The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	110985	155045	4881003	portal,protease,terminase,tail,integrase,tRNA	Enterobacteria_phage(28.26%)	55	105528:105543	163444:163459
105528:105543	attL	CTTACCCGGCCTACAT	NA	NA	NA	NA
WP_032620558.1|110985_112023_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_032620560.1|112110_113205_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	83.7	1.4e-178
WP_032620563.1|113424_113670_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.2e-20
WP_128754880.1|113653_113920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620566.1|114027_114579_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	67.0	2.7e-66
WP_103848176.1|115427_116009_-|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.3	4.3e-46
WP_162269496.1|116301_116529_+	hypothetical protein	NA	E4WL44	Enterobacteria_phage	89.3	2.9e-30
WP_032620567.1|116724_120654_-|tail	phage tail protein	tail	M9P0D8	Enterobacteria_phage	89.4	0.0e+00
WP_128754879.1|120718_121198_-	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.0	7.9e-78
WP_032620570.1|121283_121901_-|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.0	2.6e-105
WP_032620572.1|121893_122613_-	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	97.9	9.8e-141
WP_032620573.1|122615_123353_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	6.1e-146
WP_032620574.1|123408_123747_-|tail	tail protein	tail	E4WL34	Enterobacteria_phage	99.1	5.2e-60
WP_032620577.1|123743_127004_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	97.7	0.0e+00
WP_071842901.1|126987_127302_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_032620580.1|127310_127751_-|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_032620582.1|127761_128505_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_001704117.1|128514_128916_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_020884618.1|128912_129491_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_032620586.1|129500_129776_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	97.5	1.2e-38
WP_032620588.1|129768_130095_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	96.3	2.5e-51
WP_158650950.1|130177_132184_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	98.8	0.0e+00
WP_032620589.1|132128_133628_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.4	2.5e-287
WP_032620591.1|133624_133840_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	9.4e-31
WP_032620593.1|133836_135939_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	99.3	0.0e+00
WP_020884621.1|135938_136427_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	98.1	6.5e-80
WP_080288384.1|136611_137289_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	54.9	2.3e-35
WP_032620596.1|137645_137870_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.1	1.1e-18
WP_032620598.1|137899_138421_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	3.7e-73
WP_032620601.1|138417_138954_-	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	7.7e-90
WP_014832171.1|138953_139256_-	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_032620604.1|140218_140824_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.9	7.6e-70
WP_032620605.1|140840_141908_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	1.4e-106
WP_032620607.1|141904_143836_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	5.6e-199
WP_047715965.1|143828_145166_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	6.3e-117
WP_047715957.1|145168_146032_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	80.0	1.8e-56
WP_047715956.1|146028_146208_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	55.1	1.0e-06
WP_032634315.1|146209_146854_-	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	51.2	5.7e-47
WP_032634277.1|147083_147641_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.0	4.0e-65
WP_032634276.1|147684_147885_-	transcriptional regulator	NA	U5P445	Shigella_phage	84.6	3.5e-24
WP_032634275.1|147973_148648_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.2	1.1e-114
WP_047715955.1|148816_149017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032665243.1|148988_149243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154232880.1|149241_149397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620624.1|149755_150127_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	3.8e-56
WP_032620626.1|150182_151013_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	90.1	4.0e-138
WP_032620628.1|151148_151691_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.7	3.5e-74
WP_032620630.1|151675_151876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620631.1|151872_152199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620632.1|152195_152927_+	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.2	1.0e-84
WP_032620633.1|152923_153121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620634.1|153120_153690_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	74.6	7.6e-80
WP_032620635.1|153728_154001_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	9.1e-39
WP_032620638.1|154035_154497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044488948.1|154502_155045_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.5	3.7e-07
163444:163459	attR	CTTACCCGGCCTACAT	NA	NA	NA	NA
>prophage 2
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	1279523	1321903	4881003	portal,lysis,terminase,head,capsid,tail,integrase,plate,tRNA	Erwinia_phage(38.1%)	49	1274048:1274067	1328921:1328940
1274048:1274067	attL	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
WP_032618958.1|1279523_1281083_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.6e-08
WP_017382401.1|1281079_1281574_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017692642.1|1281719_1282484_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_017692643.1|1282484_1283654_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_032618959.1|1284010_1285027_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	95.0	8.6e-191
WP_080288393.1|1285026_1285599_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	74.1	1.8e-76
WP_032618960.1|1285723_1285987_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	93.1	5.0e-42
WP_032618962.1|1286017_1286527_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	91.7	8.6e-83
