The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	642802	700253	5114241	transposase,tRNA	uncultured_marine_virus(21.43%)	51	NA	NA
WP_000003805.1|642802_644320_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|644556_646014_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_001296667.1|646072_648220_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|648299_649634_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187191.1|649999_651538_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000492897.1|652341_653877_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001280513.1|653947_654793_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839254.1|654877_655075_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761714.1|655086_655575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094436.1|655571_655949_-	toxin	NA	NA	NA	NA	NA
WP_015953067.1|655995_656373_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692312.1|656451_656673_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186756.1|656741_657218_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860054.1|657232_657718_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	3.8e-11
WP_001175142.1|657808_658627_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.8e-45
WP_001278287.1|658716_658950_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097312.1|658955_659633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282927.1|659780_660461_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000010416.1|660663_661548_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_000126799.1|661653_662616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110727.1|662612_663467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154675835.1|665129_665303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075462.1|665482_666214_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001100705.1|666723_667176_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_164965929.1|667618_668847_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	1.1e-171
WP_000792543.1|669039_671088_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_114637670.1|674818_675358_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001352368.1|675427_676636_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000991577.1|676980_677553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958152.1|677621_677858_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001167473.1|678123_678672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349534.1|678690_678939_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001323513.1|679007_679199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346664.1|680791_680905_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_000919994.1|681728_682295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|682535_683351_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001445143.1|683633_683885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349530.1|684505_684784_-	FaeA/PapI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000930062.1|685206_685521_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_001352368.1|686110_687319_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_035689358.1|687328_687700_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000428546.1|687832_688426_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|688538_689744_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|689825_690449_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|690426_691113_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|691120_691507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|691499_691820_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|692263_693469_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|693834_695043_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000654934.1|696139_698650_+	P fimbrial usher protein PapC	NA	NA	NA	NA	NA
WP_000381395.1|698681_700253_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 2
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	1808118	1863097	5114241	terminase,head,portal,tail,capsid,integrase,protease,lysis	Enterobacteria_phage(50.75%)	79	1822113:1822128	1835293:1835308
WP_000533643.1|1808118_1809189_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_032285015.1|1809166_1809385_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.1e-34
WP_032285014.1|1809424_1809592_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	96.4	8.3e-27
WP_000789831.1|1809828_1810527_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	80.6	4.8e-100
WP_001289879.1|1810657_1811206_-	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	58.2	7.7e-45
WP_000763363.1|1811202_1811424_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188870.1|1811522_1811738_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548537.1|1811814_1812006_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_032218312.1|1811978_1812161_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	2.6e-26
WP_032285013.1|1812157_1812838_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	9.6e-130
WP_000100845.1|1812834_1813620_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|1813625_1813922_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372939.1|1813975_1814140_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.2	3.0e-21
WP_001198861.1|1814108_1814273_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065384.1|1814345_1814714_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_170928896.1|1814902_1815772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340004.1|1815780_1816104_-	antitermination protein N	NA	A4KWR8	Enterobacteria_phage	94.3	1.4e-49
WP_000618037.1|1816457_1816862_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	4.3e-69
WP_000028392.1|1816858_1817491_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1817595_1817811_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|1817930_1818224_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_032200171.1|1818256_1819156_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	7.9e-172
WP_039025747.1|1819152_1819854_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.2e-127
WP_039025746.1|1819850_1820141_+	hypothetical protein	NA	O48423	Enterobacteria_phage	92.7	1.1e-42
WP_000736903.1|1820214_1820655_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|1820651_1821179_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_039025745.1|1821175_1821352_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	96.6	3.9e-27
WP_000386643.1|1821354_1821696_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_039025744.1|1821902_1822265_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
