738808_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	6.3e-77
WP_032938578.1|4739025_4740498_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.1	1.0e-11
WP_003023018.1|4740565_4741354_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003023026.1|4741484_4741634_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_044701075.1|4741833_4742607_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003023032.1|4742606_4743296_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003837092.1|4743298_4744357_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-20
>prophage 354
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4758706	4762146	4976908		Catovirus(50.0%)	3	NA	NA
WP_003837068.1|4758706_4760227_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	3.7e-81
WP_044701085.1|4760322_4760799_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_044701086.1|4760856_4762146_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.8	1.5e-19
>prophage 355
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4765812	4770357	4976908		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003035181.1|4765812_4766535_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.4e-09
WP_003837055.1|4767304_4769326_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_032938564.1|4769448_4770357_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	2.7e-26
>prophage 356
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4780075	4785042	4976908		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_003845404.1|4780075_4781812_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	1.1e-17
WP_032938552.1|4781804_4782800_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_047715970.1|4782796_4783474_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_003035219.1|4783695_4785042_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	5.0e-53
>prophage 357
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4789009	4795088	4976908		Bacillus_phage(33.33%)	6	NA	NA
WP_003837021.1|4789009_4791160_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	2.8e-42
WP_003035227.1|4791189_4792158_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_044701098.1|4792320_4793406_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_003035231.1|4793504_4793765_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003035233.1|4794068_4794335_-	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	51.1	3.6e-16
WP_003837014.1|4794410_4795088_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	2.6e-18
>prophage 358
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4801460	4806650	4976908		Planktothrix_phage(33.33%)	6	NA	NA
WP_003035246.1|4801460_4802183_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
WP_003035248.1|4802179_4802839_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003837002.1|4802976_4803723_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003035253.1|4804088_4804592_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	5.5e-05
WP_003035255.1|4804893_4805781_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_003035257.1|4806134_4806650_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
>prophage 359
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4811719	4819990	4976908		Tupanvirus(33.33%)	6	NA	NA
WP_003035269.1|4811719_4813315_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	8.5e-60
WP_044701107.1|4813458_4814721_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_044701108.1|4814874_4815690_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_044701109.1|4815857_4818290_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_032936389.1|4818295_4819195_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_003836983.1|4819327_4819990_+	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.8	2.2e-22
>prophage 360
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4824169	4826041	4976908		Planktothrix_phage(100.0%)	1	NA	NA
WP_003836972.1|4824169_4826041_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	3.7e-14
>prophage 361
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4831149	4834956	4976908	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_131138615.1|4831149_4832317_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	6.4e-166
WP_003845471.1|4832588_4832831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003845473.1|4832831_4833218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071681817.1|4834152_4834956_-	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	52.3	1.8e-79
>prophage 362
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4845925	4847931	4976908		Stx2-converting_phage(50.0%)	2	NA	NA
WP_003035316.1|4845925_4847128_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.9e-97
WP_003836960.1|4847172_4847931_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	3.9e-15
>prophage 363
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4856122	4869478	4976908		Salmonella_phage(20.0%)	15	NA	NA
WP_003845517.1|4856122_4857334_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	90.2	3.0e-190
WP_161799272.1|4857689_4857791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003035354.1|4857806_4859492_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_003035356.1|4859761_4860142_+	membrane protein	NA	NA	NA	NA	NA
WP_003035358.1|4860176_4860440_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
WP_003845523.1|4860612_4860903_+	YbjC family protein	NA	NA	NA	NA	NA
WP_044701671.1|4860886_4861609_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_003836932.1|4861668_4862571_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	2.0e-37
WP_003035368.1|4862661_4863138_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003035370.1|4863571_4864684_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003035373.1|4864822_4865956_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_044701670.1|4865965_4866919_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_003035376.1|4866915_4867761_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_003035378.1|4867820_4868309_+	YbjO family protein	NA	NA	NA	NA	NA
WP_044701666.1|4868350_4869478_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.6e-28
>prophage 364
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4873014	4927431	4976908	portal,capsid,tail,integrase,plate,tRNA,terminase,lysis,head	Escherichia_phage(42.22%)	54	4891471:4891487	4929193:4929209
WP_032948928.1|4873014_4873719_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003035722.1|4873763_4875485_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.4e-15
WP_044701662.1|4875485_4877252_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-23
WP_003035727.1|4877366_4878335_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_002439523.1|4878882_4879377_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_046155120.1|4879511_4883495_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.8e-88
WP_003831898.1|4883606_4884218_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_044701644.1|4884228_4885572_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	1.1e-81
WP_003836908.1|4885664_4886957_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
WP_032948932.1|4887193_4889638_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	3.5e-222
