The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	572013	598618	6229565	terminase,transposase,head	Salmonella_phage(25.0%)	30	NA	NA
WP_077257948.1|572013_573360_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_022652343.1|573609_574578_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_012695467.1|574599_575184_-	MFS transporter	NA	NA	NA	NA	NA
WP_021243026.1|575261_576419_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695469.1|576612_577506_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012695470.1|577642_578458_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_013815099.1|578618_579587_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_001567369.1|580064_580697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|580725_582129_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_016808964.1|582451_582985_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_032743587.1|582981_583482_-	lysozyme	NA	H9C184	Pectobacterium_phage	75.8	4.4e-71
WP_016808966.1|583501_583780_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	52.5	3.4e-09
WP_016808967.1|583780_584119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808968.1|584119_584716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808969.1|584797_585064_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	41.6	8.4e-05
WP_016808970.1|585074_587006_-	tape measure protein	NA	NA	NA	NA	NA
WP_004113073.1|587133_587619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719835.1|587618_588041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808973.1|588043_589402_-	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	27.8	2.8e-35
WP_016808974.1|589402_590188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808975.1|590187_590442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808976.1|590537_591011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016808977.1|591131_591491_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_004113060.1|591500_591755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719836.1|591758_592697_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	30.8	6.6e-28
WP_016808979.1|592714_593506_-	Ig domain-containing protein	NA	A0A1S5R5Y7	Pseudomonas_phage	55.3	5.6e-12
WP_026055954.1|593505_594519_-	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	35.0	2.6e-14
WP_016808981.1|594490_595852_-|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	28.6	1.7e-16
WP_016808982.1|595838_597212_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_016808983.1|597208_598618_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2I7RTP3	Vibrio_phage	33.7	1.0e-56
>prophage 2
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	881507	941359	6229565	tRNA,protease,plate,holin	Enterobacteria_phage(25.0%)	58	NA	NA
WP_004112629.1|881507_882497_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
WP_004101623.1|882622_883063_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_029496829.1|883059_883332_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_017146002.1|883659_884025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017146003.1|884254_884797_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	64.6	4.9e-68
WP_004101614.1|884804_885077_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	56.6	1.2e-17
WP_004101612.1|885066_885459_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	53.7	2.2e-25
WP_004101611.1|885535_885898_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	5.1e-29
WP_047719902.1|886358_887060_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	40.0	5.1e-33
WP_047719904.1|887538_891066_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_004101605.1|891420_892527_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.7	1.7e-107
WP_004112591.1|892676_892889_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004101601.1|892971_893406_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_017146008.1|893591_893882_+	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	64.9	1.1e-29
WP_023320857.1|894088_895027_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_024274080.1|895977_896913_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_023320856.1|896957_898331_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.8e-50
WP_016807751.1|898813_899797_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_029779322.1|900138_900759_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047719906.1|900877_901396_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023329611.1|901404_902337_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023329610.1|902368_904900_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_016807754.1|904963_905635_-	molecular chaperone	NA	NA	NA	NA	NA
WP_024274079.1|905690_906221_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_032734669.1|906638_907268_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004101576.1|907351_907984_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024274078.1|908153_908900_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	5.4e-17
WP_017146018.1|908913_909981_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023320845.1|910144_911410_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.1	5.9e-157
WP_023320844.1|911409_911832_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.1	6.8e-33
WP_004178082.1|911910_913398_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004101565.1|914024_914219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004112572.1|914373_914565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017146020.1|914742_915057_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_004101558.1|915935_916124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024274077.1|916790_917696_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024274076.1|917833_918766_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_023320841.1|918935_919916_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_024274075.1|920072_920957_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004101547.1|921088_921631_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004101545.1|921834_922719_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807767.1|922890_924027_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023320840.1|924168_925356_+	MFS transporter	NA	NA	NA	NA	NA
WP_023320839.1|925454_925799_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_004101537.1|925899_926628_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	2.1e-45
WP_004101535.1|926895_927330_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004101533.1|927326_928046_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017146024.1|928042_929302_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004101529.1|929303_930026_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_024274073.1|930022_931246_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024274072.1|931242_931776_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_024274071.1|931790_932750_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_163470950.1|934218_935658_+	MFS transporter	NA	NA	NA	NA	NA
WP_004101515.1|935713_937393_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_004101512.1|937541_938033_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004101511.1|938032_938572_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_024274069.1|938549_939635_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024274068.1|939598_941359_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	1103821	1165297	6229565	terminase,head,tRNA,portal,integrase,tail,capsid,plate	Enterobacteria_phage(52.94%)	68	1109138:1109154	1146451:1146467
WP_023320736.1|1103821_1104322_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004101248.1|1104501_1104948_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004101246.1|1104931_1105723_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004101244.1|1105823_1107008_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004101242.1|1107045_1107738_-	CTP synthase	NA	NA	NA	NA	NA
WP_004101240.1|1107900_1108410_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004101238.1|1108396_1108744_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_023320734.1|1108747_1108987_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
1109138:1109154	attL	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
WP_004216467.1|1109250_1109502_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_047719938.1|1109545_1110685_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.7	1.4e-144
WP_047719940.1|1110839_1112012_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	2.9e-158
WP_047719941.1|1112011_1112527_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_047719942.1|1112572_1112884_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	52.2	1.5e-16
WP_053086776.1|1112904_1113042_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_047719943.1|1113028_1116004_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.2	1.1e-217
WP_047721071.1|1116019_1116493_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.1	1.9e-52
WP_047719944.1|1116657_1119117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719945.1|1119388_1120486_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	8.8e-08
WP_047719946.1|1120470_1120686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719947.1|1120682_1123712_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
WP_047719948.1|1123701_1124625_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	42.9	9.3e-51
WP_017898624.1|1124626_1124977_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_047719949.1|1124973_1125561_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	56.0	4.8e-53
WP_047719950.1|1125557_1126193_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	7.8e-57
WP_032720044.1|1126189_1126657_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_128316295.1|1126657_1126849_-	peptidase	NA	NA	NA	NA	NA
WP_049070297.1|1126838_1127168_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_047719951.1|1127179_1127725_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	1.1e-30
WP_032432781.1|1127721_1128006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|1127996_1128197_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_032708341.1|1128196_1128712_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	1.7e-41
WP_047719953.1|1128816_1129683_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.9	2.6e-71
WP_047719954.1|1129732_1130767_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.3	6.2e-96
WP_047719956.1|1130777_1131617_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_047719957.1|1131773_1133501_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.4	8.2e-234
WP_047719958.1|1133494_1134556_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	4.1e-143
WP_047719959.1|1135138_1136503_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	22.3	1.8e-18
WP_047719961.1|1136705_1138394_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	53.1	1.3e-175
WP_047719963.1|1141044_1142061_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.1e-65
WP_047719965.1|1142334_1142901_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.5	4.7e-13
WP_004213098.1|1142897_1143122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719966.1|1143190_1143463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009486498.1|1143478_1143856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021466843.1|1143871_1144090_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	47.3	1.6e-06
WP_023300862.1|1144223_1144439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023300861.1|1144543_1144813_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.8	3.9e-42
WP_038423230.1|1144935_1145235_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.7	3.5e-36
WP_047719967.1|1145350_1146334_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	2.4e-150
WP_023320733.1|1146596_1147610_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