1822113:1822128	attL	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_000971055.1|1822261_1822402_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1822487_1822871_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|1823059_1824142_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|1824730_1824946_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_023149315.1|1824945_1825443_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_001398804.1|1825439_1825907_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	91.6	4.1e-71
WP_001139682.1|1825894_1826047_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001537735.1|1826280_1826691_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001663509.1|1826748_1826982_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453587.1|1827370_1827916_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_047340750.1|1827890_1829816_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1829812_1830019_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_039025778.1|1830015_1830897_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.0e-163
WP_000963723.1|1831045_1832287_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_001029461.1|1832288_1832546_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001038675.1|1832602_1833181_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.0	9.2e-57
WP_000179580.1|1833514_1833820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|1834010_1834208_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920679.1|1834200_1834386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599514.1|1834385_1834577_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.5e-11
WP_001091146.1|1834577_1834799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425299.1|1834816_1835116_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032284967.1|1835112_1836867_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	6.0e-91
1835293:1835308	attR	CTGGATAATCTGCAAA	NA	NA	NA	NA
WP_000161636.1|1837213_1837465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126640.1|1837461_1837884_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228106.1|1838101_1839142_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000190771.1|1839151_1839493_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179424.1|1839504_1839888_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000835282.1|1840089_1840632_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_000140265.1|1840643_1840925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032285275.1|1842494_1843814_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	3.1e-233
WP_039025779.1|1843823_1844156_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063244.1|1844211_1845237_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_074142580.1|1845278_1845674_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.0e-54
WP_000752960.1|1845685_1846039_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_032203530.1|1846050_1846629_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	8.6e-79
WP_000683128.1|1846625_1847021_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_032285277.1|1847028_1847769_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	2.5e-131
WP_000479142.1|1847784_1848207_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000459457.1|1848188_1848623_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840349.1|1848615_1851195_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
WP_000847379.1|1851191_1851521_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152622.1|1851520_1852219_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000194780.1|1852224_1852968_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090892.1|1852904_1853537_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_047340752.1|1853597_1857095_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.0	0.0e+00
WP_001233090.1|1857165_1857765_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_085004450.1|1857829_1861108_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.2	3.2e-05
WP_032284983.1|1861107_1861692_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	3.0e-103
WP_000586339.1|1861765_1863097_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 3
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2234323	2283686	5114241	terminase,head,holin,portal,tail,plate,capsid,transposase,tRNA,integrase,protease,lysis	Shigella_phage(44.44%)	67	2234949:2234966	2253658:2253675
WP_032285083.1|2234323_2235430_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2234949:2234966	attL	TTATGGCTGAGCGTATAA	NA	NA	NA	NA
WP_000476093.1|2235483_2235945_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2235954_2236608_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|2236779_2238030_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001527053.1|2238431_2239778_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_001527052.1|2240485_2241601_+	macro domain-containing protein	NA	A0A2D1GR68	Pseudomonas_phage	39.0	3.6e-25
WP_001527051.1|2241812_2242940_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	61.2	2.5e-122
WP_001527050.1|2242920_2243166_-	phage excisionase	NA	NA	NA	NA	NA
WP_032285084.1|2243221_2243758_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	92.6	1.8e-91
WP_032285085.1|2243886_2244711_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	1.5e-148
WP_000135665.1|2244776_2245139_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
WP_001307125.1|2245418_2245760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005197.1|2245697_2246006_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
WP_000848748.1|2246179_2246854_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|2246944_2247145_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515830.1|2247188_2247740_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|2247915_2248095_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104943.1|2248084_2249026_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_077249478.1|2249022_2249517_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.8e-85
WP_001371856.1|2249516_2250170_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.0e-125
WP_000210188.1|2250166_2250493_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	3.5e-53
WP_016244991.1|2250489_2250879_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.7	1.0e-67
WP_001061404.1|2250898_2251696_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_001371855.1|2251703_2252693_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	3.3e-195
