The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	445140	503682	4879702	portal,head,protease,holin,tail,tRNA,capsid,integrase,terminase	Enterobacterial_phage(33.33%)	77	465257:465272	500909:500924
WP_032619843.1|445140_446424_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	2.5e-09
WP_022650865.1|446684_447005_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
WP_154232874.1|446992_447232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032636446.1|447326_448640_-	hypothetical protein	NA	K7PH95	Enterobacterial_phage	52.6	2.7e-112
WP_017382566.1|448698_448932_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_032619848.1|449039_449711_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	9.9e-87
WP_022651029.1|449711_450026_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_032619850.1|450069_453915_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	62.7	0.0e+00
WP_032619853.1|453967_454555_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	3.6e-48
WP_022648880.1|454554_455265_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_032619855.1|455267_456026_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	3.9e-95
WP_022648882.1|456022_456361_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032620356.1|456363_459666_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	84.9	0.0e+00
WP_032619857.1|459723_460065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619858.1|460120_460399_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|460407_460791_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|460799_461243_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|461302_461650_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_022648888.1|462092_462431_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_032619860.1|462439_462766_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_023296252.1|462809_464021_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619863.1|464030_464879_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_032619865.1|464892_466197_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
465257:465272	attL	TGCGTCAGGAACTGGA	NA	NA	NA	NA
WP_032619866.1|466196_467954_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
WP_032619868.1|467953_468427_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619870.1|468584_468935_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_032619873.1|468934_469525_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	77.6	9.3e-89
WP_032619877.1|469506_470964_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.2	2.0e-278
WP_032619880.1|471050_471311_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	40.2	2.5e-09
WP_047715785.1|471559_471754_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	1.3e-18
WP_032619884.1|471704_471980_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	96.0	9.3e-07
WP_032619887.1|471976_472519_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
WP_000220248.1|472515_472797_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_032264642.1|472793_473198_-	exported phage-related protein	NA	NA	NA	NA	NA
WP_032619892.1|473425_474229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619895.1|474265_474628_-	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	90.8	3.4e-57
WP_032619897.1|474642_475632_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	92.1	4.2e-182
WP_050595702.1|475628_476354_-	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	1.1e-54
WP_032619898.1|476369_476759_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.9	2.9e-62
WP_032619899.1|476755_477079_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	90.4	4.1e-46
WP_032619900.1|477075_477735_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	77.9	2.3e-96
WP_032619901.1|477734_478229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634002.1|478225_479104_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	81.4	1.7e-38
WP_032619902.1|479093_479273_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_023315870.1|479436_479991_-	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_071842884.1|480019_480271_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_032619903.1|480305_481058_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	70.1	4.5e-80
WP_032619905.1|481105_481540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620359.1|481639_481849_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	6.6e-13
WP_032103842.1|481876_482086_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	75.0	3.0e-18
WP_032620361.1|482805_483219_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.2	5.2e-54
WP_032619906.1|483218_484046_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	85.6	1.5e-121
WP_032620364.1|484643_484988_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
WP_032619908.1|485067_485337_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	1.5e-30
WP_022650818.1|485369_485633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619909.1|485607_486750_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_015570783.1|486969_487470_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_015570785.1|487878_489210_+	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
WP_032619910.1|489225_491262_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003857881.1|491368_491815_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_017384695.1|491798_492590_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384696.1|492689_493877_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_032619911.1|493908_494616_-	CTP synthase	NA	NA	NA	NA	NA
WP_015570789.1|494767_495112_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|495112_495418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015570791.1|495498_495753_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032619912.1|496064_497093_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.4	2.5e-12
WP_015570793.1|497138_497237_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|497237_497312_+	protein YoaJ	NA	NA	NA	NA	NA