WP_071842907.1|1286534_1286735_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	1.3e-29
WP_032618963.1|1286698_1287037_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	3.6e-53
WP_032618964.1|1287103_1287331_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	70.1	4.8e-17
WP_032618966.1|1287330_1287552_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	94.4	1.1e-31
WP_032618967.1|1287538_1289767_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.6	0.0e+00
WP_032665232.1|1289889_1290087_+	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	71.4	1.5e-11
WP_032618969.1|1290211_1291261_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.9	5.7e-105
WP_032618970.1|1291304_1293263_-	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	NA	NA	NA	NA
WP_047715938.1|1293689_1294715_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.7	7.9e-168
WP_032618972.1|1294716_1296486_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.2	6.1e-301
WP_032618973.1|1296651_1297506_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	1.9e-114
WP_047715936.1|1297561_1298617_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	82.8	3.8e-165
WP_032618975.1|1298620_1299376_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.5	9.8e-75
WP_023295250.1|1299475_1299982_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	4.4e-63
WP_017382979.1|1299981_1300185_+|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_032618977.1|1300175_1300397_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_023295248.1|1300380_1300893_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_032618978.1|1300889_1301321_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	78.3	2.8e-58
WP_032618979.1|1301320_1301737_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	2.1e-42
WP_032618981.1|1301832_1302300_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	2.3e-58
WP_032618983.1|1302292_1302742_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.8	4.7e-48
WP_032618984.1|1302810_1303446_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.7	8.2e-99
WP_032618985.1|1303442_1303793_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	6.2e-40
WP_032618987.1|1303798_1304707_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_032620226.1|1304699_1305230_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	2.4e-91
WP_044489085.1|1305241_1307590_+|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	49.2	3.0e-114
WP_032618988.1|1307591_1308023_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.1	7.0e-17
WP_023323582.1|1308397_1309591_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_017382996.1|1309603_1310122_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032618991.1|1310179_1310503_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_032665230.1|1310535_1310658_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	7.7e-14
WP_032618993.1|1310647_1313098_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.1	9.3e-308
WP_032618994.1|1313108_1313573_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	2.1e-59
WP_032618995.1|1313569_1314739_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.5	2.5e-170
WP_063132245.1|1314804_1315023_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	5.4e-34
WP_032618996.1|1315045_1315693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384024.1|1315972_1316479_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015571912.1|1316579_1318424_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_032618997.1|1318576_1320322_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|1320437_1320653_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015571911.1|1320889_1321903_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
1328921:1328940	attR	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
>prophage 3
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	1379841	1416349	4881003	integrase,transposase	Stx2-converting_phage(20.0%)	25	1368833:1368847	1381785:1381799
1368833:1368847	attL	TTTCCAGAACGTCCC	NA	NA	NA	NA
WP_007897923.1|1379841_1381089_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007897920.1|1381075_1382842_+	hypothetical protein	NA	NA	NA	NA	NA
1381785:1381799	attR	GGGACGTTCTGGAAA	NA	NA	NA	NA
WP_017384059.1|1382829_1384947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|1384950_1385379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|1385469_1386616_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000019450.1|1386900_1387881_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_017384068.1|1388151_1389285_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_003846917.1|1390366_1391620_-	lactose permease	NA	NA	NA	NA	NA
WP_007894989.1|1391671_1394746_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_007851507.1|1394867_1395950_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_032435706.1|1396319_1397312_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427614.1|1397715_1398720_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_007898884.1|1398981_1399260_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898888.1|1399590_1399884_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_004152282.1|1399982_1400750_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|1400750_1401707_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004118243.1|1401703_1402702_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_007898890.1|1402698_1403601_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_022652364.1|1403645_1405970_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_023304425.1|1406056_1407010_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_016151347.1|1407006_1407528_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_007896426.1|1408771_1410097_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_022649395.1|1410250_1411219_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_016151369.1|1413382_1413733_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_000227969.1|1415272_1416349_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	1794761	1826215	4881003	integrase,transposase,protease	Salmonella_phage(16.67%)	26	1791853:1791872	1832104:1832123
1791853:1791872	attL	AATGTAGGCCGGGTAAGGCG	NA	NA	NA	NA