WP_003035741.1|4889648_4890266_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_003035744.1|4890267_4891131_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003035746.1|4891240_4891867_-	hydrolase	NA	NA	NA	NA	NA
4891471:4891487	attL	CGTCAAAGCCTTCTTCA	NA	NA	NA	NA
WP_003836902.1|4892251_4893400_+	MFS transporter	NA	NA	NA	NA	NA
WP_003035749.1|4893613_4895035_+	amino acid permease	NA	NA	NA	NA	NA
WP_044701640.1|4895078_4895876_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.7e-21
WP_044701636.1|4895907_4896903_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	87.6	1.0e-167
WP_040090132.1|4897045_4897345_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	73.7	1.4e-32
WP_044701633.1|4897448_4897805_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	76.1	3.8e-45
WP_164845066.1|4897815_4897992_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	71.2	2.1e-12
WP_044701632.1|4897982_4898483_+	hypothetical protein	NA	M1SV55	Escherichia_phage	84.9	7.4e-79
WP_044701629.1|4898546_4898771_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	67.6	1.6e-17
WP_044701628.1|4898770_4899070_+	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	57.7	3.6e-20
WP_044701626.1|4899069_4899345_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	63.7	4.7e-27
WP_044701624.1|4899334_4901626_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.4	0.0e+00
WP_044701622.1|4901725_4902211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044701651.1|4902226_4903318_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	36.8	7.0e-05
WP_023223238.1|4903755_4904793_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.3	1.2e-163
WP_044701619.1|4904792_4906562_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	8.5e-287
WP_044701617.1|4906726_4907590_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.6	3.7e-102
WP_044701616.1|4907621_4908782_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	4.3e-130
WP_047715974.1|4908785_4909544_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.3	3.0e-79
WP_000177982.1|4909641_4910142_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_001100637.1|4910141_4910345_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000524754.1|4910335_4910557_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_044701612.1|4910540_4911050_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	83.8	1.9e-77
WP_044701609.1|4911046_4911460_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	1.9e-35
WP_044701608.1|4911567_4912035_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	70.3	9.7e-57
WP_044701606.1|4912027_4912483_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.1	1.3e-50
WP_047715975.1|4912496_4913240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044701601.1|4913314_4913956_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.6	4.5e-97
WP_023223227.1|4913952_4914300_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	71.3	9.5e-41
WP_044701599.1|4914304_4915213_+|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	84.4	5.2e-139
WP_044701597.1|4915205_4915736_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	97.2	5.6e-101
WP_044701594.1|4917590_4918118_+|tail	tail assembly chaperone	tail	Q2A0A8	Sodalis_phage	28.6	7.5e-13
WP_044701591.1|4918247_4919435_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.1e-189
WP_023223221.1|4919447_4919966_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_044701589.1|4920028_4920310_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_000763326.1|4920342_4920462_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_044701587.1|4920454_4922884_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	76.0	3.9e-266
WP_044701585.1|4922895_4923360_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	7.6e-62
WP_044701584.1|4923362_4924556_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.6	2.1e-164
WP_052746971.1|4924618_4924840_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	72.6	2.1e-25
WP_003035753.1|4925148_4927431_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
4929193:4929209	attR	CGTCAAAGCCTTCTTCA	NA	NA	NA	NA
>prophage 365
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4931554	4932643	4976908		Streptococcus_phage(100.0%)	1	NA	NA
WP_003847007.1|4931554_4932643_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.2	5.9e-81
>prophage 366
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4937697	4942238	4976908		Bacillus_phage(100.0%)	3	NA	NA
WP_003035780.1|4937697_4937982_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
WP_044701581.1|4938188_4940453_+	ComEC family protein	NA	NA	NA	NA	NA
WP_003035784.1|4940489_4942238_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
>prophage 367
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4956976	4957525	4976908		Rhodobacter_phage(100.0%)	1	NA	NA
WP_003035820.1|4956976_4957525_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 368
NZ_CP011612	Citrobacter freundii strain CAV1321 chromosome, complete genome	4976908	4961307	4967796	4976908	tRNA	Bandra_megavirus(33.33%)	4	NA	NA
WP_032936329.1|4961307_4962708_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	3.8e-80
WP_003836860.1|4962875_4964078_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044701568.1|4964344_4966957_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.4	1.6e-18
WP_032936311.1|4967028_4967796_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	1.7e-29
>prophage 1
NZ_CP011610	Citrobacter freundii strain CAV1321 plasmid pCAV1321-135, complete sequence	135117	9420	57059	135117	integrase,transposase	Escherichia_phage(23.81%)	36	28365:28381	34086:34102
WP_022652239.1|9420_11547_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_022652238.1|11695_12910_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.4e-35
WP_072200700.1|12943_14347_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_022652236.1|14680_16819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652318.1|18847_19813_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652317.1|19812_20979_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_047715661.1|21804_23163_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.7e-117
WP_032430836.1|23219_24755_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.5	6.5e-259
WP_000609174.1|24804_25152_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|25148_25532_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_022652315.1|25640_26792_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_086538014.1|27893_28787_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	87.1	6.7e-155
28365:28381	attL	CAGCCAGCGATTGATGG	NA	NA	NA	NA
WP_022652313.1|28918_29449_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022652312.1|29452_29722_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652311.1|30577_31567_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_022652310.1|31892_32633_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_001572362.1|33708_34731_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
34086:34102	attR	CCATCAATCGCTGGCTG	NA	NA	NA	NA