WP_001205470.1|2252710_2253067_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150293.1|2253046_2254261_-	hypothetical protein	NA	NA	NA	NA	NA
2253658:2253675	attR	TTATGGCTGAGCGTATAA	NA	NA	NA	NA
WP_000355468.1|2254263_2255439_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001120496.1|2255730_2256057_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001197765.1|2256060_2256537_+	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.8	8.6e-85
WP_077249476.1|2256753_2256936_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	3.2e-16
WP_001526898.1|2257029_2257320_-	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.7	1.0e-43
WP_001135221.1|2257844_2258195_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.8	2.0e-62
WP_000929184.1|2258320_2258815_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_103852454.1|2259048_2260545_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.2	4.8e-299
WP_000605606.1|2260556_2260739_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|2260738_2261980_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|2261957_2262608_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257492.1|2262622_2263828_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_032285137.1|2263876_2264077_+	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	3.2e-25
WP_000927710.1|2264079_2264403_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_000702398.1|2264399_2264810_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	100.0	3.1e-75
WP_000213503.1|2264784_2265291_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_032285136.1|2265287_2265848_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000497757.1|2265856_2266027_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_032285135.1|2266010_2267507_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.4	7.0e-274
WP_000090997.1|2267506_2267863_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_000661054.1|2267862_2268132_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_032285134.1|2268273_2270109_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.0	1.9e-305
WP_032285133.1|2270169_2271498_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.4	7.9e-245
WP_032285132.1|2271494_2272574_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	98.6	2.5e-204
WP_001259084.1|2272573_2273122_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424747.1|2273121_2273547_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_032285131.1|2273533_2274592_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.6	4.7e-200
WP_032285130.1|2274582_2275167_+	YmfQ family protein	NA	O22003	Shigella_phage	97.9	1.7e-111
WP_000554695.1|2275170_2276094_+	hypothetical protein	NA	U5P0I1	Shigella_phage	98.1	4.2e-51
WP_071556292.1|2276068_2276272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045545.1|2276237_2276846_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.3	7.6e-94
WP_032285129.1|2276845_2277343_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	68.9	1.5e-55
WP_071556291.1|2277373_2277565_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	83.3	1.9e-14
WP_000834396.1|2277598_2279488_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000943926.1|2280330_2280495_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
WP_001317720.1|2280595_2280919_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	65.4	3.0e-41
WP_120795380.1|2281175_2281220_-	protein YmgK	NA	NA	NA	NA	NA
WP_000526135.1|2281552_2282011_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001695662.1|2282166_2282277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373096.1|2282329_2282734_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332300.1|2282954_2283686_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 4
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2483246	2545368	5114241	terminase,holin,tail,transposase,tRNA,integrase,lysis	Escherichia_phage(40.38%)	66	2474684:2474698	2515223:2515237
2474684:2474698	attL	GCTGATTGACGAAAA	NA	NA	NA	NA
WP_001306539.1|2483246_2484479_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2484733_2485717_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001272254.1|2486194_2487568_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	5.1e-53
WP_001157407.1|2487696_2488632_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2488683_2489919_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2489920_2490136_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2490214_2490424_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2490416_2490611_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2490667_2491477_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_039026005.1|2491469_2494070_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.0e-248
WP_000632297.1|2494171_2494447_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2494521_2494692_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2494691_2494913_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2495353_2495842_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2495838_2495994_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_039025896.1|2496393_2496813_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_047340760.1|2496913_2497195_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	71.2	1.9e-23
WP_047340761.1|2497178_2497604_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|2497675_2498746_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|2498786_2499209_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|2499549_2501547_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625667.1|2501610_2502888_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_039025955.1|2503018_2503900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957772.1|2503896_2504589_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001117227.1|2504600_2505800_-	MFS transporter	NA	NA	NA	NA	NA
WP_000882656.1|2506463_2506676_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
WP_000940319.1|2507144_2507744_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|2507743_2508034_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|2508030_2508573_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_089541817.1|2509892_2511121_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_001348108.1|2511553_2511928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|2512179_2512395_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001351713.1|2512394_2512892_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228688.1|2513108_2513294_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|2513490_2514948_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291094.1|2515085_2515877_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