1146451:1146467	attR	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
WP_004101234.1|1147667_1147769_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_100248259.1|1147768_1147843_+	protein YoaJ	NA	NA	NA	NA	NA
WP_085955747.1|1147983_1148109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004112248.1|1148157_1148421_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_023320731.1|1148549_1149188_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004101221.1|1149277_1150192_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	1.0e-73
WP_023320730.1|1150730_1151519_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004101219.1|1151776_1152298_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004101218.1|1152294_1153242_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_047719968.1|1153339_1155670_+	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_004101215.1|1155750_1156122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719969.1|1156511_1157555_-	type II asparaginase	NA	NA	NA	NA	NA
WP_023320726.1|1157833_1159021_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024274036.1|1159101_1160886_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	2.5e-20
WP_004101200.1|1161082_1161421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101197.1|1161517_1162768_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_023320724.1|1163004_1163655_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004112222.1|1163675_1164152_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017146107.1|1164190_1165297_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	2055216	2098894	6229565	terminase,holin,tRNA,capsid,plate	Enterobacteria_phage(21.57%)	66	NA	NA
WP_047720220.1|2055216_2055804_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	1.1e-33
WP_047720222.1|2055796_2057029_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	51.0	4.6e-106
WP_047721096.1|2057036_2057393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720225.1|2057458_2058112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720228.1|2058114_2058702_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	27.5	2.9e-05
WP_047720230.1|2058691_2059561_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.8	3.0e-27
WP_019725008.1|2059557_2059863_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_047720232.1|2059864_2060704_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	33.1	2.0e-28
WP_047720233.1|2060707_2062606_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	62.6	1.7e-38
WP_047720234.1|2062807_2063284_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	31.1	1.6e-06
WP_047720237.1|2063362_2063893_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	67.2	1.8e-62
WP_023304864.1|2064069_2064513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720240.1|2064512_2065994_-	DUF3383 domain-containing protein	NA	I2GUE7	Acinetobacter_phage	33.0	1.6e-57
WP_047720241.1|2065997_2066549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720243.1|2066530_2066899_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	2.1e-06
WP_047720244.1|2066895_2067459_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	5.7e-19
WP_047720245.1|2067461_2067905_-	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	5.7e-14
WP_047720246.1|2067904_2068231_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	3.6e-10
WP_047720248.1|2068232_2069270_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	1.4e-84
WP_047720249.1|2069269_2069752_-	hypothetical protein	NA	A0A2R3UAX9	Myoviridae_environmental_samples	57.7	1.3e-32
WP_077257936.1|2069753_2071571_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.3	1.2e-57
WP_047720252.1|2071633_2072323_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	51.3	9.6e-61
WP_047720253.1|2072375_2073896_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.8	4.0e-99
WP_047720256.1|2073896_2075573_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.1	3.3e-248
WP_047720257.1|2075574_2076060_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	80.1	9.7e-68
WP_047720260.1|2076091_2076727_-	hypothetical protein	NA	I6S676	Salmonella_phage	80.7	1.6e-102
WP_167879619.1|2077156_2077333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720262.1|2077329_2077872_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	78.1	1.1e-78
WP_031280382.1|2077868_2078168_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_012542610.1|2078649_2079150_-	late gene antiterminator protein	NA	G8C7V7	Escherichia_phage	92.1	8.7e-88
WP_047720267.1|2079146_2079287_-	YlcG family protein	NA	NA	NA	NA	NA
WP_047720268.1|2079283_2079508_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	61.6	7.5e-23
WP_047720270.1|2079504_2080086_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	47.3	1.3e-39
WP_047720271.1|2080078_2080249_-	prophage protein NinE	NA	G8C7V4	Escherichia_phage	73.2	4.3e-15
WP_040239931.1|2080248_2080704_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	2.3e-55
WP_047720274.1|2080904_2081162_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	4.1e-25
WP_158414337.1|2081247_2081403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125961865.1|2081395_2081968_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	45.2	2.1e-13
WP_052959178.1|2082453_2082735_-	hypothetical protein	NA	O64352	Escherichia_phage	72.7	9.1e-10
WP_047720276.1|2082731_2083250_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.1	6.7e-91
WP_052959179.1|2083249_2083873_-	hypothetical protein	NA	Q5G8U8	Enterobacteria_phage	41.1	2.6e-12
WP_047720277.1|2083869_2084295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720280.1|2084848_2085142_-	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.3e-24
WP_047720282.1|2085138_2086008_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.2	4.0e-96
WP_047720283.1|2085992_2086847_-	replication protein	NA	K7PGT1	Enterobacteria_phage	55.7	3.4e-63
WP_004139615.1|2086932_2087154_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004201115.1|2087194_2087422_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_047721102.1|2087533_2088232_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	1.2e-106
WP_047720286.1|2088280_2088604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720289.1|2088600_2089068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176678792.1|2089090_2089297_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	65.7	6.2e-16
WP_019725103.1|2089941_2090136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032431540.1|2090225_2090510_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.5e-39
WP_014342891.1|2090689_2091025_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_023283324.1|2091021_2091645_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.1	7.9e-46
WP_047671926.1|2091641_2092070_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.7	2.6e-64
WP_047720291.1|2092066_2092723_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	6.0e-113
WP_017898877.1|2092719_2092941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720292.1|2092937_2093516_+	morphogenetic protein	NA	M1F3E2	Salmonella_phage	50.5	9.9e-43
WP_025269983.1|2093512_2093704_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_047720295.1|2093700_2093919_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	46.2	1.2e-06
WP_047720296.1|2094071_2094311_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	6.3e-12
WP_004151317.1|2094323_2094659_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004099791.1|2096133_2097000_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
WP_004099787.1|2097001_2097214_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_047720298.1|2097508_2098894_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	7.9e-46
>prophage 5
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	2905193	2974283	6229565	tRNA,integrase,transposase,holin	Salmonella_phage(28.57%)	58	2949415:2949432	2978384:2978401
WP_016807795.1|2905193_2908580_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_047720392.1|2908636_2909584_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_004108679.1|2909596_2910025_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004108682.1|2910021_2910642_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_047720393.1|2910654_2911341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004110265.1|2911360_2911777_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004108688.1|2911794_2912124_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004098218.1|2912375_2912471_+	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_004108691.1|2912594_2913983_+	tryptophanase	NA	NA	NA	NA	NA
WP_004108693.1|2914121_2915378_+	tryptophan permease	NA	NA	NA	NA	NA
WP_004108695.1|2915585_2916593_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004108697.1|2916753_2918151_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	2.6e-20
WP_004108699.1|2918683_2919751_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047720394.1|2919747_2922477_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.0e-20
WP_004108704.1|2922476_2923601_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023320268.1|2923638_2923956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720395.1|2930375_2931500_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004108710.1|2931566_2932442_-	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_004117639.1|2932936_2933716_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024273672.1|2933800_2935144_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_032725825.1|2935185_2936550_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.0e-45
WP_004108719.1|2937114_2938764_+	signal transduction protein	NA	NA	NA	NA	NA
WP_047720396.1|2938908_2940360_+	MFS transporter	NA	NA	NA	NA	NA
WP_004108723.1|2940412_2941516_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_004108725.1|2941539_2942367_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004108727.1|2942360_2943272_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_047720397.1|2943258_2943690_+	heme-binding protein	NA	NA	NA	NA	NA
WP_004117622.1|2943826_2944840_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047720398.1|2945050_2946082_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_032726119.1|2946555_2947260_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_023320260.1|2947548_2947872_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_023320259.1|2948018_2948453_+	VOC family protein	NA	NA	NA	NA	NA
WP_047720400.1|2948618_2949362_+	hypothetical protein	NA	NA	NA	NA	NA
2949415:2949432	attL	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
WP_094146055.1|2950013_2950739_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_049090646.1|2950735_2952076_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_047720401.1|2952075_2952819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302419.1|2952830_2954600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302418.1|2954632_2955262_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_012134292.1|2955258_2956371_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_047720403.1|2956363_2957752_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.6	1.1e-50
WP_047720404.1|2957751_2958024_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_047720406.1|2958658_2959153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153324.1|2959172_2959418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023567062.1|2959746_2961144_-	guanylate cyclase	NA	NA	NA	NA	NA
WP_023567061.1|2961140_2961794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032739149.1|2962278_2962716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720408.1|2962684_2963956_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_047720409.1|2964260_2964929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176678776.1|2964958_2965114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257635.1|2965115_2966084_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	1.3e-172
