The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	207367	213487	4876110	integrase,transposase	Enterobacteria_phage(75.0%)	9	202319:202332	214318:214331
202319:202332	attL	CGCACTGGTTGCAG	NA	NA	NA	NA
WP_047715722.1|207367_208564_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.8	2.0e-69
WP_022649395.1|208581_209550_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_017692853.1|209816_210380_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_023323621.1|210408_210627_-	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_032620852.1|210629_211373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026094409.1|211935_212202_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_032620854.1|212198_212753_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.1	1.5e-35
WP_032620855.1|212745_213045_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
WP_032620857.1|213037_213487_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
214318:214331	attR	CTGCAACCAGTGCG	NA	NA	NA	NA
>prophage 2
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	1434260	1492802	4876110	head,holin,tRNA,portal,capsid,tail,integrase,protease,terminase	Enterobacterial_phage(33.33%)	77	1437019:1437034	1472671:1472686
WP_032103856.1|1434260_1435373_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_032619915.1|1435413_1435887_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032619914.1|1435886_1436549_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|1436666_1437917_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
1437019:1437034	attL	TGCGTCAGGAACTGGA	NA	NA	NA	NA
WP_015570796.1|1437992_1438238_+	YmjA family protein	NA	NA	NA	NA	NA
WP_023296321.1|1438242_1439742_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_071524166.1|1439866_1439959_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|1440328_1440577_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1440630_1440705_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|1440705_1440804_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032619912.1|1440849_1441878_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.4	2.5e-12
WP_015570791.1|1442189_1442444_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|1442524_1442830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570789.1|1442830_1443175_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_032619911.1|1443326_1444034_+	CTP synthase	NA	NA	NA	NA	NA
WP_017384696.1|1444065_1445253_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_017384695.1|1445352_1446144_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|1446127_1446574_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_032619910.1|1446680_1448717_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_015570785.1|1448732_1450064_-	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
WP_015570783.1|1450472_1450973_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032619909.1|1451192_1452335_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_022650818.1|1452309_1452573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619908.1|1452605_1452875_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	1.5e-30
WP_032620364.1|1452954_1453299_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
WP_032619906.1|1453896_1454724_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	85.6	1.5e-121
WP_032620361.1|1454723_1455137_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.2	5.2e-54
WP_032103842.1|1455856_1456066_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	75.0	3.0e-18
WP_032620359.1|1456093_1456303_-	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	6.6e-13
WP_032619905.1|1456402_1456837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619903.1|1456884_1457637_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	70.1	4.5e-80
WP_071842884.1|1457671_1457923_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_023315870.1|1457951_1458506_+	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_032619902.1|1458669_1458849_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_032634002.1|1458838_1459717_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	81.4	1.7e-38
WP_032619901.1|1459713_1460208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619900.1|1460207_1460867_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	77.9	2.3e-96
WP_032619899.1|1460863_1461187_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	90.4	4.1e-46
WP_032619898.1|1461183_1461573_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.9	2.9e-62
WP_050595702.1|1461588_1462314_+	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	1.1e-54
WP_032619897.1|1462310_1463300_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	92.1	4.2e-182
WP_032619895.1|1463314_1463677_+	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	90.8	3.4e-57
WP_032619892.1|1463713_1464517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032264642.1|1464744_1465149_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_000220248.1|1465145_1465427_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_032619887.1|1465423_1465966_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
WP_032619884.1|1465962_1466238_+	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	96.0	9.3e-07
WP_047715785.1|1466188_1466383_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	1.3e-18
WP_032619880.1|1466631_1466892_-	hypothetical protein	NA	A0A089FW14	Salmonella_phage	40.2	2.5e-09
WP_032619877.1|1466978_1468436_+	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.2	2.0e-278
WP_032619873.1|1468417_1469008_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	77.6	9.3e-89
WP_032619870.1|1469007_1469358_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_032619868.1|1469515_1469989_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619866.1|1469988_1471746_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
WP_032619865.1|1471745_1473050_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
1472671:1472686	attR	TCCAGTTCCTGACGCA	NA	NA	NA	NA
WP_032619863.1|1473063_1473912_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_023296252.1|1473921_1475133_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619860.1|1475176_1475503_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_022648888.1|1475511_1475850_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_022648886.1|1476292_1476640_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_006809155.1|1476699_1477143_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_001549114.1|1477151_1477535_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_032619858.1|1477543_1477822_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_032619857.1|1477877_1478219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620356.1|1478276_1481579_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	84.9	0.0e+00
