The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	119875	165074	5006568	integrase,capsid,protease,lysis,tRNA,terminase,portal,tail,head	Enterobacteria_phage(54.39%)	66	110395:110408	140166:140179
110395:110408	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|119875_120982_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|121035_121497_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|121506_122160_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|122331_123582_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|123695_124838_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|124827_125064_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|125203_125443_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|125426_125753_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|125752_125974_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|126360_126552_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|126524_126707_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|126703_127384_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|127380_128166_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|128171_128468_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|128543_128687_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|128655_128820_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|128892_129261_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|129443_129644_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|129857_130439_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|130455_130728_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|130705_130888_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|131164_131917_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|131913_132471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|132510_133206_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|133281_133497_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|133638_133935_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|133967_134867_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|134863_135565_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|135561_135852_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|135925_136366_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|136362_136890_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|136886_137063_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|137065_137407_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950951.1|137399_137594_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|137613_137976_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|137972_138113_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|138198_138582_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|138770_139853_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|140441_140657_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
140166:140179	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_016239222.1|140656_141151_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.3e-88
WP_001228695.1|141367_141550_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|141640_141934_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|142414_142741_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|142947_143130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|143692_144241_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|144212_146141_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000259002.1|146124_146331_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001329908.1|146327_147920_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_001253914.1|147909_149415_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|149451_149799_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|149856_150885_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|150936_151311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|151303_151657_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|151668_152247_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|152243_152639_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|152646_153387_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|153402_153825_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|153806_154241_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_047340604.1|154233_156795_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.4	0.0e+00
WP_000847405.1|156791_157121_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|157120_157819_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|157824_158568_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|158504_159137_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|159197_162680_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|162738_164799_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|164795_165074_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 2
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	244043	329360	5006568	holin,integrase,capsid,transposase,lysis,protease,terminase,tail,head	Escherichia_phage(30.43%)	89	264530:264545	324622:324637
WP_001111620.1|244043_245243_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|246035_246878_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|246927_247386_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|247498_248404_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|248495_249509_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|249710_250619_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_047340607.1|250762_251176_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|251779_252397_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|253854_256530_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|257006_257654_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001297114.1|258391_260023_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|260108_261029_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|261043_261952_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|261963_262977_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|262973_263978_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|264030_264360_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|264394_265855_-	cardiolipin synthase	NA	NA	NA	NA	NA
264530:264545	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
WP_001309467.1|265997_266171_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|266225_267479_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|267778_268075_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|268298_269015_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|269054_269453_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|269558_270098_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|270127_270871_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|271226_271865_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|271921_273052_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|273029_273278_-	excisionase	NA	NA	NA	NA	NA
WP_016235602.1|273342_275814_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	7.2e-58
WP_016235603.1|275906_276098_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|276094_276283_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_122998275.1|276643_276829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|276832_277051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042030300.1|277122_277422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233320.1|277780_278200_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|278279_278534_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693845.1|278530_278956_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095673.1|278978_279941_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_000788950.1|279947_280694_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450994.1|280715_281486_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	2.7e-80
WP_016235605.1|281501_281927_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	6.3e-63
WP_000150294.1|282101_282767_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018428.1|282947_283160_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	3.1e-26
WP_001329966.1|283327_283600_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265092.1|283601_284657_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140035.1|284657_285023_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001064916.1|285019_285709_+	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	2.3e-54
WP_000917767.1|285923_286121_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_047340608.1|286271_287321_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.1	3.4e-198
WP_000874516.1|288594_290448_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
WP_000284510.1|290598_290814_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016235607.1|290818_291163_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	4.8e-37
WP_000369850.1|291128_291401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992073.1|291506_292040_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.8	3.1e-99
WP_001082539.1|292338_292806_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_000347013.1|293156_293297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|293429_293615_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|294018_294528_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_047340609.1|294499_296428_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	7.4e-260
WP_000259002.1|296411_296618_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_047340610.1|298197_299703_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.2	1.8e-99
WP_047340611.1|299739_300087_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	1.7e-21
WP_000522592.1|300144_301173_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000201501.1|301224_301608_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204533.1|301600_301954_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974994.1|301969_302545_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683079.1|302541_302937_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_016234254.1|302944_303691_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	1.7e-124
WP_001299690.1|303709_304141_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|304167_304581_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_016235616.1|308933_309533_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	5.9e-99