WP_139153340.1|2966120_2966399_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_071845810.1|2966476_2967763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013815099.1|2967862_2968831_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_024130760.1|2969224_2969638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720411.1|2969735_2970134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720412.1|2970134_2971766_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_047720413.1|2971765_2973076_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_047720415.1|2973077_2974283_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2978384:2978401	attR	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
>prophage 6
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	3486544	3580593	6229565	transposase,head,tRNA,tail,protease,plate	Vibrio_phage(62.16%)	101	NA	NA
WP_004107530.1|3486544_3487075_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004107529.1|3487084_3488419_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
WP_047720474.1|3488623_3489550_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004107523.1|3489642_3490128_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_004107521.1|3490188_3491151_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004107519.1|3491353_3492250_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_004107516.1|3492399_3492903_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_004107514.1|3493052_3493751_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004107505.1|3493747_3495121_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_047721119.1|3495213_3495888_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107495.1|3495959_3496580_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	3.2e-63
WP_004107493.1|3496871_3497906_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_073971822.1|3497911_3498868_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_004107487.1|3498833_3499670_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_047720475.1|3499981_3501448_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_004107479.1|3501444_3502704_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_004107477.1|3502839_3503670_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_004107475.1|3503751_3504738_+	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032729189.1|3506386_3507391_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047720476.1|3507387_3508392_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047720477.1|3508552_3509701_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_004107466.1|3509697_3510012_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_004116819.1|3510066_3511431_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004107462.1|3511534_3512923_-	MFS transporter	NA	NA	NA	NA	NA
WP_004107460.1|3512994_3514005_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047720479.1|3514415_3515795_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_004107456.1|3515897_3516491_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_024274858.1|3516530_3517796_-	MFS transporter	NA	NA	NA	NA	NA
WP_004107452.1|3517837_3519961_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004107449.1|3520075_3521071_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004107447.1|3521146_3521695_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016809579.1|3521795_3522455_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_004107443.1|3522454_3522778_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_004116813.1|3522815_3523850_-	YiiG family protein	NA	NA	NA	NA	NA
WP_024274857.1|3523981_3524533_-	ATPase AAA	NA	NA	NA	NA	NA
WP_004107437.1|3524529_3524967_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_024274856.1|3524976_3525246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004107433.1|3525302_3526145_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_004107430.1|3526131_3527499_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_004107427.1|3527491_3527806_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004116804.1|3527817_3528798_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_157776753.1|3528971_3529202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720480.1|3529334_3531935_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_004107410.1|3532109_3532592_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004107407.1|3532588_3533767_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_047720481.1|3533780_3534278_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_047720482.1|3534289_3535081_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016807439.1|3535143_3535413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807441.1|3537404_3538280_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.0	9.8e-26
WP_016807442.1|3538279_3539092_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	56.1	6.5e-32
WP_016807443.1|3539094_3539679_-	YmfQ family protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
WP_047720484.1|3539663_3540740_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	53.7	2.0e-105
WP_016807445.1|3540726_3541179_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	42.8	8.6e-26
WP_016807446.1|3541175_3541715_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	45.8	1.0e-33
WP_016807447.1|3541705_3542797_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	50.1	5.2e-93
WP_016807448.1|3542789_3544046_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	41.7	3.8e-87
WP_047720486.1|3544045_3545839_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	30.3	1.4e-63
WP_016807450.1|3545937_3546321_-|tail	phage tail assembly protein	tail	A0A2P9JZJ9	Alteromonadaceae_phage	41.3	4.4e-15
WP_047739941.1|3546324_3546678_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_047720679.1|3546687_3548166_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	59.2	2.5e-162
WP_047720680.1|3548167_3548398_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047720681.1|3548400_3549012_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.8	1.0e-37
WP_047720682.1|3549008_3549551_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	4.9e-60
WP_016807456.1|3549550_3549991_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	3.2e-33
WP_016807458.1|3550695_3551598_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	60.9	2.3e-102
WP_016807459.1|3551600_3552572_-	I protein	NA	M1Q578	Vibrio_phage	48.7	1.8e-73
WP_016807460.1|3552804_3553647_-|head	phage head morphogenesis protein	head	M1PVV7	Vibrio_phage	55.4	2.5e-87
WP_139153325.1|3553650_3554094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720489.1|3554077_3555649_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	9.6e-157
WP_044348590.1|3555648_3557238_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	69.8	1.2e-199
WP_044348588.1|3557234_3557810_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	56.8	6.4e-50
WP_044348586.1|3557799_3558084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807465.1|3558086_3558374_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_016807466.1|3558386_3558689_-	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_047720492.1|3558669_3558900_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_047720494.1|3558896_3559508_-	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	3.7e-24
WP_047720495.1|3559495_3559900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720497.1|3560113_3560692_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	3.3e-38
WP_047720498.1|3560795_3561119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720499.1|3561124_3561517_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	63.3	3.8e-38
WP_047720500.1|3561513_3562068_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	45.1	1.1e-35
WP_052959182.1|3562064_3562664_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	45.5	1.1e-12
WP_016807476.1|3562656_3563154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044348544.1|3563234_3563852_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	60.9	3.4e-65
WP_047720501.1|3563867_3564155_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	53.9	4.9e-19
WP_004114539.1|3564157_3564397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720503.1|3564401_3565349_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	77.8	3.0e-137
WP_047720504.1|3565385_3567464_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	46.1	4.2e-168
WP_023301751.1|3567466_3567691_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_047720505.1|3567862_3568501_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004107400.1|3568802_3569645_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_004107397.1|3569867_3570566_+	porin	NA	NA	NA	NA	NA
WP_004107394.1|3570730_3570943_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004107391.1|3571071_3571908_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_123830053.1|3572064_3575115_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004107383.1|3575127_3576030_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_004107380.1|3576026_3576662_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004107377.1|3576990_3577920_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004107374.1|3578234_3579152_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.1	6.7e-17
WP_004107372.1|3579169_3580111_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_004107369.1|3580155_3580593_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	4334604	4390460	6229565	terminase,holin,tRNA,portal,integrase,lysis,tail,plate,capsid,head	Erwinia_phage(34.88%)	62	4349525:4349570	4382312:4382357
WP_004105930.1|4334604_4334937_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_004105929.1|4334973_4336353_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.2e-33
WP_004105928.1|4336593_4337139_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023321656.1|4337378_4338152_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_047720615.1|4338315_4339965_-	glycerone kinase	NA	NA	NA	NA	NA
WP_047720617.1|4340032_4341454_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_004105924.1|4341464_4342097_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_004105923.1|4342107_4343178_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_004105922.1|4343773_4344871_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_174202071.1|4344969_4346889_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_004105920.1|4346947_4348111_-	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
WP_004105919.1|4348135_4348561_-	heme-binding protein	NA	NA	NA	NA	NA
WP_071530277.1|4349104_4349428_+	DUF1889 family protein	NA	NA	NA	NA	NA
4349525:4349570	attL	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_047720619.1|4349729_4351178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720621.1|4351197_4352196_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.5	3.4e-192
WP_047720623.1|4352195_4352771_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_001630878.1|4352900_4353164_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_015959030.1|4353194_4353704_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	4.4e-87
WP_032433679.1|4353711_4353912_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
WP_047720626.1|4353875_4354214_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	8.0e-53
WP_047720628.1|4354281_4354509_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	94.7	2.4e-29
WP_047720629.1|4354508_4354730_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	94.5	6.0e-33
WP_176678794.1|4354878_4356951_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.8	0.0e+00
WP_176678780.1|4357093_4357279_+	Tum protein	NA	A0A218M4I0	Erwinia_phage	78.7	9.2e-19
WP_047720635.1|4357587_4358319_+	hypothetical protein	NA	Q37850	Escherichia_phage	87.2	7.9e-122
WP_047720637.1|4358432_4359230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720639.1|4359608_4360655_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	92.8	7.7e-187