WP_022652309.1|35237_36716_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430841.1|36733_37561_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652307.1|37642_37846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021314637.1|38123_38354_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_050483874.1|39525_40035_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_032430842.1|40625_41579_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|42199_42910_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|42911_44117_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032430843.1|44113_45265_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|45261_45870_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022542389.1|46057_47062_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|47665_47995_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|47975_48257_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_047715662.1|48534_49515_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.6e-184
WP_148116659.1|49820_51049_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	3.5e-146
WP_001752509.1|51167_51668_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|51994_52699_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000215515.1|55595_55952_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|56354_57059_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP011609	Citrobacter freundii strain CAV1321 plasmid pCAV1321-71, complete sequence	70610	13552	44126	70610	integrase,protease,transposase	Escherichia_phage(27.27%)	36	40091:40105	46486:46500
WP_000845048.1|13552_14566_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003159191.1|14729_15284_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_047715652.1|15353_16145_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|16308_16656_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|16649_17489_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|17893_19435_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032491313.1|19790_20270_+	trimethoprim-resistant dihydrofolate reductase DfrA3b	NA	A0A0N9RSY5	Escherichia_phage	30.7	1.8e-10
WP_000654805.1|20370_21339_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_032491180.1|21459_22320_+	class A extended-spectrum beta-lactamase SHV-30	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|22340_23102_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004206881.1|23209_26107_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
WP_000509966.1|26201_26807_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206885.1|27389_29477_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_004206886.1|29489_30440_-	DsbC family protein	NA	NA	NA	NA	NA
WP_004206887.1|30450_31713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187436.1|31757_32153_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004206889.1|32257_32641_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004206890.1|32720_33374_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004187429.1|33465_33723_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_147810693.1|33691_34057_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187425.1|34149_34584_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_004187413.1|35958_36168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|36170_36389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206893.1|36433_37117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206894.1|37117_37375_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206895.1|37392_38667_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004206896.1|39194_39551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|39528_40107_+	hypothetical protein	NA	NA	NA	NA	NA
40091:40105	attL	ACGAACAGGGGGAAT	NA	NA	NA	NA
WP_004206898.1|40108_40516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|40668_41214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206900.1|41354_41825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187394.1|41811_42060_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_004206901.1|42052_42640_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187390.1|42636_43122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316874.1|43163_43367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187383.1|43385_44126_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
46486:46500	attR	ATTCCCCCTGTTCGT	NA	NA	NA	NA
>prophage 1
NZ_CP011611	Citrobacter freundii strain CAV1321 plasmid pKPC_CAV1321-244, complete sequence	243709	14298	57579	243709	transposase,integrase	Escherichia_phage(45.45%)	41	26438:26497	46208:47030
WP_016162063.1|14298_15003_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000557452.1|15109_15970_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|15982_16525_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_165587319.1|16616_17772_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	30.6	1.3e-17
WP_001067855.1|17718_18423_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|18918_19932_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|20223_20778_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|20908_21739_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|21876_22509_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|22593_23046_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|23268_23616_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|23609_24449_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_047715689.1|24576_25077_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|25583_26348_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
26438:26497	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|26502_27207_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|27279_28140_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|28322_28880_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_004152391.1|29994_31710_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|31819_34849_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|34955_35981_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|35977_36757_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|37143_38025_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|38274_39594_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_001039466.1|42105_43290_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|43385_44042_+	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001067855.1|44053_44758_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|44901_45543_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|45692_46193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|46272_46977_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|46982_47123_+	hypothetical protein	NA	NA	NA	NA	NA
46208:47030	attR	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
WP_001446887.1|47608_48346_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|48342_48567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|48777_50271_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|50301_50553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|50446_50749_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_047715692.1|50835_51651_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|51980_52157_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|52338_53343_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|53421_56388_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001067855.1|56443_57148_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165919943.1|57138_57579_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.6	4.8e-21