2515223:2515237	attR	GCTGATTGACGAAAA	NA	NA	NA	NA
WP_038989197.1|2515869_2516802_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	55.2	2.2e-84
WP_000613571.1|2516737_2516989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|2516992_2518087_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|2518067_2519369_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|2519371_2520778_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001351715.1|2520761_2521874_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_039025969.1|2521978_2522743_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	63.8	2.0e-83
WP_000918487.1|2522841_2523981_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|2524023_2524200_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|2524203_2524599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2524598_2524982_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|2524982_2525363_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|2525359_2525752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047340762.1|2525778_2526741_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	5.8e-56
WP_000470331.1|2526801_2527353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001703076.1|2527724_2530958_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	1.3e-104
WP_000024051.1|2530950_2531289_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152422.1|2531288_2531987_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	9.6e-125
WP_001379783.1|2531992_2532736_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	8.0e-146
WP_000741591.1|2532633_2533281_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_047340763.1|2533341_2536755_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.0	0.0e+00
WP_001230375.1|2536824_2537424_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_097761930.1|2537488_2540887_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.2e-12
WP_001698950.1|2540886_2541462_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_047340764.1|2541559_2542150_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	9.5e-25
WP_000836768.1|2542466_2542700_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2542768_2542882_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|2543221_2543395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295593.1|2543659_2544094_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|2544234_2545368_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 5
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2710280	2720857	5114241	tail	Enterobacteria_phage(62.5%)	8	NA	NA
WP_001613101.1|2710280_2710862_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	4.0e-100
WP_096006623.1|2710861_2714260_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	9.1e-11
WP_001233114.1|2714324_2714924_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_069914273.1|2714991_2718471_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090847.1|2718531_2719134_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_024170790.1|2719070_2719814_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
WP_001724602.1|2719819_2720518_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_000447248.1|2720527_2720857_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
>prophage 6
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2723893	2762949	5114241	terminase,tail,portal,integrase,protease,lysis	Enterobacteria_phage(40.0%)	52	2735923:2735939	2767643:2767659
WP_001161009.1|2723893_2724223_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001297778.1|2724231_2724618_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_000211109.1|2724678_2725422_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|2725433_2725835_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677108.1|2725831_2726410_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001283153.1|2726421_2726697_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_032285386.1|2726689_2727013_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	5.5e-51
WP_085910248.1|2727099_2729127_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.1	0.0e+00
WP_021542121.1|2729071_2730580_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_001072975.1|2730579_2730792_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_047340765.1|2730788_2732888_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.9	0.0e+00
WP_000421825.1|2732896_2733436_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548593.1|2733985_2734192_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|2734487_2734661_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|2734833_2734989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|2735135_2735324_-	cold-shock protein	NA	NA	NA	NA	NA
WP_001356335.1|2735334_2735547_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_001071776.1|2735910_2736408_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2735923:2735939	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092966.1|2736404_2736938_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|2736934_2737246_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839562.1|2737250_2737466_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2737717_2738092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2738263_2738692_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_029380182.1|2739058_2739187_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_032285384.1|2739908_2740730_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000904112.1|2740726_2741101_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001695976.1|2741113_2742163_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_001429486.1|2742164_2742443_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_000887491.1|2742901_2743114_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001297700.1|2743633_2744542_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_000982358.1|2744631_2746023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032285383.1|2746290_2746707_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.3	1.8e-62
WP_032285382.1|2746747_2747818_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.1	7.4e-52
WP_032285381.1|2747889_2748315_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2748311_2748566_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2748645_2749065_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_032154077.1|2749362_2749518_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	3.4e-06