WP_047720640.1|4360654_4362424_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	97.5	0.0e+00
WP_047720642.1|4362589_4363444_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	94.7	1.9e-151
WP_047720643.1|4363519_4364587_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	93.2	6.0e-187
WP_047720645.1|4364591_4365341_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	91.2	2.6e-112
WP_047720648.1|4365434_4365944_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	95.9	6.2e-89
WP_015370176.1|4365943_4366147_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	91.0	8.3e-29
WP_032413163.1|4366149_4366446_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	96.9	2.9e-46
WP_032413164.1|4366432_4366930_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	93.3	3.9e-88
WP_047720651.1|4366926_4367340_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	93.4	2.8e-63
WP_077257940.1|4367311_4367485_+|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	96.5	6.8e-24
WP_047045389.1|4367447_4367915_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	4.2e-84
WP_047720652.1|4367907_4368357_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	93.3	2.0e-67
WP_047720653.1|4368423_4369149_-	UPF0489 family protein	NA	NA	NA	NA	NA
WP_047720654.1|4369279_4369921_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	90.6	4.5e-105
WP_047720655.1|4369917_4370265_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	75.7	1.4e-44
WP_047720656.1|4370269_4371178_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.5	7.8e-111
WP_047720657.1|4371185_4371767_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	50.8	3.5e-48
WP_052959183.1|4371772_4373878_+	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.3	1.2e-109
WP_047720658.1|4373880_4374135_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	53.0	1.0e-15
WP_047720659.1|4374225_4375386_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	48.3	7.8e-47
WP_047720660.1|4375496_4376684_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.4	3.0e-211
WP_047720661.1|4376699_4377218_+|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	5.0e-94
WP_047720662.1|4377281_4377617_+|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	98.2	6.8e-52
WP_000763323.1|4377649_4377769_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_047720663.1|4377761_4380203_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	87.6	0.0e+00
WP_047720664.1|4380217_4380703_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	96.9	1.7e-83
WP_047720665.1|4380699_4381869_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	96.4	3.7e-206
WP_071845060.1|4381935_4382154_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	1.2e-38
WP_004105914.1|4382511_4383018_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4382312:4382357	attR	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_047720666.1|4383014_4384142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720667.1|4384138_4384783_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004105908.1|4385023_4386868_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_016808010.1|4387017_4388760_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.9	3.4e-70
WP_001144069.1|4388993_4389209_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032729227.1|4389446_4390460_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	2.4e-108
>prophage 8
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	4457773	4489291	6229565	plate,transposase,tail,head	Vibrio_phage(66.67%)	43	NA	NA
WP_016807441.1|4457773_4458649_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.0	9.8e-26
WP_016807442.1|4458648_4459461_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	56.1	6.5e-32
WP_047720673.1|4459463_4460048_-	YmfQ family protein	NA	A0A2I7S9L6	Vibrio_phage	47.2	2.8e-45
WP_047720674.1|4460032_4461109_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.6	6.0e-102
WP_019704449.1|4461095_4461548_-	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_047720675.1|4461544_4462084_-|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	45.3	3.0e-33
WP_047720676.1|4462074_4463166_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	48.8	3.2e-90
WP_047720677.1|4463158_4464415_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	41.7	2.9e-87
WP_016807449.1|4464414_4466226_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	32.6	1.8e-69
WP_016807450.1|4466324_4466708_-|tail	phage tail assembly protein	tail	A0A2P9JZJ9	Alteromonadaceae_phage	41.3	4.4e-15
WP_047720678.1|4466711_4467065_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_047720679.1|4467074_4468553_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	59.2	2.5e-162
WP_047720680.1|4468554_4468785_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047720681.1|4468787_4469399_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.8	1.0e-37
WP_047720682.1|4469395_4469938_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	4.9e-60
WP_016807456.1|4469937_4470378_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	3.2e-33
WP_016807458.1|4471082_4471985_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	60.9	2.3e-102
WP_016807459.1|4471987_4472959_-	I protein	NA	M1Q578	Vibrio_phage	48.7	1.8e-73
WP_016807460.1|4473191_4474034_-|head	phage head morphogenesis protein	head	M1PVV7	Vibrio_phage	55.4	2.5e-87
WP_139153325.1|4474037_4474481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720489.1|4474464_4476036_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	9.6e-157
WP_016807463.1|4476035_4477622_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	70.7	4.6e-199
WP_016807464.1|4477621_4478200_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.0	7.6e-51
WP_004114569.1|4478189_4478465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807465.1|4478467_4478755_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_016807466.1|4478764_4479067_-	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_016807467.1|4479047_4479278_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807468.1|4479274_4479886_-	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	2.9e-24
WP_016807469.1|4479873_4480278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807471.1|4480491_4481073_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	45.7	3.9e-39
WP_016807472.1|4481170_4481686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026055841.1|4481688_4482084_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	60.2	7.2e-37
WP_016807474.1|4482086_4482641_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	44.4	1.5e-35
WP_016807475.1|4482637_4483225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807476.1|4483217_4483715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807477.1|4483795_4484413_-	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	61.4	1.2e-65
WP_016807478.1|4484428_4484716_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	53.9	3.8e-19
WP_016807479.1|4484725_4484983_-	hypothetical protein	NA	A0A0U5KSG7	unidentified_phage	48.7	8.6e-15
WP_016807480.1|4484985_4485225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016807481.1|4485229_4486177_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	78.5	4.2e-139
WP_176678781.1|4486213_4488307_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	50.6	5.5e-184
WP_016807483.1|4488309_4488558_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	84.0	1.0e-33
WP_016807484.1|4488721_4489291_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	54.1	7.2e-38
>prophage 9
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	5113998	5141729	6229565	terminase,integrase,holin	Salmonella_phage(36.67%)	37	5109951:5109964	5120378:5120391
5109951:5109964	attL	GAGAGAATCAGATC	NA	NA	NA	NA
WP_047720752.1|5113998_5115228_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	89.0	2.4e-224
WP_047720753.1|5115205_5115496_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	69.7	6.5e-27
WP_071532314.1|5115521_5115761_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	77.9	1.4e-27
WP_032413642.1|5115768_5116077_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	57.8	8.4e-25
WP_047720754.1|5116551_5116905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720755.1|5116939_5118028_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	57.1	8.0e-110
WP_047720756.1|5118039_5120979_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	59.0	3.0e-297
5120378:5120391	attR	GAGAGAATCAGATC	NA	NA	NA	NA
WP_047720757.1|5121282_5121474_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_048257997.1|5121473_5121668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721139.1|5121950_5122511_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	39.5	2.0e-08
WP_032734636.1|5122920_5123241_+	hypothetical protein	NA	H6WRX6	Salmonella_phage	73.6	1.2e-37
WP_032734635.1|5123577_5124495_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	66.1	3.7e-100
WP_047720758.1|5124491_5125235_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.4	3.6e-61
WP_047720759.1|5125227_5125494_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.9	3.5e-11
WP_004103042.1|5125490_5126120_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	48.4	1.7e-43
WP_004103037.1|5126777_5127035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720760.1|5127031_5129113_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	1.4e-203
WP_004178082.1|5129602_5131090_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_024359402.1|5131168_5131402_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	3.7e-25
WP_047720761.1|5131480_5131702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720762.1|5131759_5132359_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.9	3.1e-92
WP_047720763.1|5132358_5132565_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	71.2	9.9e-22
WP_047720764.1|5132567_5132864_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	75.5	4.1e-37
WP_047720765.1|5132860_5133205_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	73.2	1.0e-39
WP_094298915.1|5133201_5133339_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	63.6	5.4e-08
WP_047720766.1|5133335_5134019_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	1.1e-64
WP_139153329.1|5134643_5135147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720768.1|5135245_5135638_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.7	1.0e-43
WP_047720769.1|5135627_5135906_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	77.2	4.8e-35
WP_047720770.1|5135905_5136535_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.0	3.1e-106
WP_047720771.1|5136542_5136818_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	54.4	1.7e-16
WP_029669831.1|5136768_5136963_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	4.1e-25
WP_047720772.1|5136959_5137253_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	1.3e-30
WP_047720773.1|5137316_5138300_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	46.2	1.5e-38
WP_047720774.1|5138301_5139894_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	40.6	3.0e-97
WP_014837912.1|5139894_5140116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257951.1|5140157_5141729_+	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.4	2.1e-55
>prophage 10
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	5159529	5168606	6229565		Klebsiella_phage(28.57%)	7	NA	NA
WP_042946229.1|5159529_5159787_-	hypothetical protein	NA	L0ARW5	Klebsiella_phage	49.4	3.2e-17
WP_052959185.1|5159790_5161482_-	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.3	1.9e-102
WP_047720785.1|5161557_5162136_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	88.5	4.5e-88
WP_004178082.1|5162566_5164054_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178082.1|5164475_5165963_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_047720786.1|5166279_5166600_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	4.1e-22
WP_004104577.1|5166806_5168606_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.7	5.0e-24
>prophage 11