WP_003857896.1|497365_497614_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071524166.1|497983_498076_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_023296321.1|498200_499700_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_015570796.1|499704_499950_-	YmjA family protein	NA	NA	NA	NA	NA
WP_003857898.1|500025_501276_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
500909:500924	attR	TCCAGTTCCTGACGCA	NA	NA	NA	NA
WP_032619914.1|501393_502056_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032619915.1|502055_502529_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032103856.1|502569_503682_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	1725449	1732954	4879702	integrase	Enterobacteria_phage(85.71%)	10	1719624:1719637	1737188:1737201
1719624:1719637	attL	GGAGCTGATGGCGA	NA	NA	NA	NA
WP_032620857.1|1725449_1725899_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
WP_032620855.1|1725891_1726191_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
WP_032620854.1|1726183_1726738_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.1	1.5e-35
WP_026094409.1|1726734_1727001_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_032620852.1|1727563_1728307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023323621.1|1728309_1728528_+	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_017692853.1|1728556_1729120_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_032620851.1|1729458_1730598_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080288371.1|1730594_1731656_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_032620849.1|1731691_1732954_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.4	8.2e-74
1737188:1737201	attR	TCGCCATCAGCTCC	NA	NA	NA	NA
>prophage 3
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	1997126	2041186	4879702	tRNA,protease,tail,portal,integrase,terminase	Enterobacteria_phage(28.26%)	55	1991669:1991684	2049585:2049600
1991669:1991684	attL	CTTACCCGGCCTACAT	NA	NA	NA	NA
WP_032620558.1|1997126_1998164_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_032620560.1|1998251_1999346_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	83.7	1.4e-178
WP_032620563.1|1999565_1999811_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.2e-20
WP_128754880.1|1999794_2000061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620566.1|2000168_2000720_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	67.0	2.7e-66
WP_103848176.1|2001568_2002150_-|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.3	4.3e-46
WP_162269496.1|2002442_2002670_+	hypothetical protein	NA	E4WL44	Enterobacteria_phage	89.3	2.9e-30
WP_032620567.1|2002865_2006795_-|tail	phage tail protein	tail	M9P0D8	Enterobacteria_phage	89.4	0.0e+00
WP_128754879.1|2006859_2007339_-	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.0	7.9e-78
WP_032620570.1|2007424_2008042_-|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.0	2.6e-105
WP_032620572.1|2008034_2008754_-	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	97.9	9.8e-141
WP_032620573.1|2008756_2009494_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	6.1e-146
WP_032620574.1|2009549_2009888_-|tail	tail protein	tail	E4WL34	Enterobacteria_phage	99.1	5.2e-60
WP_032620577.1|2009884_2013145_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	97.7	0.0e+00
WP_071842901.1|2013128_2013443_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_032620580.1|2013451_2013892_-|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_032620582.1|2013902_2014646_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_001704117.1|2014655_2015057_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_020884618.1|2015053_2015632_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_032620586.1|2015641_2015917_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	97.5	1.2e-38
WP_032620588.1|2015909_2016236_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	96.3	2.5e-51
WP_158650950.1|2016318_2018325_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	98.8	0.0e+00
WP_032620589.1|2018269_2019769_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.4	2.5e-287
WP_032620591.1|2019765_2019981_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	9.4e-31
WP_032620593.1|2019977_2022080_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	99.3	0.0e+00
WP_020884621.1|2022079_2022568_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	98.1	6.5e-80
WP_080288384.1|2022752_2023430_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	54.9	2.3e-35
WP_032620596.1|2023786_2024011_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.1	1.1e-18
WP_032620598.1|2024040_2024562_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	3.7e-73
WP_032620601.1|2024558_2025095_-	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	7.7e-90
WP_014832171.1|2025094_2025397_-	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_032620604.1|2026359_2026965_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.9	7.6e-70
WP_032620605.1|2026981_2028049_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	1.4e-106
WP_032620607.1|2028045_2029977_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	5.6e-199
WP_047715965.1|2029969_2031307_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	6.3e-117
WP_047715957.1|2031309_2032173_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	80.0	1.8e-56
WP_047715956.1|2032169_2032349_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	55.1	1.0e-06
WP_032634315.1|2032350_2032995_-	antirepressor	NA	A0A2I7RHG4	Vibrio_phage	51.2	5.7e-47
WP_032634277.1|2033224_2033782_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.0	4.0e-65
WP_032634276.1|2033825_2034026_-	transcriptional regulator	NA	U5P445	Shigella_phage	84.6	3.5e-24
WP_032634275.1|2034114_2034789_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.2	1.1e-114
WP_047715955.1|2034957_2035158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032665243.1|2035129_2035384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154232880.1|2035382_2035538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620624.1|2035896_2036268_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	3.8e-56
WP_032620626.1|2036323_2037154_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	90.1	4.0e-138