WP_047340766.1|2749519_2750095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2750581_2750770_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2750766_2750958_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_033561585.1|2751051_2753523_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|2753595_2753847_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000877001.1|2753881_2755162_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001389342.1|2755163_2755292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836040.1|2755349_2756369_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
WP_001295394.1|2756380_2757595_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|2757800_2758127_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705195.1|2758261_2758603_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2758637_2759198_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|2759200_2759911_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001317855.1|2760018_2760324_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041658.1|2760522_2762949_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
2767643:2767659	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 7
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3245466	3253200	5114241		Enterobacteria_phage(33.33%)	8	NA	NA
WP_047340782.1|3245466_3246573_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.5	6.5e-43
WP_047340783.1|3246565_3247033_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001350333.1|3247019_3247430_-	FdtA/QdtA family cupin domain-containing protein	NA	NA	NA	NA	NA
WP_047340784.1|3247447_3248323_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	5.1e-107
WP_047340785.1|3248380_3249280_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_047340786.1|3249279_3250365_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	8.0e-102
WP_047340787.1|3250737_3251631_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	2.3e-46
WP_047340788.1|3251805_3253200_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
>prophage 8
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3344517	3353960	5114241		Enterobacteria_phage(85.71%)	10	NA	NA
WP_021539239.1|3344517_3345654_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
WP_021539240.1|3345650_3347651_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|3347775_3348237_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|3348278_3348749_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_047340794.1|3348795_3349515_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|3349511_3351197_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240405.1|3351418_3352150_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|3352209_3352317_+	protein YohO	NA	NA	NA	NA	NA
WP_000783127.1|3352297_3353029_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_021539241.1|3353033_3353960_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 9
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3567567	3642587	5114241	terminase,head,holin,portal,tRNA,integrase,lysis	Enterobacteria_phage(54.55%)	94	3581566:3581581	3614939:3614954
WP_001283598.1|3567567_3568380_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3568379_3569393_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699117.1|3569458_3570595_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	8.5e-22
WP_000615813.1|3570693_3571689_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|3571685_3572864_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3573128_3574349_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683541.1|3574507_3576514_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|3576634_3576913_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089248.1|3576946_3577495_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|3577494_3578304_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043840.1|3578303_3579128_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3579130_3580216_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|3580250_3581183_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3581348_3581900_+	endonuclease SmrB	NA	NA	NA	NA	NA
3581566:3581581	attL	AATATGTTCGCCCGGA	NA	NA	NA	NA
WP_001317961.1|3582015_3582858_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730189.1|3582859_3583384_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822662.1|3583380_3583851_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001317962.1|3583847_3584396_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000160649.1|3584370_3585120_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000033309.1|3587864_3588431_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3589091_3589577_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425039.1|3589779_3591924_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531905.1|3591923_3593234_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|3593415_3593700_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_021525697.1|3594071_3595412_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776768.1|3595473_3596229_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3596522_3597455_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958680.1|3597766_3598924_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	2.8e-222
WP_050437765.1|3599002_3601165_-	hypothetical protein	NA	A5VW57	Enterobacteria_phage	77.5	7.2e-62
WP_032228630.1|3601265_3602156_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	98.6	1.3e-166
WP_001555392.1|3602218_3602488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555391.1|3602484_3602643_-	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	92.3	9.3e-20
WP_021520314.1|3602733_3602991_+	Arc family DNA-binding protein	NA	A0A2H4FVY6	Salmonella_phage	97.6	2.0e-40
WP_001716763.1|3602983_3603253_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	100.0	2.9e-45
WP_024187640.1|3603421_3603706_+	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	98.9	5.9e-41
WP_085910264.1|3603796_3604165_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	97.5	5.5e-63
WP_023486184.1|3604189_3606028_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.5	1.4e-247
WP_023486185.1|3606027_3607443_-	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.7	1.3e-200
WP_032284935.1|3607452_3608145_-	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	96.1	1.3e-113
WP_024623285.1|3608147_3608603_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	6.7e-87
WP_032284934.1|3608602_3609304_-	hypothetical protein	NA	A0A2H4FWI9	Salmonella_phage	98.3	1.6e-79
WP_032284933.1|3609303_3610722_-	packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	1.2e-275
WP_001140510.1|3610731_3611193_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|3611173_3611362_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000372575.1|3612676_3613570_-	scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	99.0	4.3e-130