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	5492231	5599551	6229565	terminase,transposase,holin,portal,integrase,lysis,tail,capsid,protease,head	Enterobacteria_phage(33.33%)	100	5490198:5490214	5578950:5578966
5490198:5490214	attL	CAGCGCGGGCGAGCGCA	NA	NA	NA	NA
WP_004114163.1|5492231_5492723_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004103976.1|5493052_5494159_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_127472320.1|5494181_5494484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720825.1|5495540_5498030_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.5	6.6e-19
WP_004114157.1|5498384_5499158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024274503.1|5499150_5501091_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.2	1.0e-54
WP_024274502.1|5501350_5501611_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004114150.1|5501610_5503044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720826.1|5503050_5506416_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_047720827.1|5507220_5508501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720828.1|5508754_5509933_-|integrase	phage integrase SAM-like domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	28.8	4.8e-28
WP_045419636.1|5509935_5510145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720829.1|5510188_5510758_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	72.5	2.2e-79
WP_047720830.1|5511216_5511414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720831.1|5511413_5511941_-	hypothetical protein	NA	A0A0P0ZCH9	Stx2-converting_phage	65.3	5.1e-62
WP_004123003.1|5512073_5512901_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	85.8	3.0e-133
WP_047721149.1|5512957_5513329_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	8.3e-59
WP_176678784.1|5514117_5514774_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	58.1	1.8e-69
WP_004122998.1|5514865_5515063_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.3	1.6e-16
WP_047720832.1|5515090_5515648_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.2	1.4e-65
WP_032741919.1|5515644_5515842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721152.1|5515897_5516542_+	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	50.7	4.3e-47
WP_032423246.1|5516543_5516723_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_004122995.1|5516719_5517598_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	57.7	1.7e-33
WP_004122994.1|5517594_5517852_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	75.0	3.3e-22
WP_047720833.1|5517851_5518736_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	71.8	7.4e-122
WP_047720834.1|5518728_5520576_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.4	4.0e-202
WP_047720835.1|5520572_5521634_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	3.3e-100
WP_071845044.1|5521646_5522249_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.5	2.4e-76
WP_047720836.1|5522478_5522910_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	37.3	7.4e-19
WP_047043763.1|5522934_5523117_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_139153342.1|5523358_5523688_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	89.9	5.1e-52
WP_047720838.1|5523674_5524094_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.4	7.4e-40
WP_047720839.1|5524096_5524564_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	63.2	1.7e-45
WP_047720840.1|5524794_5525025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153332.1|5525808_5526066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720841.1|5526522_5526708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720842.1|5526798_5527131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720843.1|5527130_5527550_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	53.6	5.2e-33
WP_047720844.1|5527843_5528389_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	87.2	1.1e-86
WP_047720845.1|5528363_5530286_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	89.7	0.0e+00
WP_015367380.1|5530285_5530492_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	88.1	6.7e-26
WP_047720846.1|5530488_5532081_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	86.6	6.3e-273
WP_047720847.1|5532061_5533393_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	73.2	2.6e-171
WP_047720848.1|5533402_5533735_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	80.0	5.1e-44
WP_047720849.1|5533802_5534828_+|capsid	major capsid protein	capsid	K7P6G7	Enterobacteria_phage	92.7	2.6e-179
WP_047720850.1|5534878_5535298_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	51.5	4.1e-22
WP_047720851.1|5535308_5535662_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	66.7	1.8e-42
WP_077257944.1|5535670_5536255_+|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	77.8	2.5e-78
WP_047720852.1|5536251_5536650_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	76.5	4.1e-56
WP_047720853.1|5536656_5537400_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	85.4	2.8e-114
WP_077257945.1|5537410_5537839_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	59.3	8.7e-36
WP_071845045.1|5537859_5538174_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	76.0	2.3e-41
WP_047720854.1|5538157_5541304_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	75.9	0.0e+00
WP_047720855.1|5541354_5541702_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	62.6	2.0e-35
WP_047720856.1|5541698_5542454_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.5	3.7e-130
WP_047720857.1|5542455_5543193_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.6	8.2e-135
WP_126488854.1|5543198_5543471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720858.1|5543560_5544151_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.0	3.0e-79
WP_047720859.1|5544216_5553429_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	41.6	0.0e+00
WP_047720860.1|5553469_5554612_+|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	33.3	9.8e-18
WP_004178082.1|5555044_5556532_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004122957.1|5556638_5557022_+	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	90.6	5.2e-64
WP_004114147.1|5557278_5559039_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_004133900.1|5559058_5559286_-	YejL family protein	NA	NA	NA	NA	NA
WP_004114145.1|5559464_5560472_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.2	9.1e-84
WP_004103958.1|5560521_5561280_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004103956.1|5561360_5561954_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004114143.1|5562015_5562300_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_004103954.1|5562437_5564195_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.5	4.9e-101
WP_004103953.1|5564343_5565063_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004103952.1|5565059_5566256_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.4	2.1e-23
WP_004103951.1|5566586_5566931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004103950.1|5566934_5568524_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.4	1.4e-17
WP_004103948.1|5568525_5569551_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004103946.1|5569550_5570645_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_032704881.1|5570654_5572460_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004103944.1|5572530_5574093_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_004103943.1|5574277_5574847_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	3.1e-12
WP_024274498.1|5575273_5575987_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004103941.1|5576023_5577001_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_004103940.1|5577120_5578587_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	28.9	1.5e-42
WP_004103935.1|5578902_5579475_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
5578950:5578966	attR	TGCGCTCGCCCGCGCTG	NA	NA	NA	NA
WP_004103933.1|5579621_5579873_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_032704880.1|5579898_5581080_-	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_047720861.1|5581410_5582541_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_004103928.1|5582541_5583480_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004114117.1|5583496_5585185_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_047721156.1|5585510_5586446_+	pseudouridine kinase	NA	NA	NA	NA	NA
WP_004103922.1|5586438_5587374_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_004103919.1|5587470_5588721_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_004103916.1|5588755_5589844_-	sugar kinase	NA	NA	NA	NA	NA
WP_004103914.1|5589845_5590703_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.1	6.9e-24
WP_047720862.1|5590799_5591849_-	YeiH family protein	NA	NA	NA	NA	NA
WP_004103910.1|5592021_5592894_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016809573.1|5592872_5593361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720863.1|5593360_5593843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004103903.1|5594048_5595518_+	amino acid permease	NA	NA	NA	NA	NA
WP_004114107.1|5595822_5597796_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
WP_085949440.1|5598181_5599551_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
>prophage 12
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	5912757	5993259	6229565	terminase,holin,portal,integrase,tail,plate,capsid,protease,head	Enterobacteria_phage(26.32%)	97	5954785:5954844	5991382:5991505
WP_047720900.1|5912757_5913792_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.7	9.8e-126
WP_047720901.1|5913791_5914022_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047720902.1|5914359_5914755_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	78.6	1.2e-52
WP_047720903.1|5915397_5915736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720904.1|5915736_5916054_-	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	51.4	1.3e-17
WP_047720905.1|5916046_5916391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162556077.1|5916387_5916549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720906.1|5916545_5917334_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	3.1e-63
WP_047720907.1|5917333_5917633_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.2e-13
WP_047720908.1|5917721_5918639_-	recombination-associated protein RdgC	NA	A0A1Y0SUG1	Pseudomonas_phage	34.1	1.1e-38
WP_047720909.1|5918955_5920113_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	28.9	2.4e-35
WP_047720910.1|5920283_5920766_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.9	1.3e-11
WP_071845047.1|5920868_5921138_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	52.1	5.9e-14
WP_047720911.1|5921396_5921852_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.1	5.5e-65
WP_071845048.1|5922089_5922302_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	1.7e-16
WP_047720912.1|5922258_5923173_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	4.0e-30
WP_047720913.1|5923169_5923979_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	71.5	1.2e-115
WP_047720914.1|5923988_5924378_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	72.9	6.9e-48
WP_047720915.1|5924392_5925088_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	64.7	8.2e-76
WP_047720916.1|5925084_5926065_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.1e-134
WP_047720917.1|5926083_5926428_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	83.2	3.3e-54
WP_047720918.1|5926953_5927880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004121584.1|5928149_5928545_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	93.9	3.2e-61
WP_017145564.1|5928531_5928813_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.3e-37
WP_047720919.1|5928812_5929442_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.3e-104
WP_047720920.1|5929449_5929725_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	4.4e-25
WP_047720921.1|5930006_5930372_+	hypothetical protein	NA	L7TH90	Pseudomonas_virus	53.6	5.5e-15