WP_032620628.1|2037289_2037832_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.7	3.5e-74
WP_032620630.1|2037816_2038017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620631.1|2038013_2038340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620632.1|2038336_2039068_+	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.2	1.0e-84
WP_032620633.1|2039064_2039262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620634.1|2039261_2039831_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	74.6	7.6e-80
WP_032620635.1|2039869_2040142_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	9.1e-39
WP_032620638.1|2040176_2040638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044488948.1|2040643_2041186_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.5	3.7e-07
2049585:2049600	attR	CTTACCCGGCCTACAT	NA	NA	NA	NA
>prophage 4
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	3165808	3208188	4879702	portal,plate,head,tRNA,tail,lysis,capsid,integrase,terminase	Erwinia_phage(38.1%)	49	3160333:3160352	3215206:3215225
3160333:3160352	attL	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
WP_032618958.1|3165808_3167368_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.6e-08
WP_017382401.1|3167364_3167859_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017692642.1|3168004_3168769_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_017692643.1|3168769_3169939_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_032618959.1|3170295_3171312_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	95.0	8.6e-191
WP_080288393.1|3171311_3171884_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	74.1	1.8e-76
WP_032618960.1|3172008_3172272_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	93.1	5.0e-42
WP_032618962.1|3172302_3172812_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	91.7	8.6e-83
WP_071842907.1|3172819_3173020_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	1.3e-29
WP_032618963.1|3172983_3173322_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	3.6e-53
WP_032618964.1|3173388_3173616_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	70.1	4.8e-17
WP_032618966.1|3173615_3173837_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	94.4	1.1e-31
WP_032618967.1|3173823_3176052_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.6	0.0e+00
WP_032665232.1|3176174_3176372_+	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	71.4	1.5e-11
WP_032618969.1|3176496_3177546_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.9	5.7e-105
WP_032618970.1|3177589_3179548_-	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	NA	NA	NA	NA
WP_047715938.1|3179974_3181000_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.7	7.9e-168
WP_032618972.1|3181001_3182771_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.2	6.1e-301
WP_032618973.1|3182936_3183791_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	1.9e-114
WP_047715936.1|3183846_3184902_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	82.8	3.8e-165
WP_032618975.1|3184905_3185661_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.5	9.8e-75
WP_023295250.1|3185760_3186267_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	4.4e-63
WP_017382979.1|3186266_3186470_+|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_032618977.1|3186460_3186682_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_023295248.1|3186665_3187178_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_032618978.1|3187174_3187606_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	78.3	2.8e-58
WP_032618979.1|3187605_3188022_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	2.1e-42
WP_032618981.1|3188117_3188585_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	2.3e-58
WP_032618983.1|3188577_3189027_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.8	4.7e-48
WP_032618984.1|3189095_3189731_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.7	8.2e-99
WP_032618985.1|3189727_3190078_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	6.2e-40
WP_032618987.1|3190083_3190992_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_032620226.1|3190984_3191515_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	2.4e-91
WP_044489085.1|3191526_3193875_+|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	49.2	3.0e-114
WP_032618988.1|3193876_3194308_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.1	7.0e-17
WP_023323582.1|3194682_3195876_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_017382996.1|3195888_3196407_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032618991.1|3196464_3196788_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_032665230.1|3196820_3196943_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	7.7e-14
WP_032618993.1|3196932_3199383_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.1	9.3e-308
WP_032618994.1|3199393_3199858_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	2.1e-59
WP_032618995.1|3199854_3201024_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.5	2.5e-170
WP_063132245.1|3201089_3201308_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	5.4e-34
WP_032618996.1|3201330_3201978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384024.1|3202257_3202764_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015571912.1|3202864_3204709_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_032618997.1|3204861_3206607_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|3206722_3206938_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015571911.1|3207174_3208188_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
3215206:3215225	attR	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
>prophage 5
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	3266126	3302634	4879702	integrase,transposase	Stx2-converting_phage(20.0%)	25	3255118:3255132	3268070:3268084
3255118:3255132	attL	TTTCCAGAACGTCCC	NA	NA	NA	NA
WP_007897923.1|3266126_3267374_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007897920.1|3267360_3269127_+	hypothetical protein	NA	NA	NA	NA	NA
3268070:3268084	attR	GGGACGTTCTGGAAA	NA	NA	NA	NA