WP_080288382.1|1794761_1795730_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	5.1e-185
WP_032619181.1|1795794_1798392_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_032619182.1|1798402_1800472_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_071842894.1|1800586_1801213_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001618770.1|1801343_1802759_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001618769.1|1802885_1803098_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	4.2e-07
WP_001618768.1|1803223_1804102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|1804552_1805700_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_001067212.1|1807131_1807977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|1808257_1808464_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001019190.1|1808484_1808784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619186.1|1809079_1810282_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032619187.1|1810274_1811579_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032619190.1|1811575_1813450_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001625709.1|1813464_1813851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619191.1|1813947_1814373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619193.1|1814409_1814724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619194.1|1814743_1815130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619196.1|1815660_1816851_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_032620260.1|1816819_1817197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619198.1|1817373_1818735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047685188.1|1819462_1819669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128302277.1|1819672_1820575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050019407.1|1820896_1823032_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080288391.1|1823065_1824787_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	22.9	9.6e-17
WP_032619204.1|1824943_1826215_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.5	1.4e-214
1832104:1832123	attR	CGCCTTACCCGGCCTACATT	NA	NA	NA	NA
>prophage 5
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	1873399	1897889	4881003	integrase,transposase	Enterobacteria_phage(40.0%)	30	1861728:1861743	1888494:1888509
1861728:1861743	attL	ACCGCATCGCGCAGTT	NA	NA	NA	NA
WP_006176728.1|1873399_1873975_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_015572138.1|1874006_1874657_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_023304255.1|1874656_1875610_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_006811609.1|1875606_1876083_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_006811608.1|1876514_1877744_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_022651668.1|1877721_1878006_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_017692869.1|1878052_1878295_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_032619244.1|1878281_1878893_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.0	1.8e-42
WP_022651666.1|1878927_1880013_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_032619246.1|1880022_1883082_-	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.5	0.0e+00
WP_022651664.1|1883204_1883492_-	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_022651663.1|1883575_1883734_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
WP_022651662.1|1883743_1883929_-	YebW family protein	NA	NA	NA	NA	NA
WP_032619247.1|1884048_1884234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017693529.1|1884425_1884839_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.2e-07
WP_032619249.1|1885192_1885735_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	55.6	4.3e-48
WP_032619250.1|1886170_1887163_+	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032619251.1|1887146_1887839_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
WP_032619252.1|1887850_1888582_+	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
1888494:1888509	attR	AACTGCGCGATGCGGT	NA	NA	NA	NA
WP_032619253.1|1888568_1888829_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	62.5	7.9e-24
WP_032619254.1|1888825_1889305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619256.1|1889306_1889564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489041.1|1889560_1891636_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.6e-199
WP_032619258.1|1891683_1892442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619259.1|1892705_1892939_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	79.2	1.2e-28
WP_032619262.1|1893345_1893945_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	87.3	2.9e-98
WP_155858305.1|1894153_1894306_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	100.0	4.4e-19
WP_085949497.1|1894307_1895455_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_164474130.1|1895705_1895846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003860714.1|1896083_1897889_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
>prophage 6
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	2361636	2372449	4881003		Hokovirus(12.5%)	9	NA	NA
WP_032619353.1|2361636_2363055_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	8.9e-61
WP_032619354.1|2363164_2364535_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
WP_032619355.1|2364700_2366107_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
WP_032619357.1|2366196_2367282_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	8.2e-99
WP_017693099.1|2367282_2368164_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_032619358.1|2368402_2369569_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
WP_032619359.1|2369618_2370623_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	1.9e-33
WP_032619360.1|2370817_2371798_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_017693103.1|2371837_2372449_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
>prophage 7
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	2472336	2552382	4881003	portal,protease,terminase,holin,tail,coat,integrase,plate	Enterobacteria_phage(14.29%)	91	2466052:2466067	2485276:2485291
2466052:2466067	attL	CATTCAGGTGCCGGAG	NA	NA	NA	NA