WP_032284931.1|3613660_3615859_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	97.1	0.0e+00
3614939:3614954	attR	AATATGTTCGCCCGGA	NA	NA	NA	NA
WP_000200770.1|3615860_3617276_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	7.5e-278
WP_001436504.1|3617272_3617695_-	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_032284930.1|3617718_3617898_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	96.6	5.4e-24
WP_000807785.1|3617899_3618142_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000999674.1|3618245_3618626_-	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
WP_047340800.1|3618909_3619428_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	7.2e-93
WP_038977024.1|3619630_3619783_-	hypothetical protein	NA	Q716B2	Shigella_phage	98.0	6.2e-21
WP_047340801.1|3619770_3620238_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	93.5	2.8e-72
WP_000229392.1|3620234_3620711_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|3620694_3621018_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|3621684_3622308_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994515.1|3622304_3622493_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008199.1|3622489_3622852_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_032284927.1|3622848_3623139_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	97.9	4.2e-50
WP_001279421.1|3623138_3623408_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950962.1|3623400_3623577_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_032145626.1|3623569_3624520_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	47.0	8.2e-95
WP_001254220.1|3624516_3624693_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000153262.1|3624689_3625217_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_000736903.1|3625213_3625654_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001248388.1|3625727_3627104_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_032285183.1|3627100_3627988_-	replication protein	NA	A5VW95	Enterobacteria_phage	91.5	4.0e-144
WP_001244621.1|3628050_3628323_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251074.1|3628345_3628642_-	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	96.9	2.1e-44
WP_000437875.1|3628760_3628961_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|3629061_3629775_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708836.1|3629902_3630760_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	5.8e-39
WP_001317717.1|3631241_3631565_+	antitermination protein	NA	K7P718	Enterobacteria_phage	100.0	1.0e-52
WP_001278766.1|3631557_3632052_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_000065374.1|3632308_3632677_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000972063.1|3632752_3632887_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3632871_3633024_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|3633108_3633417_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_032285061.1|3633413_3634325_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	99.7	2.2e-169
WP_000041322.1|3634308_3634791_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
WP_000753555.1|3634802_3635117_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_016063077.1|3635133_3635301_+	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	100.0	1.3e-24
WP_032285062.1|3635297_3635843_+	hypothetical protein	NA	J9Q748	Salmonella_phage	83.8	4.9e-84
WP_032285063.1|3635839_3636139_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	5.3e-56
WP_032285064.1|3636140_3636548_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	6.3e-68
WP_000348980.1|3636549_3636741_+	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
WP_032285065.1|3636743_3637394_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	57.9	1.3e-54
WP_123003164.1|3637567_3637867_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	97.0	1.8e-51
WP_001163428.1|3637975_3638176_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001317963.1|3638472_3638625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047340802.1|3638704_3639952_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274890.1|3640023_3640938_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194528.1|3641153_3642587_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.0	9.1e-29
>prophage 10
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3979924	3987064	5114241		Escherichia_phage(83.33%)	6	NA	NA
WP_001272914.1|3979924_3982486_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
WP_001141285.1|3982591_3983248_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	4.3e-50
WP_001318002.1|3983298_3984066_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	7.4e-70
WP_000848000.1|3984261_3985170_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590398.1|3985166_3986429_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278992.1|3986425_3987064_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
>prophage 11
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	4040994	4109757	5114241	transposase,plate,tRNA	uncultured_marine_virus(16.67%)	54	NA	NA
WP_001352368.1|4040994_4042203_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000186450.1|4043393_4046150_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000098244.1|4046380_4047721_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000211791.1|4047741_4049082_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000097082.1|4049083_4050436_-	galactarate/glucarate/glycerate transporter GudP	NA	NA	NA	NA	NA
WP_000807756.1|4050870_4051320_-	flavodoxin	NA	NA	NA	NA	NA
WP_000889984.1|4051337_4052120_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_000206999.1|4052119_4052449_-	YqcC family protein	NA	NA	NA	NA	NA
WP_000342431.1|4053070_4053616_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_000100411.1|4053683_4054532_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
WP_000627995.1|4054643_4056008_+	nucleotide 5'-monophosphate nucleosidase	NA	NA	NA	NA	NA
WP_000450473.1|4056563_4057853_+	HAAAP family serine/threonine permease SdaC	NA	NA	NA	NA	NA
WP_000626404.1|4057910_4059278_+	L-serine ammonia-lyase II	NA	NA	NA	NA	NA
WP_001318010.1|4059388_4060144_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	8.5e-10
WP_000013592.1|4060198_4061347_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_000440775.1|4061374_4062022_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000528587.1|4062568_4063885_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000724159.1|4063917_4065693_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_000808354.1|4065801_4067220_+	L-fuculokinase	NA	NA	NA	NA	NA