WP_017384059.1|3269114_3271232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|3271235_3271664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3271754_3272901_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000019450.1|3273185_3274166_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_017384068.1|3274436_3275570_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_003846917.1|3276651_3277905_-	lactose permease	NA	NA	NA	NA	NA
WP_007894989.1|3277956_3281031_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_007851507.1|3281152_3282235_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_032435706.1|3282604_3283597_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427614.1|3284000_3285005_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_007898884.1|3285266_3285545_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898888.1|3285875_3286169_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_004152282.1|3286267_3287035_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|3287035_3287992_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004118243.1|3287988_3288987_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_007898890.1|3288983_3289886_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_022652364.1|3289930_3292255_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_023304425.1|3292341_3293295_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_016151347.1|3293291_3293813_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_007896426.1|3295056_3296382_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_022649395.1|3296535_3297504_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_016151369.1|3299667_3300018_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_000227969.1|3301557_3302634_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	3681046	3712502	4879702	protease,integrase,transposase	Salmonella_phage(16.67%)	26	3678138:3678157	3718391:3718410
3678138:3678157	attL	AATGTAGGCCGGGTAAGGCG	NA	NA	NA	NA
WP_080288382.1|3681046_3682015_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	5.1e-185
WP_032619181.1|3682079_3684677_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_032619182.1|3684687_3686757_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_071842894.1|3686871_3687498_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001618770.1|3687628_3689044_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001618769.1|3689170_3689383_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	4.2e-07
WP_001618768.1|3689508_3690387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|3690837_3691985_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_001067212.1|3693418_3694264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|3694544_3694751_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_001019190.1|3694771_3695071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619186.1|3695366_3696569_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032619187.1|3696561_3697866_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032619190.1|3697862_3699737_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001625709.1|3699751_3700138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619191.1|3700234_3700660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619193.1|3700696_3701011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619194.1|3701030_3701417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619196.1|3701947_3703138_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_032620260.1|3703106_3703484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619198.1|3703660_3705022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047685188.1|3705749_3705956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128302277.1|3705959_3706862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050019407.1|3707183_3709319_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080288391.1|3709352_3711074_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	22.9	9.6e-17
WP_032619204.1|3711230_3712502_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.5	1.4e-214
3718391:3718410	attR	CGCCTTACCCGGCCTACATT	NA	NA	NA	NA
>prophage 7
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	3759686	3784176	4879702	integrase,transposase	Enterobacteria_phage(40.0%)	30	3748015:3748030	3774781:3774796
3748015:3748030	attL	ACCGCATCGCGCAGTT	NA	NA	NA	NA
WP_006176728.1|3759686_3760262_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_015572138.1|3760293_3760944_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_023304255.1|3760943_3761897_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_006811609.1|3761893_3762370_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_006811608.1|3762801_3764031_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_022651668.1|3764008_3764293_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_017692869.1|3764339_3764582_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_032619244.1|3764568_3765180_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.0	1.8e-42
WP_022651666.1|3765214_3766300_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_032619246.1|3766309_3769369_-	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.5	0.0e+00
WP_022651664.1|3769491_3769779_-	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_022651663.1|3769862_3770021_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
WP_022651662.1|3770030_3770216_-	YebW family protein	NA	NA	NA	NA	NA
WP_032619247.1|3770335_3770521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017693529.1|3770712_3771126_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.2e-07
WP_032619249.1|3771479_3772022_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	55.6	4.3e-48
WP_032619250.1|3772457_3773450_+	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032619251.1|3773433_3774126_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
WP_032619252.1|3774137_3774869_+	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
3774781:3774796	attR	AACTGCGCGATGCGGT	NA	NA	NA	NA
WP_032619253.1|3774855_3775116_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	62.5	7.9e-24