WP_047720923.1|5930778_5931024_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	59.3	3.6e-18
WP_032419453.1|5931084_5931435_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_047720924.1|5931593_5932091_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
WP_047720925.1|5932094_5933846_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	72.0	8.8e-252
WP_047720926.1|5933842_5934004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720927.1|5933993_5935220_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	8.4e-209
WP_032439289.1|5935212_5935812_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	5.9e-91
WP_047720928.1|5935821_5937060_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	68.0	1.0e-153
WP_047720929.1|5937137_5937455_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	54.9	6.7e-25
WP_047720930.1|5937463_5937802_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	2.4e-41
WP_047720931.1|5937798_5938248_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	3.3e-62
WP_032750781.1|5938244_5938592_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	2.3e-31
WP_047720932.1|5938648_5939359_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	68.2	7.5e-85
WP_047720933.1|5939389_5939794_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.7	5.5e-32
WP_047720934.1|5939796_5940102_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_015370209.1|5940177_5940561_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	2.3e-32
WP_047720935.1|5940630_5944038_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	41.8	3.9e-187
WP_047720936.1|5944059_5944533_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
WP_017145580.1|5944519_5944996_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.1	6.7e-53
WP_016809748.1|5945008_5945389_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.7	1.3e-59
WP_047720937.1|5948540_5950673_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	36.9	2.0e-11
WP_047720938.1|5950675_5952076_+	hypothetical protein	NA	W6E8G0	Rhizobium_phage	29.7	2.8e-14
WP_004178082.1|5952525_5954013_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_047720940.1|5954329_5954659_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	2.5e-22
5954785:5954844	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGG	NA	NA	NA	NA
WP_047720941.1|5954972_5955980_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	55.6	3.9e-103
WP_047720942.1|5955992_5956400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720944.1|5956778_5957024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720945.1|5957045_5957675_-	membrane protein	NA	NA	NA	NA	NA
WP_077257946.1|5957684_5958113_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	40.2	3.7e-10
WP_047720947.1|5958153_5958366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720948.1|5958368_5958611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437051.1|5958633_5958837_+	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	8.3e-05
WP_071845051.1|5958846_5959050_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	66.1	5.2e-15
WP_047720949.1|5959063_5959303_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_047720950.1|5959299_5959578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720951.1|5959646_5959871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720952.1|5959867_5960434_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.1	2.1e-13
WP_047720953.1|5960666_5961620_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	57.9	2.3e-89
WP_176678787.1|5961888_5962062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158414348.1|5962071_5962227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071845053.1|5962202_5963345_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	50.4	8.1e-97
WP_047720956.1|5963337_5965935_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.6	4.0e-192
WP_047720957.1|5966136_5966889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720958.1|5967367_5968429_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	8.5e-141
WP_047720959.1|5968422_5970150_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	69.5	2.5e-238
WP_047720960.1|5970306_5971146_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	4.3e-95
WP_047720961.1|5971155_5972190_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.7	1.1e-95
WP_047720962.1|5972238_5973096_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.9	1.3e-70
WP_047720963.1|5973208_5973724_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_047724057.1|5973723_5973924_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	61.5	7.9e-16
WP_047720965.1|5974194_5974740_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	2.4e-30
WP_158414347.1|5974926_5975262_+	peptidase	NA	NA	NA	NA	NA
WP_032411298.1|5975262_5975730_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_047720967.1|5975726_5976362_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	5.0e-56
WP_047720968.1|5976358_5976946_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	59.5	5.9e-59
WP_047720969.1|5976942_5977293_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	1.8e-26
WP_047720970.1|5977294_5978218_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	8.4e-52
WP_047720971.1|5978207_5981237_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
WP_032445019.1|5981233_5981449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720973.1|5982876_5983749_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_047720975.1|5983998_5984490_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	1.3e-54
WP_047720977.1|5984505_5987511_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.4	7.8e-232
WP_053086776.1|5987497_5987635_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_047720979.1|5987655_5987967_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	53.3	8.5e-17
WP_047720980.1|5988012_5988528_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_047720981.1|5988527_5989697_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	5.1e-155
WP_047720983.1|5989848_5990982_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	69.5	3.9e-144
WP_071845063.1|5991025_5991277_+	ogr/Delta-like zinc finger family protein	NA	Q858U4	Yersinia_virus	44.6	1.0e-07
WP_004103451.1|5991636_5992524_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
5991382:5991505	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGGATAAAAGCAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_004103450.1|5992590_5993259_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	65.5	9.5e-05
>prophage 13
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	6102909	6129706	6229565	terminase,holin	Escherichia_phage(28.95%)	49	NA	NA
WP_047720995.1|6102909_6104193_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	56.3	7.1e-142
WP_047721168.1|6104226_6104478_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	44.4	6.0e-13
WP_047720996.1|6104519_6104744_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	5.9e-12
WP_047720997.1|6104740_6105610_-	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	41.5	5.1e-59
WP_047720998.1|6105606_6105798_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	66.1	6.0e-13
WP_047720999.1|6105794_6106331_-	hypothetical protein	NA	J9Q748	Salmonella_phage	70.9	1.8e-70
WP_047721000.1|6106327_6106546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721001.1|6106542_6107202_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.7	1.0e-115
WP_043875719.1|6107198_6107426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046878446.1|6107422_6107581_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	69.2	2.2e-13
WP_047721002.1|6107577_6108258_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.3e-123
WP_047721003.1|6108254_6109100_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	2.6e-68
WP_047721004.1|6109115_6109400_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	71.3	5.4e-34
WP_047721005.1|6109407_6110409_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	6.8e-39
WP_071845055.1|6110488_6110695_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	95.6	8.1e-32
WP_047721006.1|6110687_6110876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052959190.1|6111171_6111453_-	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	61.7	1.0e-08
WP_047721007.1|6111690_6111972_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	82.8	3.9e-37
WP_176678789.1|6112114_6112837_-	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	63.2	2.5e-75
WP_047721009.1|6112905_6113133_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	53.7	2.2e-14
WP_047721010.1|6113173_6113494_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	8.5e-36
WP_165473733.1|6113493_6113643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435255.1|6113873_6114602_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_047721011.1|6114598_6115378_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.7	2.6e-94
WP_047721012.1|6115374_6115680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071458385.1|6115676_6116189_+	hypothetical protein	NA	K7PJM1	Enterobacteria_phage	51.6	3.7e-25
WP_047721013.1|6116466_6116736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052959187.1|6116732_6117212_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_047721014.1|6117384_6118140_+	DUF551 domain-containing protein	NA	O64350	Escherichia_phage	63.6	4.5e-11
WP_047721015.1|6118224_6118422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153335.1|6118611_6118884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721017.1|6119215_6119473_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.4	5.4e-25
WP_047721018.1|6119674_6120124_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.3	5.3e-36
WP_071532248.1|6120116_6120287_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	69.6	5.7e-15
WP_047721019.1|6120279_6120918_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.3	5.7e-76
WP_047721020.1|6120914_6121055_+	YlcG family protein	NA	NA	NA	NA	NA
WP_042934016.1|6121051_6121549_+	antiterminator	NA	G8C7V7	Escherichia_phage	92.7	1.9e-87
WP_139153343.1|6122010_6122310_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	8.4e-46
WP_004136189.1|6122306_6122849_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	77.5	5.8e-77
WP_047721022.1|6122845_6123190_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	74.6	2.0e-35
WP_047721023.1|6123186_6123462_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	5.4e-15
WP_047721026.1|6123603_6123897_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	2.6e-31
WP_047721174.1|6123960_6124440_+	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	59.1	1.2e-54
WP_025108058.1|6124515_6124761_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	56.8	2.0e-16
WP_047721175.1|6124990_6125206_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	73.2	3.1e-26
WP_047720773.1|6125293_6126277_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	46.2	1.5e-38
WP_047721029.1|6126278_6127871_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	40.6	3.0e-97
WP_014837912.1|6127871_6128093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257953.1|6128134_6129706_+	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.8	2.8e-55
>prophage 14
NZ_CP011618	Klebsiella oxytoca strain CAV1335 chromosome, complete genome	6229565	6149355	6156191	6229565		Pseudomonas_phage(33.33%)	6	NA	NA
WP_047721037.1|6149355_6149934_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.1	2.0e-88
WP_004178082.1|6150364_6151852_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178082.1|6152273_6153761_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_041147657.1|6153840_6154260_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_047721039.1|6154261_6155527_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	1.1e-208
WP_047721040.1|6155519_6156191_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.6e-79
>prophage 1
NZ_CP011617	Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence	115319	5	66792	115319	integrase,transposase,protease	Salmonella_phage(37.5%)	56	5987:6044	66825:66882