WP_022648882.1|1481581_1481920_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032619855.1|1481916_1482675_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	3.9e-95
WP_022648880.1|1482677_1483388_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_032619853.1|1483387_1483975_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	3.6e-48
WP_032619850.1|1484027_1487873_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	62.7	0.0e+00
WP_022651029.1|1487916_1488231_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_032619848.1|1488231_1488903_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	9.9e-87
WP_017382566.1|1489010_1489244_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_032636446.1|1489302_1490616_+	hypothetical protein	NA	K7PH95	Enterobacterial_phage	52.6	2.7e-112
WP_154232874.1|1490710_1490950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650865.1|1490937_1491258_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
WP_032619843.1|1491518_1492802_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	2.5e-09
>prophage 3
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	2364064	2459021	4876110	coat,plate,holin,tRNA,portal,tail,protease,integrase,terminase	Salmonella_phage(12.77%)	103	2415400:2415415	2460238:2460253
WP_032619517.1|2364064_2365798_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	8.8e-87
WP_026080697.1|2365832_2366972_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_017693238.1|2366976_2368560_-	MFS transporter	NA	NA	NA	NA	NA
WP_023303901.1|2368820_2369213_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_023303902.1|2369212_2371291_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006811100.1|2371283_2372432_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_003859718.1|2372582_2373227_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763862.1|2373237_2373627_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
WP_014884341.1|2373644_2374694_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_017384409.1|2374690_2375557_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_017693235.1|2375576_2377178_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_023303904.1|2377222_2378890_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
WP_017384412.1|2378975_2379938_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303905.1|2379934_2382319_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032619515.1|2382294_2383056_-	molecular chaperone	NA	NA	NA	NA	NA
WP_015570265.1|2383072_2383621_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303908.1|2383628_2384201_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_023303909.1|2384628_2385888_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003859699.1|2385984_2386488_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017384416.1|2386507_2388517_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_017693230.1|2388521_2389451_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003859696.1|2389447_2390335_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003859695.1|2390458_2391037_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006811111.1|2391039_2391399_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_017384418.1|2392186_2392615_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_015570257.1|2392630_2394055_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_023303910.1|2394029_2394833_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003859689.1|2394986_2395967_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_032619514.1|2395981_2397496_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.2	6.9e-11
WP_017384422.1|2397567_2398557_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_017384423.1|2398874_2399432_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_032619513.1|2399935_2400439_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_017693227.1|2400580_2401924_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003859683.1|2402004_2402256_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_003859682.1|2402362_2402446_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_017384426.1|2402660_2404079_+	MFS transporter	NA	NA	NA	NA	NA
WP_003859680.1|2404121_2404760_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_015570249.1|2405005_2405344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859676.1|2405544_2406042_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_003859673.1|2406078_2406315_-	YecH family protein	NA	NA	NA	NA	NA
WP_032620305.1|2406506_2407718_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859671.1|2408034_2408703_-	YecA family protein	NA	NA	NA	NA	NA
WP_003859669.1|2409114_2410236_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859667.1|2410304_2411219_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023303913.1|2411230_2412505_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_015570244.1|2412501_2413377_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_032619512.1|2413373_2414090_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.1e-11
WP_017384432.1|2414255_2414726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619511.1|2414731_2415658_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2415400:2415415	attL	TGCGAAATACCCGGCA	NA	NA	NA	NA
WP_017384434.1|2415687_2416011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619510.1|2417670_2418204_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_032619509.1|2418200_2419475_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_012906750.1|2419758_2419938_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032619507.1|2419959_2420364_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_032619506.1|2420404_2421475_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032619505.1|2421551_2422130_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_050019395.1|2422129_2424307_-	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.9	3.9e-55
WP_032619504.1|2424309_2424861_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_032619503.1|2424853_2425768_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	1.6e-58
WP_032619502.1|2425751_2426105_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_032619501.1|2426141_2427260_-	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	7.8e-36
WP_032620301.1|2427262_2427478_-|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619500.1|2427452_2427923_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_032619498.1|2430166_2430454_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032619497.1|2430505_2431012_-|tail	tail protein	tail	NA	NA	NA	NA
WP_032619495.1|2431008_2432478_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
WP_032619493.1|2432516_2433140_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
WP_023303465.1|2433132_2433687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023299864.1|2433695_2434358_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.9e-21