WP_032619465.1|2472336_2473350_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	69.0	5.6e-134
WP_032619466.1|2473349_2473571_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_032619467.1|2473630_2473873_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_032619468.1|2473859_2475764_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	29.8	7.3e-18
WP_032619469.1|2475986_2476259_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.2	2.7e-14
WP_155858306.1|2476645_2476816_-	hypothetical protein	NA	A0A1I9SEJ3	Klebsiella_phage	50.9	4.7e-09
WP_032619471.1|2477101_2477593_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	55.0	1.4e-16
WP_032619472.1|2477665_2477935_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.2e-08
WP_032620290.1|2477934_2478387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619473.1|2478409_2479327_+	hypothetical protein	NA	U5P0A0	Shigella_phage	40.0	2.4e-51
WP_032619474.1|2479329_2480070_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.3	1.1e-99
WP_032619475.1|2480087_2480744_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	26.9	3.2e-13
WP_032619476.1|2480939_2481173_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	2.8e-12
WP_032620293.1|2481703_2482057_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	92.5	5.4e-52
WP_032619477.1|2482242_2482566_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	7.0e-30
WP_164474158.1|2482744_2482912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619479.1|2483051_2483348_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	59.1	2.6e-23
WP_032619481.1|2485156_2485513_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.3	9.1e-39
2485276:2485291	attR	CATTCAGGTGCCGGAG	NA	NA	NA	NA
WP_032619482.1|2485509_2486115_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	1.2e-75
WP_032619483.1|2486453_2486858_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_044489029.1|2486854_2487151_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_032619484.1|2487147_2487777_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	5.1e-101
WP_032620296.1|2487784_2488060_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	1.6e-22
WP_032619486.1|2488185_2488443_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
WP_020690713.1|2488591_2488795_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_032619487.1|2488867_2489095_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
WP_032619488.1|2489283_2489544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619489.1|2489819_2490323_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_032619490.1|2490326_2492447_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	9.2e-304
WP_023299859.1|2492443_2492659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619491.1|2492667_2494188_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.3e-153
WP_103848174.1|2494180_2496238_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
WP_032619492.1|2496306_2496642_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_023303463.1|2496641_2496998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023299864.1|2496999_2497662_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.9e-21
WP_023303465.1|2497670_2498225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619493.1|2498217_2498841_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
WP_032619495.1|2498879_2500349_+|tail	tail protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
WP_032619497.1|2500345_2500852_+|tail	tail protein	tail	NA	NA	NA	NA
WP_032619498.1|2500903_2501191_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032619500.1|2503434_2503905_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_032620301.1|2503879_2504095_+|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619501.1|2504097_2505216_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	7.8e-36
WP_032619502.1|2505252_2505606_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_032619503.1|2505589_2506504_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	1.6e-58
WP_032619504.1|2506496_2507048_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_050019395.1|2507050_2509228_+	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.9	3.9e-55
WP_032619505.1|2509227_2509806_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_032619506.1|2509882_2510953_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032619507.1|2510993_2511398_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_012906750.1|2511419_2511599_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032619509.1|2511882_2513157_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032619510.1|2513153_2513687_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017384434.1|2515346_2515670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619511.1|2515699_2516626_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384432.1|2516631_2517102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619512.1|2517267_2517984_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	6.6e-12
WP_015570244.1|2517980_2518856_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_023303913.1|2518852_2520127_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003859667.1|2520138_2521053_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003859669.1|2521121_2522243_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859671.1|2522654_2523323_+	YecA family protein	NA	NA	NA	NA	NA
WP_032620305.1|2523639_2524851_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859673.1|2525042_2525279_+	YecH family protein	NA	NA	NA	NA	NA
WP_003859676.1|2525315_2525813_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_015570249.1|2526013_2526352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859680.1|2526597_2527236_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_017384426.1|2527278_2528697_-	MFS transporter	NA	NA	NA	NA	NA
WP_003859682.1|2528911_2528995_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_003859683.1|2529101_2529353_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_017693227.1|2529433_2530777_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_032619513.1|2530918_2531422_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_017384423.1|2531925_2532483_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_017384422.1|2532800_2533790_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_032619514.1|2533861_2535376_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.2	6.9e-11