WP_000050481.1|5_1547_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|1951_2791_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|2784_3132_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3295_4087_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845039.1|4232_5246_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001044210.1|5892_6033_-	hypothetical protein	NA	NA	NA	NA	NA
5987:6044	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|6038_6743_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032413363.1|7689_8682_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427623.1|9085_10090_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_071571074.1|10652_10823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075209834.1|11314_12283_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	9.7e-184
WP_148662571.1|12396_13122_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.6	6.8e-33
WP_032413394.1|13216_14236_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_032413397.1|14232_15177_+	ectoine utilization protein EutC	NA	A0A1V0SL93	Klosneuvirus	23.0	7.8e-13
WP_032413223.1|15868_16885_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032413215.1|18135_18672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900946.1|20992_22003_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_023287153.1|22732_23899_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_004117790.1|23898_24870_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_032413223.1|27645_28662_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_043875877.1|29609_30173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|30159_30402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|30449_30914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946349.1|30923_31331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413230.1|31373_32333_+	DNA replication protein	NA	NA	NA	NA	NA
WP_004181760.1|32329_33088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|33084_33408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719752.1|33558_33876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413233.1|33941_35078_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004178082.1|35163_36651_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_016946352.1|37163_37418_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_043875876.1|37503_38565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026560.1|38885_39785_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
WP_003100847.1|40103_40661_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|40654_41026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|41022_41523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|41519_41846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|42100_42457_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|42446_42848_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|42844_43135_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_047719753.1|43293_46260_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_022542389.1|46338_47343_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032413243.1|50351_51287_+|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
WP_004210306.1|51759_52242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186895.1|52484_52799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413246.1|53407_54808_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004210304.1|55174_55657_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_032413408.1|55670_56672_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_032413247.1|56631_57741_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_032413249.1|57751_58315_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032413250.1|58311_59274_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_032413253.1|59285_59576_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_032413255.1|59593_60859_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032413257.1|60839_62510_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.8	1.5e-35
WP_077257929.1|64124_65093_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	6.3e-183
WP_176678774.1|65823_66792_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.1e-184
66825:66882	attR	ATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 2
NZ_CP011617	Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence	115319	77145	85038	115319	transposase	uncultured_Caudovirales_phage(85.71%)	8	NA	NA
WP_022652343.1|77145_78114_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_000125668.1|78333_79737_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|79769_80474_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|80560_80881_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|80926_82216_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|82228_82654_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|82713_83541_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|83559_85038_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
>prophage 1
NZ_CP011616	Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-118, complete sequence	117623	1601	12629	117623		Salmonella_phage(70.0%)	18	NA	NA
WP_047719725.1|1601_2213_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	71.2	3.4e-78
WP_047719726.1|2395_2620_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	51.4	1.5e-15
WP_052959161.1|3190_3754_+	ribonuclease H	NA	J9Q745	Salmonella_phage	39.1	1.1e-30
WP_047719727.1|4407_4833_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	77.3	4.1e-54
WP_047719728.1|4832_4988_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_076752079.1|5051_5801_+	Rha family transcriptional regulator	NA	J9Q7T3	Salmonella_phage	64.3	5.9e-80
WP_047719619.1|5887_6322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719620.1|6377_6695_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_047719621.1|6846_7140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719622.1|7321_7972_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	48.1	5.2e-56
WP_047719623.1|7981_8281_-	hypothetical protein	NA	A0A192Y8D4	Enterobacteria_phage	34.3	3.1e-08
WP_047719624.1|8416_8677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719625.1|8673_9324_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	54.2	2.4e-53
WP_047719626.1|9427_11095_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	64.6	1.2e-210
WP_047719627.1|11103_11283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719628.1|11324_11936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719629.1|12009_12237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719630.1|12308_12629_+	hypothetical protein	NA	J9Q750	Salmonella_phage	69.8	1.3e-41
>prophage 2
NZ_CP011616	Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-118, complete sequence	117623	18121	78758	117623	capsid,tail,transposase,portal,terminase	Salmonella_phage(86.05%)	59	NA	NA
WP_047719639.1|18121_18766_-	hypothetical protein	NA	J9Q754	Salmonella_phage	49.8	1.3e-51
WP_139153313.1|19397_19931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139153314.1|19995_20349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719642.1|20394_21972_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	70.9	1.6e-212
WP_047719643.1|22037_22751_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	65.7	1.7e-84
WP_047719644.1|22734_23409_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	64.8	3.4e-71
WP_047719645.1|23401_24043_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	85.3	2.9e-96
WP_047719646.1|24032_24590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719647.1|24586_25477_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	78.1	2.1e-137
WP_047719648.1|25486_25753_+	hypothetical protein	NA	J9Q757	Salmonella_phage	76.1	1.0e-31
WP_047719649.1|25922_26513_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	61.3	6.5e-58
WP_047719650.1|26512_27769_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	88.5	1.5e-229
WP_047719651.1|27800_29375_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	73.0	5.2e-227
WP_047719652.1|29387_30254_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	56.1	2.1e-76
WP_047719653.1|30283_31156_+|capsid	phage capsid protein	capsid	J9Q710	Salmonella_phage	81.4	1.0e-131
WP_047719654.1|31229_31673_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	44.6	2.8e-21
WP_047719655.1|31714_32140_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	63.6	1.2e-42
WP_047719656.1|32139_32973_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	48.9	7.0e-74
WP_047719657.1|32983_33328_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	57.0	5.5e-33
WP_047719658.1|33318_33813_+	hypothetical protein	NA	J9Q711	Salmonella_phage	51.2	1.4e-34
WP_077257922.1|33809_34193_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	44.4	1.7e-30
WP_047719660.1|34285_34726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719662.1|35674_35992_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	66.7	4.8e-31
WP_047719731.1|36117_36345_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	76.7	4.0e-24
WP_047719663.1|36349_40852_+	tape measure protein	NA	J9Q712	Salmonella_phage	36.8	2.7e-188
WP_047719664.1|40898_41234_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	70.0	1.3e-42
WP_047719665.1|41288_41987_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	75.2	2.5e-101
WP_047719666.1|41976_42780_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	74.8	7.9e-115
WP_047719667.1|42767_43379_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	57.1	3.6e-59
WP_047719753.1|54499_57466_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001247892.1|57624_57915_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|57911_58313_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|58302_58659_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|58913_59240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|59236_59737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|59733_60105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|60098_60656_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_047739741.1|60760_62044_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.3	1.9e-49
WP_047719668.1|62091_63636_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	40.1	2.8e-44
WP_009484919.1|63718_64033_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	69.8	2.3e-33
WP_047719669.1|64043_64736_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	77.6	1.4e-99
WP_047719670.1|64732_64984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719672.1|65174_66362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719673.1|66510_67176_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	75.2	4.1e-93
WP_047719674.1|67180_67555_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	54.3	9.9e-20
WP_047719675.1|67883_68630_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	55.2	4.4e-75
WP_047719676.1|68668_70030_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	69.8	1.6e-179
WP_047719677.1|70165_71281_+	DNA primase catalytic core, N-terminal domain protein	NA	J9Q720	Salmonella_phage	66.6	8.9e-149
WP_047719678.1|71346_72255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719679.1|72341_72797_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	42.4	4.6e-27
WP_047719680.1|72793_73258_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_047719681.1|73257_74586_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	71.5	4.4e-187
WP_047719682.1|74582_74798_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	57.1	2.2e-16
WP_047719683.1|74952_75204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719685.1|76351_76963_+	hypothetical protein	NA	S4TP42	Salmonella_phage	35.1	6.6e-21
WP_047719686.1|77172_77643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257924.1|77821_78259_+	DUF2829 domain-containing protein	NA	K4N0H8	Escherichia_phage	43.0	1.2e-21
WP_047719687.1|78255_78501_+	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	56.8	2.3e-17