WP_023303463.1|2434359_2434716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619492.1|2434715_2435051_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_103848174.1|2435119_2437177_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
WP_032619491.1|2437169_2438690_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.3e-153
WP_023299859.1|2438698_2438914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619490.1|2438910_2441031_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	9.2e-304
WP_032619489.1|2441034_2441538_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_032619488.1|2441813_2442074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619487.1|2442262_2442490_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
WP_020690713.1|2442562_2442766_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_032619486.1|2442914_2443172_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
WP_032620296.1|2443297_2443573_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	1.6e-22
WP_032619484.1|2443580_2444210_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	5.1e-101
WP_044489029.1|2444206_2444503_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_032619483.1|2444499_2444904_-	exported phage-related protein	NA	NA	NA	NA	NA
WP_032619482.1|2445242_2445848_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	1.2e-75
WP_032619481.1|2445844_2446201_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.3	9.1e-39
WP_032619479.1|2448009_2448306_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	59.1	2.6e-23
WP_164474158.1|2448445_2448613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619477.1|2448791_2449115_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	7.0e-30
WP_032620293.1|2449300_2449654_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	92.5	5.4e-52
WP_032619476.1|2450184_2450418_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	2.8e-12
WP_032619475.1|2450613_2451270_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	26.9	3.2e-13
WP_032619474.1|2451287_2452028_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.3	1.1e-99
WP_032619473.1|2452030_2452948_-	hypothetical protein	NA	U5P0A0	Shigella_phage	40.0	2.4e-51
WP_032620290.1|2452970_2453423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619472.1|2453422_2453692_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.2e-08
WP_032619471.1|2453764_2454256_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	55.0	1.4e-16
WP_155858306.1|2454541_2454712_+	hypothetical protein	NA	A0A1I9SEJ3	Klebsiella_phage	50.9	4.7e-09
WP_032619469.1|2455098_2455371_+	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.2	2.7e-14
WP_032619468.1|2455593_2457498_+	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	29.8	7.3e-18
WP_032619467.1|2457484_2457727_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_032619466.1|2457786_2458008_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_032619465.1|2458007_2459021_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	69.0	5.6e-134
2460238:2460253	attR	TGCGAAATACCCGGCA	NA	NA	NA	NA
>prophage 4
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	2558908	2569721	4876110		Bodo_saltans_virus(12.5%)	9	NA	NA
WP_017693103.1|2558908_2559520_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_032619360.1|2559559_2560540_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_032619359.1|2560734_2561739_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	1.9e-33
WP_032619358.1|2561788_2562955_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
WP_017693099.1|2563193_2564075_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_032619357.1|2564075_2565161_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	8.2e-99
WP_032619355.1|2565250_2566657_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
WP_032619354.1|2566822_2568193_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
WP_032619353.1|2568302_2569721_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	8.9e-61
>prophage 5
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	3033468	3057958	4876110	integrase,transposase	Enterobacteria_phage(40.0%)	30	3051018:3051031	3059067:3059080
WP_003860714.1|3033468_3035274_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_164474130.1|3035511_3035652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3035902_3037049_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_155858305.1|3037051_3037204_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	100.0	4.4e-19
WP_032619262.1|3037412_3038012_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	87.3	2.9e-98
WP_032619259.1|3038418_3038652_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	79.2	1.2e-28
WP_032619258.1|3038915_3039674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489041.1|3039721_3041797_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.6e-199
WP_032619256.1|3041793_3042051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619254.1|3042052_3042532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619253.1|3042528_3042789_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	62.5	7.9e-24
WP_032619252.1|3042775_3043507_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_032619251.1|3043518_3044211_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
WP_032619250.1|3044194_3045187_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032619249.1|3045622_3046165_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	55.6	4.3e-48
WP_017693529.1|3046518_3046932_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.2e-07
WP_032619247.1|3047123_3047309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651662.1|3047428_3047614_+	YebW family protein	NA	NA	NA	NA	NA
WP_022651663.1|3047623_3047782_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
WP_022651664.1|3047865_3048153_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_032619246.1|3048275_3051335_+	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.5	0.0e+00
3051018:3051031	attL	AGCCTGCGCGCCAG	NA	NA	NA	NA
WP_022651666.1|3051344_3052430_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_032619244.1|3052464_3053076_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.0	1.8e-42
WP_017692869.1|3053062_3053305_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_022651668.1|3053351_3053636_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_006811608.1|3053613_3054843_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_006811609.1|3055274_3055751_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_023304255.1|3055747_3056701_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572138.1|3056700_3057351_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3057382_3057958_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
3059067:3059080	attR	CTGGCGCGCAGGCT	NA	NA	NA	NA
>prophage 6
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	3093889	3136596	4876110	tRNA,integrase,protease,transposase	Staphylococcus_phage(14.29%)	40	3099235:3099254	3139486:3139505