WP_032619254.1|3775112_3775592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619256.1|3775593_3775851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489041.1|3775847_3777923_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.6e-199
WP_032619258.1|3777970_3778729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619259.1|3778992_3779226_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	79.2	1.2e-28
WP_032619262.1|3779632_3780232_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	87.3	2.9e-98
WP_155858305.1|3780440_3780593_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	100.0	4.4e-19
WP_085949497.1|3780594_3781742_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_164474130.1|3781992_3782133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003860714.1|3782370_3784176_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
>prophage 8
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	4247923	4258736	4879702		Hokovirus(12.5%)	9	NA	NA
WP_032619353.1|4247923_4249342_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	8.9e-61
WP_032619354.1|4249451_4250822_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
WP_032619355.1|4250987_4252394_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
WP_032619357.1|4252483_4253569_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	8.2e-99
WP_017693099.1|4253569_4254451_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_032619358.1|4254689_4255856_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
WP_032619359.1|4255905_4256910_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	1.9e-33
WP_032619360.1|4257104_4258085_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_017693103.1|4258124_4258736_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
>prophage 9
NZ_CP011572	Enterobacter hormaechei strain CAV1311 chromosome, complete genome	4879702	4358623	4438669	4879702	plate,holin,protease,tail,coat,portal,integrase,terminase	Enterobacteria_phage(14.29%)	91	4352339:4352354	4371563:4371578
4352339:4352354	attL	CATTCAGGTGCCGGAG	NA	NA	NA	NA
WP_032619465.1|4358623_4359637_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	69.0	5.6e-134
WP_032619466.1|4359636_4359858_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_032619467.1|4359917_4360160_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_032619468.1|4360146_4362051_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	29.8	7.3e-18
WP_032619469.1|4362273_4362546_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.2	2.7e-14
WP_155858306.1|4362932_4363103_-	hypothetical protein	NA	A0A1I9SEJ3	Klebsiella_phage	50.9	4.7e-09
WP_032619471.1|4363388_4363880_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	55.0	1.4e-16
WP_032619472.1|4363952_4364222_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.2e-08
WP_032620290.1|4364221_4364674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619473.1|4364696_4365614_+	hypothetical protein	NA	U5P0A0	Shigella_phage	40.0	2.4e-51
WP_032619474.1|4365616_4366357_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.3	1.1e-99
WP_032619475.1|4366374_4367031_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	26.9	3.2e-13
WP_032619476.1|4367226_4367460_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	2.8e-12
WP_032620293.1|4367990_4368344_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	92.5	5.4e-52
WP_032619477.1|4368529_4368853_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	7.0e-30
WP_164474158.1|4369031_4369199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619479.1|4369338_4369635_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	59.1	2.6e-23
WP_032619481.1|4371443_4371800_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.3	9.1e-39
4371563:4371578	attR	CATTCAGGTGCCGGAG	NA	NA	NA	NA
WP_032619482.1|4371796_4372402_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	1.2e-75
WP_032619483.1|4372740_4373145_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_044489029.1|4373141_4373438_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_032619484.1|4373434_4374064_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	5.1e-101
WP_032620296.1|4374071_4374347_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	1.6e-22
WP_032619486.1|4374472_4374730_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
WP_020690713.1|4374878_4375082_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_032619487.1|4375154_4375382_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
WP_032619488.1|4375570_4375831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619489.1|4376106_4376610_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_032619490.1|4376613_4378734_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	9.2e-304
WP_023299859.1|4378730_4378946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619491.1|4378954_4380475_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.3e-153
WP_103848174.1|4380467_4382525_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
WP_032619492.1|4382593_4382929_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_023303463.1|4382928_4383285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023299864.1|4383286_4383949_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.9e-21
WP_023303465.1|4383957_4384512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619493.1|4384504_4385128_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
WP_032619495.1|4385166_4386636_+|tail	tail protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
WP_032619497.1|4386632_4387139_+|tail	tail protein	tail	NA	NA	NA	NA
WP_032619498.1|4387190_4387478_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032619500.1|4389721_4390192_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_032620301.1|4390166_4390382_+|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619501.1|4390384_4391503_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	7.8e-36
WP_032619502.1|4391539_4391893_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_032619503.1|4391876_4392791_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	1.6e-58
WP_032619504.1|4392783_4393335_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_050019395.1|4393337_4395515_+	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.9	3.9e-55