WP_000920840.1|4067221_4067644_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_000642344.1|4067701_4068433_+	L-fucose operon activator	NA	NA	NA	NA	NA
WP_001045520.1|4068476_4069577_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_000203905.1|4069569_4069965_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_000044401.1|4069983_4070901_-	glycine cleavage system transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_000750398.1|4071251_4071479_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_001318012.1|4071670_4072876_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
WP_039025734.1|4072875_4073319_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117724.1|4073369_4074176_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
WP_000678650.1|4074602_4075700_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001696093.1|4076836_4077337_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001318014.1|4077395_4078934_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000686690.1|4078953_4080291_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000710991.1|4080287_4080953_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001246519.1|4080965_4082618_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000997073.1|4082675_4083167_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032284850.1|4083358_4085995_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	2.6e-98
WP_001318015.1|4086006_4088487_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	38.8	3.4e-07
WP_050437762.1|4088519_4089254_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_024196213.1|4089243_4089633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284851.1|4089738_4090953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284860.1|4091009_4094336_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_001318017.1|4094328_4095939_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001318018.1|4095944_4097351_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000342484.1|4097979_4099740_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000373313.1|4099703_4100783_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000484008.1|4100763_4101300_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000106969.1|4101303_4101732_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_039025766.1|4101731_4103108_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001318019.1|4103406_4104354_-	phosphoglycerate dehydrogenase	NA	M1I1Q8	Acanthocystis_turfacea_Chlorella_virus	27.3	1.4e-14
WP_001089172.1|4104424_4105021_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	2.4e-23
WP_000382402.1|4105023_4106199_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810569.1|4106198_4107779_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_114637672.1|4107810_4108476_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_001352368.1|4108548_4109757_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 12
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	4332708	4341643	5114241	transposase	Stx2-converting_phage(66.67%)	6	NA	NA
WP_047340814.1|4332708_4336206_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.9	7.0e-99
WP_000422741.1|4338418_4338844_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624717.1|4338840_4339191_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_001593684.1|4339221_4340814_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000612556.1|4340909_4341257_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001282144.1|4341253_4341643_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
>prophage 13
NZ_CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	4821074	4873260	5114241	terminase,head,holin,plate,tail,portal,capsid,integrase,protease,lysis	Escherichia_phage(32.56%)	63	4837009:4837055	4870472:4870518
WP_000208242.1|4821074_4821605_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|4821614_4822946_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4823012_4823939_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872909.1|4824031_4824517_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4824601_4824847_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4825272_4826118_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4826140_4827649_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4827819_4828830_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796345.1|4828926_4829673_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|4829677_4830106_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4830132_4830432_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4830643_4831084_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802221.1|4831184_4831784_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4831891_4832659_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4832713_4833469_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045701.1|4833575_4834565_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001318165.1|4834884_4835847_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4836027_4836930_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4837009:4837055	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4837166_4837385_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882971.1|4837466_4838630_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	2.0e-204
WP_000978875.1|4838629_4839109_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	3.3e-84
WP_000069929.1|4839123_4841571_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.3	0.0e+00
WP_000785970.1|4841563_4841683_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4841715_4841991_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251400.1|4842047_4842566_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001286711.1|4842578_4843769_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_000257039.1|4844027_4845371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164161.1|4845652_4846180_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.7	6.4e-89
WP_000104723.1|4846183_4848433_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	55.7	2.1e-136
WP_001285325.1|4848443_4848974_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121481.1|4848966_4849875_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	3.4e-162
WP_000127163.1|4849879_4850227_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093728.1|4850223_4850859_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001504911.1|4850942_4851728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001781.1|4851799_4852252_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_000917179.1|4852244_4852712_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001440152.1|4852674_4852848_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040652.1|4852819_4853245_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	1.6e-66