WP_014832949.1|3093889_3094657_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015571575.1|3094688_3095228_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3095243_3095492_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3095608_3096970_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_013098352.1|3097061_3097928_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|3097947_3099234_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
3099235:3099254	attL	AATGTAGGCCGGGTAAGGCG	NA	NA	NA	NA
WP_003863126.1|3099285_3099879_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_017383004.1|3100001_3100880_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015571579.1|3100965_3102627_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3102601_3102784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304267.1|3102765_3103104_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_023304268.1|3103212_3103500_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3103489_3103966_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3104083_3104566_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_032619204.1|3105142_3106414_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.5	1.4e-214
WP_080288391.1|3106570_3108292_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	22.9	9.6e-17
WP_050019407.1|3108325_3110461_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_128302277.1|3110782_3111685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047685188.1|3111688_3111895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619198.1|3112622_3113984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620260.1|3114160_3114538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619196.1|3114506_3115697_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_032619194.1|3116227_3116614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619193.1|3116633_3116948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619191.1|3116984_3117410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001625709.1|3117506_3117893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619190.1|3117907_3119782_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032619187.1|3119778_3121083_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032619186.1|3121075_3122278_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001019190.1|3122573_3122873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|3122893_3123100_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001067212.1|3123380_3124226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3125657_3126804_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_001618768.1|3127255_3128134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001618769.1|3128259_3128472_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	4.2e-07
WP_001618770.1|3128598_3130014_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_071842894.1|3130144_3130771_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_032619182.1|3130885_3132955_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_032619181.1|3132965_3135563_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_080288382.1|3135627_3136596_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	5.1e-185
3139486:3139505	attR	CGCCTTACCCGGCCTACATT	NA	NA	NA	NA
>prophage 7
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	3515008	3551516	4876110	integrase,transposase	Stx2-converting_phage(20.0%)	25	3528009:3528023	3555443:3555457
WP_000227969.1|3515008_3516085_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016151369.1|3517624_3517975_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_022649395.1|3520138_3521107_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_007896426.1|3521260_3522586_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_016151347.1|3523829_3524351_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_023304425.1|3524347_3525301_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_022652364.1|3525387_3527712_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|3527756_3528659_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
3528009:3528023	attL	GGAACGCGCGCGCAG	NA	NA	NA	NA
WP_004118243.1|3528655_3529654_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|3529650_3530607_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|3530607_3531375_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|3531473_3531767_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|3532097_3532376_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|3532637_3533642_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032435706.1|3534045_3535038_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007851507.1|3535407_3536490_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_007894989.1|3536611_3539686_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_003846917.1|3539737_3540991_+	lactose permease	NA	NA	NA	NA	NA
WP_017384068.1|3542072_3543206_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000019450.1|3543476_3544457_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_085949497.1|3544740_3545888_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_017384060.1|3545978_3546407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|3546410_3548528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897920.1|3548515_3550282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|3550268_3551516_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3555443:3555457	attR	CTGCGCGCGCGTTCC	NA	NA	NA	NA
>prophage 8
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	3609454	3651834	4876110	lysis,head,plate,tRNA,portal,capsid,tail,integrase,terminase	Erwinia_phage(38.1%)	49	3602418:3602437	3657291:3657310
3602418:3602437	attL	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
WP_015571911.1|3609454_3610468_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
WP_001144069.1|3610704_3610920_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032618997.1|3611035_3612781_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_015571912.1|3612933_3614778_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_017384024.1|3614878_3615385_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032618996.1|3615664_3616312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063132245.1|3616334_3616553_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	5.4e-34
WP_032618995.1|3616618_3617788_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.5	2.5e-170
WP_032618994.1|3617784_3618249_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	2.1e-59
WP_032618993.1|3618259_3620710_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.1	9.3e-308
WP_032665230.1|3620699_3620822_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	7.7e-14