WP_047719688.1|78512_78758_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	42.3	2.2e-12
>prophage 3
NZ_CP011616	Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-118, complete sequence	117623	83607	117210	117623		Salmonella_phage(92.31%)	35	NA	NA
WP_047719695.1|83607_85578_+	hypothetical protein	NA	J9Q7G6	Salmonella_phage	44.2	5.5e-125
WP_047719696.1|85674_86913_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	61.0	2.8e-143
WP_052959164.1|87090_89463_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	67.0	7.3e-310
WP_052959165.1|89533_90694_+	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	61.1	1.5e-138
WP_047719697.1|90690_91113_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	38.5	1.2e-13
WP_047719698.1|91550_92261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719699.1|92421_92862_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	46.9	7.8e-32
WP_047719700.1|92928_93909_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	45.6	9.5e-62
WP_047719701.1|93969_94932_+	exonuclease	NA	J9Q7S6	Salmonella_phage	64.1	4.5e-117
WP_047719702.1|94928_95189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719703.1|95206_96244_+	recombinase	NA	J9Q736	Salmonella_phage	74.8	6.1e-152
WP_047719737.1|96230_96950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719704.1|97034_97238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719705.1|97234_98062_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	78.2	5.7e-100
WP_052959167.1|98200_98938_+	hypothetical protein	NA	G4KK93	Yersinia_phage	33.0	6.3e-26
WP_047719706.1|99220_99475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052959174.1|99615_99822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153316.1|100005_100353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719710.1|100828_101953_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	48.3	2.7e-76
WP_047719711.1|102271_102919_+	hypothetical protein	NA	J9Q739	Salmonella_phage	55.2	6.0e-65
WP_047719712.1|103155_104241_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	71.8	1.5e-148
WP_047719713.1|104237_106154_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	61.8	2.7e-214
WP_047719714.1|106143_106842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719715.1|106858_107431_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	58.7	9.8e-59
WP_047719739.1|107513_109844_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	70.7	0.0e+00
WP_052959168.1|109939_110344_+	DUF2591 family protein	NA	NA	NA	NA	NA
WP_047719716.1|110357_111500_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	80.0	1.3e-179
WP_052959175.1|111693_112440_+	hypothetical protein	NA	J9Q742	Salmonella_phage	51.0	1.6e-61
WP_047719718.1|112636_113728_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	59.2	3.1e-130
WP_047719719.1|113729_114143_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	38.4	3.1e-14
WP_176678773.1|114151_114616_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	53.9	5.2e-42
WP_052959171.1|114612_115263_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	37.7	8.6e-27
WP_047719721.1|115316_115724_+	hypothetical protein	NA	J9Q743	Salmonella_phage	37.6	9.8e-13
WP_047719722.1|115720_116263_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	58.7	3.6e-55
WP_139153317.1|116346_117210_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	42.1	4.3e-26
>prophage 1
NZ_CP011614	Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-92, complete sequence	92095	16218	57525	92095	protease,integrase,transposase	Escherichia_phage(37.5%)	40	30879:30938	40412:41232
WP_000845048.1|16218_17232_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|17380_17914_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_004206941.1|17993_18782_+	APH(3') family aminoglycoside O-phosphotransferase AphA16	NA	E4ZFP6	Streptococcus_phage	47.2	1.4e-60
WP_032420064.1|18905_19751_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001007673.1|19780_20608_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_000679427.1|20743_21091_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|21084_21924_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|22051_22552_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|23058_23823_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_032622530.1|24118_24424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060613126.1|24407_24767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032622536.1|25065_25710_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000427619.1|26825_27830_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032622532.1|27908_30875_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
30879:30938	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|30930_31635_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|32130_33144_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|33435_33990_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|34120_34951_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|35088_35721_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|35805_36258_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|36480_36828_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|36821_37661_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_047715689.1|37788_38289_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|38795_39560_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|39714_40419_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000522996.1|41498_41924_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
40412:41232	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTGCTCCAGCACCTCGATGCCCTCGGCACGGAAAGCGGCTGTCACCGCCTCGCCGATGGCCGGGTCTTCACGGAAGAACAAGGTATTGCGCGCCAGGGCCGTGACCTTGCTGCCCAGCCGGGCAAAGGCTTGCGCCAGCTCCAGCGCCACCACCGACGAGCCGATTACGGCAAGGCGTTCGGGAATGGTGTCGCTCGCCAGGGCCTCGGTGGAAGTCCAGTAGGGTGACTCTTTCAAGCCCGGAATCGGCGGGACCGCCGGGCTGGCACCCGTGGCGACCAGGCAGCGGTCGAACATCACGACGCGCTCGCCACCCTCGTTCAAACTAACGATAAGGCTCTGGTCGTCCTTGAAACGCGCTTCACCGTGCAGAACGGTGATGGCTGAATTGCCGTCCAGGATGCCTTCGTACTTGGCATGACGGAGTTCTTCGACACGGGCCTGCTGCTGGGCCAGCAGCCGCTCGCGCAAGATCGTCGGCGGTGTGGGTGGCATGCCGCCGTCGAATGGGCTTTCCCGGCGCAGATGGGCGATGTGGGCGGCGCGGATCATGATCTTGGACGGCACACAACCGACGTTGACGCAGGTGCCGCCGATGGTGCCGCGCTCAATCAGCGTGACCTGCGCGCCTTGCTCGACGGCCTTCAGTGCTGCCGCCATCGCGGCTCCACCGCTACCAATGACGACGACCTGCAACGGGCGTTCGTTGCCACTGGGCTTATCAGCGGCCCCTATCCAGCCGCGCATCTTGTCGAGCAGGCC	NA	NA	NA	NA
WP_000732275.1|41951_42227_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|42242_42608_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|42679_43135_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000654805.1|44521_45490_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_032491180.1|45610_46471_+	class A extended-spectrum beta-lactamase SHV-30	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|46491_47253_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004206881.1|47360_50258_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
WP_000509966.1|50352_50958_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206885.1|51540_53628_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_004206886.1|53640_54591_-	DsbC family protein	NA	NA	NA	NA	NA
WP_004206887.1|54601_55864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257921.1|55908_56184_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004206889.1|56408_56792_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004206890.1|56871_57525_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP011615	Klebsiella oxytoca strain CAV1335 plasmid pKPC_CAV1335, complete sequence	113105	40502	100115	113105	transposase	uncultured_Caudovirales_phage(15.38%)	54	NA	NA
WP_139153319.1|40502_41667_+|transposase	IS3-like element ISKpn37 family transposase	transposase	Q716C2	Shigella_phage	48.0	1.3e-73
WP_003830760.1|42569_43349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274510.1|43402_43822_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104877.1|43832_44054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085947.1|44053_44731_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_000334635.1|45082_45754_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_000600201.1|45933_46356_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_000457553.1|46355_47627_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
WP_000756331.1|47772_48744_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
WP_000817638.1|48740_49946_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_003830762.1|50553_52380_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
WP_000695683.1|52551_52902_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
WP_000725002.1|53050_53482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059177.1|53718_55188_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
WP_000697973.1|55189_55870_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
WP_000475508.1|56059_57445_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001246157.1|57473_57827_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000168542.1|57918_59211_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000574019.1|59221_62368_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	2.3e-61
WP_000758233.1|62454_62895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003830763.1|63013_65467_+	Ag(+)-translocating P-type ATPase SilP	NA	E4ZFI9	Streptococcus_phage	34.9	1.3e-80
WP_000843500.1|65497_65695_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001667049.1|65725_66466_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E5G070	Clostridium_phage	33.3	8.0e-13
WP_000688485.1|66749_67196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719746.1|67430_69248_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001667050.1|69253_70141_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_000906228.1|70180_70561_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_001667051.1|70565_71495_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_001188929.1|71548_72229_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	35.4	2.1e-31
WP_000671200.1|72225_73626_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	8.3e-19
WP_000753365.1|73834_74269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091963.1|74681_75278_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.4	1.4e-20
WP_000728912.1|75401_76331_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-75
WP_000176304.1|76327_76939_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000429587.1|76935_77331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003830765.1|77383_78247_-	3'-5' exoribonuclease	NA	K7RFY5	Vibrio_phage	35.4	1.1e-26
WP_001247114.1|78239_79355_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152391.1|79590_81306_-	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152392.1|81415_84445_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|84551_85577_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|85573_86353_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|86739_87621_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|87870_89190_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_047719748.1|89521_90004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110156.1|90077_91055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114211.1|91345_91699_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.6	1.7e-24
WP_000855178.1|91746_92109_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001010162.1|92126_93878_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000922626.1|93922_95212_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	8.7e-172
WP_000065805.1|95224_95650_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_162862902.1|95681_97433_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000034288.1|97459_97822_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_001000741.1|97897_98443_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022542389.1|99110_100115_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