WP_000736565.1|4853232_4853658_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	7.2e-59
WP_001144090.1|4853672_4854170_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_000123123.1|4854169_4854451_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|4854454_4854658_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4854657_4855167_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203426.1|4855266_4856010_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	99.2	1.4e-121
WP_001248576.1|4856013_4857087_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.7	1.9e-201
WP_001085948.1|4857145_4858000_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156861.1|4858173_4859946_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038194.1|4859945_4860980_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.2e-200
WP_001279022.1|4861411_4863370_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000598783.1|4863410_4864460_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	56.2	7.4e-105
WP_000268622.1|4864571_4866842_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
WP_000027672.1|4866831_4867107_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
WP_001113264.1|4867103_4867328_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|4867330_4867630_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|4867629_4867854_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|4867917_4868418_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001333116.1|4868414_4868612_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.5	3.6e-29
WP_000453534.1|4868587_4868860_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4869012_4869306_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023384.1|4869375_4870356_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001223800.1|4870541_4871042_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4870472:4870518	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033720.1|4871191_4871890_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4871886_4873260_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP030791	Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence	197773	1262	87111	197773	transposase,bacteriocin,protease,integrase	Shigella_phage(11.11%)	56	NA	NA
WP_001066953.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001332052.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312822.1|2685_3588_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_114637673.1|3656_4766_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|5197_6151_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001595315.1|7422_7839_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
WP_001696612.1|9553_10741_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
WP_001610286.1|10737_12678_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001696614.1|12681_14052_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001610297.1|16447_17224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610298.1|17225_19490_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_001610302.1|21831_22203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610303.1|22245_22713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610304.1|22712_22982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|25245_26439_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_103852389.1|26893_28122_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.0	3.7e-172
WP_000738422.1|28828_29122_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|32266_33382_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_001442133.1|33521_37181_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_000933675.1|37284_38514_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271277.1|38598_39555_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|39599_41777_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001190233.1|42621_43656_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
WP_000377483.1|44215_44524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|44622_44805_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001324224.1|44801_44999_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000489608.1|45680_46955_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183604.1|46929_49044_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|49213_49525_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|49502_49739_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|50678_50948_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_001017347.1|50944_51925_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001282151.1|51991_52381_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_000612591.1|52377_52725_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_021514811.1|59998_61150_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
WP_000124098.1|61271_61637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487120.1|62103_63114_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
WP_000086538.1|63691_64282_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
WP_000756335.1|64636_65635_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000110581.1|65634_66672_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000020503.1|66671_67433_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
WP_025999368.1|67489_68677_+	MFS transporter	NA	NA	NA	NA	NA
WP_000412701.1|68754_69012_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000451769.1|69012_69246_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000155780.1|72631_73300_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001442105.1|73305_74166_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000865634.1|74260_75820_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001093931.1|75816_77241_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001696801.1|77233_78190_+	carbamate kinase	NA	NA	NA	NA	NA
WP_001696803.1|78206_78596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024188138.1|78618_79842_+	cytosine permease	NA	NA	NA	NA	NA
WP_000470711.1|79919_80810_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000595317.1|81243_81633_+	cytochrome B562	NA	NA	NA	NA	NA
WP_000633743.1|84021_84312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097312644.1|84369_85032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001334006.1|86790_87111_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.0	3.5e-13