WP_032618991.1|3620854_3621178_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_017382996.1|3621235_3621754_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_023323582.1|3621766_3622960_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_032618988.1|3623334_3623766_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.1	7.0e-17
WP_044489085.1|3623767_3626116_-|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	49.2	3.0e-114
WP_032620226.1|3626127_3626658_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	2.4e-91
WP_032618987.1|3626650_3627559_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_032618985.1|3627564_3627915_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	6.2e-40
WP_032618984.1|3627911_3628547_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.7	8.2e-99
WP_032618983.1|3628615_3629065_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.8	4.7e-48
WP_032618981.1|3629057_3629525_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	2.3e-58
WP_032618979.1|3629620_3630037_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	2.1e-42
WP_032618978.1|3630036_3630468_-	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	78.3	2.8e-58
WP_023295248.1|3630464_3630977_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_032618977.1|3630960_3631182_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_017382979.1|3631172_3631376_-|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_023295250.1|3631375_3631882_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	4.4e-63
WP_032618975.1|3631981_3632737_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.5	9.8e-75
WP_047715936.1|3632740_3633796_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	82.8	3.8e-165
WP_032618973.1|3633851_3634706_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	1.9e-114
WP_032618972.1|3634871_3636641_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.2	6.1e-301
WP_047715938.1|3636642_3637668_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.7	7.9e-168
WP_032618970.1|3638094_3640053_+	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	NA	NA	NA	NA
WP_032618969.1|3640096_3641146_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.9	5.7e-105
WP_032665232.1|3641270_3641468_-	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	71.4	1.5e-11
WP_032618967.1|3641590_3643819_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.6	0.0e+00
WP_032618966.1|3643805_3644027_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	94.4	1.1e-31
WP_032618964.1|3644026_3644254_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	70.1	4.8e-17
WP_032618963.1|3644320_3644659_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	3.6e-53
WP_071842907.1|3644622_3644823_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	1.3e-29
WP_032618962.1|3644830_3645340_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	91.7	8.6e-83
WP_032618960.1|3645370_3645634_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	93.1	5.0e-42
WP_080288393.1|3645758_3646331_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	74.1	1.8e-76
WP_032618959.1|3646330_3647347_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	95.0	8.6e-191
WP_017692643.1|3647703_3648873_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_017692642.1|3648873_3649638_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_017382401.1|3649783_3650278_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032618958.1|3650274_3651834_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.6e-08
3657291:3657310	attR	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
>prophage 9
NZ_CP011584	Enterobacter hormaechei strain CAV1668 chromosome, complete genome	4876110	4776312	4820372	4876110	tRNA,portal,tail,integrase,protease,terminase	Enterobacteria_phage(28.26%)	55	4767899:4767914	4825815:4825830
4767899:4767914	attL	ATGTAGGCCGGGTAAG	NA	NA	NA	NA
WP_044488948.1|4776312_4776855_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.5	3.7e-07
WP_032620638.1|4776860_4777322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620635.1|4777356_4777629_-	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	9.1e-39
WP_032620634.1|4777667_4778237_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	74.6	7.6e-80
WP_032620633.1|4778236_4778434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620632.1|4778430_4779162_-	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.2	1.0e-84
WP_032620631.1|4779158_4779485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620630.1|4779481_4779682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620628.1|4779666_4780209_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.7	3.5e-74
WP_032620626.1|4780344_4781175_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	90.1	4.0e-138
WP_032620624.1|4781230_4781602_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	3.8e-56
WP_154232880.1|4781960_4782116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032665243.1|4782114_4782369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047715955.1|4782340_4782541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634275.1|4782709_4783384_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.2	1.1e-114
WP_032634276.1|4783472_4783673_+	transcriptional regulator	NA	U5P445	Shigella_phage	84.6	3.5e-24
WP_032634277.1|4783716_4784274_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.0	4.0e-65
WP_032634315.1|4784503_4785148_+	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	51.2	5.7e-47
WP_047715956.1|4785149_4785329_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	55.1	1.0e-06
WP_047715957.1|4785325_4786189_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	80.0	1.8e-56
WP_047715965.1|4786191_4787529_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	6.3e-117
WP_032620607.1|4787521_4789453_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	5.6e-199
WP_032620605.1|4789449_4790517_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	1.4e-106
WP_032620604.1|4790533_4791139_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.9	7.6e-70
WP_014832171.1|4792101_4792404_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_032620601.1|4792403_4792940_+	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	7.7e-90
WP_032620598.1|4792936_4793458_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	3.7e-73
WP_032620596.1|4793487_4793712_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.1	1.1e-18
WP_080288384.1|4794068_4794746_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	54.9	2.3e-35
WP_020884621.1|4794930_4795419_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	98.1	6.5e-80
WP_032620593.1|4795418_4797521_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	99.3	0.0e+00
WP_032620591.1|4797517_4797733_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	9.4e-31
WP_032620589.1|4797729_4799229_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.4	2.5e-287
WP_158650950.1|4799173_4801180_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	98.8	0.0e+00