WP_003859689.1|2535390_2536371_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_023303910.1|2536524_2537328_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_015570257.1|2537302_2538727_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_017384418.1|2538742_2539171_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_006811111.1|2539958_2540318_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003859695.1|2540320_2540899_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003859696.1|2541022_2541910_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_017693230.1|2541906_2542836_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_017384416.1|2542840_2544850_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003859699.1|2544869_2545373_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_023303909.1|2545469_2546729_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_023303908.1|2547156_2547729_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_015570265.1|2547736_2548285_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032619515.1|2548301_2549063_+	molecular chaperone	NA	NA	NA	NA	NA
WP_023303905.1|2549038_2551423_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017384412.1|2551419_2552382_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	3442436	3500978	4881003	portal,protease,head,terminase,capsid,tail,holin,integrase,tRNA	Enterobacterial_phage(33.33%)	77	3462553:3462568	3498205:3498220
WP_032619843.1|3442436_3443720_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	2.5e-09
WP_022650865.1|3443980_3444301_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
WP_154232874.1|3444288_3444528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032636446.1|3444622_3445936_-	hypothetical protein	NA	K7PH95	Enterobacterial_phage	52.6	2.7e-112
WP_017382566.1|3445994_3446228_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_032619848.1|3446335_3447007_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	9.9e-87
WP_022651029.1|3447007_3447322_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_032619850.1|3447365_3451211_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	62.7	0.0e+00
WP_032619853.1|3451263_3451851_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	3.6e-48
WP_022648880.1|3451850_3452561_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_032619855.1|3452563_3453322_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	3.9e-95
WP_022648882.1|3453318_3453657_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032620356.1|3453659_3456962_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	84.9	0.0e+00
WP_032619857.1|3457019_3457361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619858.1|3457416_3457695_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|3457703_3458087_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|3458095_3458539_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|3458598_3458946_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_022648888.1|3459388_3459727_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_032619860.1|3459735_3460062_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_023296252.1|3460105_3461317_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619863.1|3461326_3462175_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_032619865.1|3462188_3463493_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
3462553:3462568	attL	TGCGTCAGGAACTGGA	NA	NA	NA	NA
WP_032619866.1|3463492_3465250_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
WP_032619868.1|3465249_3465723_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619870.1|3465880_3466231_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_032619873.1|3466230_3466821_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	77.6	9.3e-89
WP_032619877.1|3466802_3468260_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.2	2.0e-278
WP_032619880.1|3468346_3468607_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	40.2	2.5e-09
WP_047715785.1|3468855_3469050_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	1.3e-18
WP_032619884.1|3469000_3469276_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	96.0	9.3e-07
WP_032619887.1|3469272_3469815_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
WP_000220248.1|3469811_3470093_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_032264642.1|3470089_3470494_-	exported phage-related protein	NA	NA	NA	NA	NA
WP_032619892.1|3470721_3471525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619895.1|3471561_3471924_-	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	90.8	3.4e-57
WP_032619897.1|3471938_3472928_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	92.1	4.2e-182
WP_050595702.1|3472924_3473650_-	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	1.1e-54
WP_032619898.1|3473665_3474055_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.9	2.9e-62
WP_032619899.1|3474051_3474375_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	90.4	4.1e-46
WP_032619900.1|3474371_3475031_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	77.9	2.3e-96
WP_032619901.1|3475030_3475525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634002.1|3475521_3476400_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	81.4	1.7e-38
WP_032619902.1|3476389_3476569_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_023315870.1|3476732_3477287_-	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_071842884.1|3477315_3477567_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_032619903.1|3477601_3478354_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	70.1	4.5e-80
WP_032619905.1|3478401_3478836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620359.1|3478935_3479145_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	6.6e-13
WP_032103842.1|3479172_3479382_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	75.0	3.0e-18
WP_032620361.1|3480101_3480515_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.2	5.2e-54
WP_032619906.1|3480514_3481342_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	85.6	1.5e-121