WP_032619505.1|4395514_4396093_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_032619506.1|4396169_4397240_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032619507.1|4397280_4397685_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_012906750.1|4397706_4397886_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032619509.1|4398169_4399444_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032619510.1|4399440_4399974_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017384434.1|4401633_4401957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619511.1|4401986_4402913_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384432.1|4402918_4403389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619512.1|4403554_4404271_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.1e-11
WP_015570244.1|4404267_4405143_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_023303913.1|4405139_4406414_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003859667.1|4406425_4407340_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003859669.1|4407408_4408530_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859671.1|4408941_4409610_+	YecA family protein	NA	NA	NA	NA	NA
WP_032620305.1|4409926_4411138_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859673.1|4411329_4411566_+	YecH family protein	NA	NA	NA	NA	NA
WP_003859676.1|4411602_4412100_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_015570249.1|4412300_4412639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859680.1|4412884_4413523_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_017384426.1|4413565_4414984_-	MFS transporter	NA	NA	NA	NA	NA
WP_003859682.1|4415198_4415282_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_003859683.1|4415388_4415640_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_017693227.1|4415720_4417064_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_032619513.1|4417205_4417709_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_017384423.1|4418212_4418770_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_017384422.1|4419087_4420077_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_032619514.1|4420148_4421663_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.2	6.9e-11
WP_003859689.1|4421677_4422658_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_023303910.1|4422811_4423615_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_015570257.1|4423589_4425014_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_017384418.1|4425029_4425458_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_006811111.1|4426245_4426605_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003859695.1|4426607_4427186_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003859696.1|4427309_4428197_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_017693230.1|4428193_4429123_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_017384416.1|4429127_4431137_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003859699.1|4431156_4431660_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_023303909.1|4431756_4433016_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_023303908.1|4433443_4434016_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_015570265.1|4434023_4434572_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032619515.1|4434588_4435350_+	molecular chaperone	NA	NA	NA	NA	NA
WP_023303905.1|4435325_4437710_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017384412.1|4437706_4438669_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 1
NZ_CP011571	Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence	90452	0	39742	90452	integrase,transposase	Escherichia_phage(29.41%)	32	18746:18762	41303:41319
WP_023302476.1|0_867_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
WP_006797591.1|1792_2998_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_023302473.1|2997_3972_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
WP_023302472.1|4053_5325_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
WP_006796638.1|5324_5756_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_074144872.1|6087_7056_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.1e-178
WP_032413487.1|7117_7453_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_017900922.1|7625_7904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805503.1|8166_9120_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
WP_023302470.1|9289_9910_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
WP_074142348.1|10748_11717_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	92.2	1.0e-172
WP_004152397.1|14862_16182_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|16431_17313_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|17511_18291_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|18287_19313_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
18746:18762	attL	CGGTCTTCATGTTGTCG	NA	NA	NA	NA
WP_004152392.1|19419_22449_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|22558_24274_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001235713.1|25388_25946_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|26128_26989_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_003032490.1|27151_27541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493700.1|28566_28776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|29253_30258_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|30336_30894_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|30887_31259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|31255_31756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|31752_32079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|32333_32690_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|32679_33081_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|33077_33368_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427614.1|33811_34816_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|34894_37861_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000935451.1|38026_39742_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
41303:41319	attR	CGACAACATGAAGACCG	NA	NA	NA	NA