WP_032620588.1|4801262_4801589_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	96.3	2.5e-51
WP_032620586.1|4801581_4801857_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	97.5	1.2e-38
WP_020884618.1|4801866_4802445_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_001704117.1|4802441_4802843_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_032620582.1|4802852_4803596_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_032620580.1|4803606_4804047_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_071842901.1|4804055_4804370_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_032620577.1|4804353_4807614_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	97.7	0.0e+00
WP_032620574.1|4807610_4807949_+|tail	tail protein	tail	E4WL34	Enterobacteria_phage	99.1	5.2e-60
WP_032620573.1|4808004_4808742_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	6.1e-146
WP_032620572.1|4808744_4809464_+	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	97.9	9.8e-141
WP_032620570.1|4809456_4810074_+|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.0	2.6e-105
WP_128754879.1|4810159_4810639_+	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.0	7.9e-78
WP_032620567.1|4810703_4814633_+|tail	phage tail protein	tail	M9P0D8	Enterobacteria_phage	89.4	0.0e+00
WP_162269496.1|4814828_4815056_-	hypothetical protein	NA	E4WL44	Enterobacteria_phage	89.3	2.9e-30
WP_103848176.1|4815348_4815930_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.3	4.3e-46
WP_032620566.1|4816778_4817330_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	67.0	2.7e-66
WP_128754880.1|4817437_4817704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032620563.1|4817687_4817933_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.2e-20
WP_032620560.1|4818152_4819247_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	83.7	1.4e-178
WP_032620558.1|4819334_4820372_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4825815:4825830	attR	ATGTAGGCCGGGTAAG	NA	NA	NA	NA
>prophage 1
NZ_CP011583	Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence	85187	0	57509	85187	transposase,integrase	Enterobacteria_phage(21.05%)	56	14329:14344	59068:59083
WP_010791757.1|1404_3087_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_000393453.1|3089_3998_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011405615.1|3994_5212_+	TniQ family protein	NA	NA	NA	NA	NA
WP_010981357.1|5272_5887_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_010981356.1|5925_6246_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_005413392.1|6261_6498_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995361.1|6494_6860_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000761850.1|6971_7610_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_077269372.1|7624_7978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010981353.1|7907_8342_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427614.1|8420_9425_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_162493700.1|9902_10112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003032490.1|11137_11527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|11689_12550_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|12732_13290_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|13453_16459_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
14329:14344	attL	GCTGGATGATGCATTG	NA	NA	NA	NA
WP_074142348.1|17138_18107_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	92.2	1.0e-172
WP_023302470.1|18945_19566_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
WP_020805503.1|19735_20689_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
WP_017900922.1|20951_21230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413487.1|21402_21738_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_074144872.1|21799_22768_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.1e-178
WP_006796638.1|23099_23531_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_023302472.1|23530_24802_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
WP_023302473.1|24883_25858_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
WP_006797591.1|25857_27063_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_023302476.1|27988_28855_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
WP_032410267.1|29389_29494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|29622_29880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302478.1|29937_30714_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_004098973.1|30710_31454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|31504_31855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413492.1|32479_34288_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032621004.1|34284_35331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023770.1|36647_37829_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|38253_39258_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|39336_39894_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|39887_40259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|40255_40756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|40752_41079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|41333_41690_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|41679_42081_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|42077_42368_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427614.1|42811_43816_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|43894_44452_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|44445_44817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|44813_45314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|45310_45637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|45891_46248_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|46237_46639_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|46635_46926_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427614.1|47369_48374_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|48452_51419_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000935451.1|51584_53300_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|53302_54163_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000214124.1|56294_57509_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	24.1	4.4e-16
59068:59083	attR	GCTGGATGATGCATTG	NA	NA	NA	NA
>prophage 2
NZ_CP011583	Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence	85187	77744	83721	85187	transposase	Anoxybacillus_phage(25.0%)	5	NA	NA
WP_031623921.1|77744_79391_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	30.5	1.6e-29
WP_001163403.1|79684_80467_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_047715681.1|80537_82076_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	7.9e-47
WP_000376623.1|82253_82754_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|82881_83721_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