WP_032620364.1|3481939_3482284_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
WP_032619908.1|3482363_3482633_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	1.5e-30
WP_022650818.1|3482665_3482929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619909.1|3482903_3484046_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_015570783.1|3484265_3484766_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_015570785.1|3485174_3486506_+	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
WP_032619910.1|3486521_3488558_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003857881.1|3488664_3489111_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_017384695.1|3489094_3489886_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384696.1|3489985_3491173_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_032619911.1|3491204_3491912_-	CTP synthase	NA	NA	NA	NA	NA
WP_015570789.1|3492063_3492408_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|3492408_3492714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015570791.1|3492794_3493049_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032619912.1|3493360_3494389_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.4	2.5e-12
WP_015570793.1|3494434_3494533_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|3494533_3494608_+	protein YoaJ	NA	NA	NA	NA	NA
WP_003857896.1|3494661_3494910_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071524166.1|3495279_3495372_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_023296321.1|3495496_3496996_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_015570796.1|3497000_3497246_-	YmjA family protein	NA	NA	NA	NA	NA
WP_003857898.1|3497321_3498572_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
3498205:3498220	attR	TCCAGTTCCTGACGCA	NA	NA	NA	NA
WP_032619914.1|3498689_3499352_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032619915.1|3499351_3499825_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032103856.1|3499865_3500978_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP011581	Enterobacter hormaechei strain CAV1411 chromosome, complete genome	4881003	4722762	4728882	4881003	integrase,transposase	Enterobacteria_phage(75.0%)	9	4716937:4716950	4733116:4733129
4716937:4716950	attL	GGAGCTGATGGCGA	NA	NA	NA	NA
WP_032620857.1|4722762_4723212_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
WP_032620855.1|4723204_4723504_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
WP_032620854.1|4723496_4724051_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.1	1.5e-35
WP_026094409.1|4724047_4724314_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_032620852.1|4724876_4725620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023323621.1|4725622_4725841_+	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_017692853.1|4725869_4726433_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_022649395.1|4726699_4727668_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_047715722.1|4727685_4728882_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.8	2.0e-69
4733116:4733129	attR	TCGCCATCAGCTCC	NA	NA	NA	NA
>prophage 1
NZ_CP011580	Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence	90452	0	43328	90452	transposase,integrase	Escherichia_phage(25.0%)	38	17972:17987	43871:43886
WP_023302476.1|0_867_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
WP_006797591.1|1792_2998_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_023302473.1|2997_3972_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
WP_023302472.1|4053_5325_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
WP_006796638.1|5324_5756_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_074144872.1|6087_7056_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.1e-178
WP_032413487.1|7117_7453_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_017900922.1|7625_7904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047722369.1|8166_9120_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
WP_023302470.1|9289_9910_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
WP_074142348.1|10748_11717_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	92.2	1.0e-172
WP_004152397.1|14862_16182_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|16431_17313_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|17511_18291_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
17972:17987	attL	ATCAGCACCACGTTCT	NA	NA	NA	NA
WP_004199214.1|18287_19313_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|19419_22449_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|22558_24274_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001235713.1|25388_25946_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|26128_26989_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_003032490.1|27151_27541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493700.1|28566_28776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|29253_30258_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_010981353.1|30336_30771_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_077269372.1|30700_31054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761850.1|31068_31707_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|31818_32184_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_005413392.1|32180_32417_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010981356.1|32432_32753_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_010981357.1|32791_33406_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_011405615.1|33466_34684_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|34680_35589_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010791757.1|35591_37274_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_031623923.1|37689_38703_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	5.2e-71
WP_001206316.1|38848_39640_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|39803_40151_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|40144_40984_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|41111_41612_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047715681.1|41789_43328_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	7.9e-47
43871:43886	attR	ATCAGCACCACGTTCT	NA	NA	NA	NA