WP_047340613.1|309587_311417_+|tail	tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	77.0	2.5e-47
WP_000239878.1|311927_312596_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|312652_312922_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079492.1|313694_314201_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|314246_314747_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|314832_315012_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|315392_316199_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|316198_317392_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|317403_318762_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|318765_320361_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|320360_321923_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|322014_322059_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|322196_323078_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|323074_323695_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|323722_325618_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
324622:324637	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
WP_047340614.1|325830_326706_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|326745_327336_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|327332_328091_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|328310_329360_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 3
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	1112475	1121284	5006568		Enterobacteria_phage(57.14%)	8	NA	NA
WP_105453002.1|1112475_1113621_-	O18ab/O18ac family O-antigen polymerase	NA	Q9AYY5	Salmonella_phage	42.9	5.3e-80
WP_000052607.1|1113722_1114970_-	O18ab/O18ac family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100795.1|1114966_1115524_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-50
WP_000857501.1|1115531_1116407_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023638.1|1116464_1117364_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699397.1|1117363_1118449_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
WP_000183053.1|1118821_1119715_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_001116035.1|1119889_1121284_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	6.3e-19
>prophage 4
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	1217506	1226951	5006568		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|1217506_1218643_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|1218639_1220643_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|1220767_1221229_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1221269_1221740_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1221786_1222506_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1222502_1224188_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|1224409_1225141_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|1225200_1225308_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|1225288_1226020_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|1226024_1226951_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 5
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	1435558	1506083	5006568	holin,integrase,coat,lysis,protease,tRNA,terminase,portal,head	Enterobacteria_phage(93.55%)	87	1452516:1452532	1496834:1496850
WP_001283598.1|1435558_1436371_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|1436370_1437384_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|1437449_1438586_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|1438684_1439680_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|1439676_1440855_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1441119_1442340_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|1442498_1444505_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|1444625_1444904_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|1444937_1445486_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|1445485_1446295_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|1446294_1447119_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|1447122_1448208_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|1448242_1449175_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|1449340_1449892_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|1450211_1451054_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|1451055_1451583_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|1451579_1452059_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|1452055_1452559_-	fimbrial protein	NA	NA	NA	NA	NA
1452516:1452532	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|1452575_1453328_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|1453347_1455996_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|1457184_1457670_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|1457872_1460017_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|1460016_1461327_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|1461507_1461792_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|1462163_1463504_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|1463561_1464317_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|1464610_1465543_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|1465854_1467012_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_016235118.1|1467251_1468028_-	acyltransferase	NA	C7U0V2	Enterobacteria_phage	99.1	3.0e-79
WP_047340634.1|1468181_1471127_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.6	0.0e+00
WP_000835351.1|1471227_1472151_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	100.0	1.7e-177
WP_000865489.1|1472414_1472555_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_001283825.1|1472660_1472918_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	100.0	4.5e-40
WP_001555939.1|1472941_1473190_+	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	100.0	3.1e-38
WP_001555940.1|1473250_1473832_+	hypothetical protein	NA	A5VW61	Enterobacteria_phage	100.0	1.7e-103
WP_000431541.1|1473816_1474236_+	hypothetical protein	NA	A5VW62	Enterobacteria_phage	100.0	1.6e-74
WP_000288815.1|1474258_1474582_+	hypothetical protein	NA	A5VW63	Enterobacteria_phage	100.0	4.9e-23
WP_001029855.1|1474582_1476742_-	hypothetical protein	NA	A5VW64	Enterobacteria_phage	100.0	0.0e+00
WP_000246973.1|1476741_1478091_-	DNA injection protein	NA	A5VW65	Enterobacteria_phage	100.0	4.5e-248
WP_000964906.1|1478101_1478794_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	100.0	6.6e-118
WP_000627629.1|1478796_1479252_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|1479251_1479953_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|1479952_1481371_-	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|1481380_1481842_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001362792.1|1481822_1482011_-	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_000013270.1|1482052_1483306_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	100.0	3.4e-237
WP_000372589.1|1483324_1484218_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|1484308_1486507_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_047340635.1|1486508_1487924_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	6.8e-279
WP_000113731.1|1487920_1488361_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|1488363_1488606_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|1488833_1489376_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|1489581_1489734_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|1489721_1490159_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|1490155_1490632_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|1490615_1490939_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027549.1|1491535_1492054_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000994516.1|1492050_1492239_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|1492235_1492598_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|1492594_1492885_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|1492884_1493607_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950950.1|1493599_1493776_-	protein ninF	NA	A5VW88	Enterobacteria_phage	100.0	1.5e-26
WP_000386637.1|1493768_1494116_-	DUF2591 domain-containing protein	NA	A5VW89	Enterobacteria_phage	100.0	1.8e-63
WP_001254255.1|1494118_1494295_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000736904.1|1494291_1494732_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_001248381.1|1495006_1496383_-	AAA family ATPase	NA	A5VW94	Enterobacteria_phage	100.0	5.7e-254
WP_001350936.1|1496379_1497327_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	4.4e-157
1496834:1496850	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|1497329_1497602_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|1497624_1497918_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|1498026_1498212_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|1498292_1498943_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_011478232.1|1499063_1499453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219338.1|1499464_1499764_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_000213976.1|1499842_1500043_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000392426.1|1500101_1500524_+	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000638547.1|1501707_1501839_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|1501823_1501976_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031365.1|1502232_1502838_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|1502837_1503221_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|1503244_1503541_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|1503635_1504154_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|1504150_1504450_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|1504451_1505024_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000253289.1|1505023_1505308_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000002106.1|1505300_1505585_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|1505657_1505825_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|1505882_1506083_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 6
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	1633437	1677944	5006568	tail,integrase,holin,terminase	Escherichia_phage(54.35%)	52	1654703:1654720	1684875:1684892
WP_001344399.1|1633437_1633611_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669398.1|1633924_1634440_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1634455_1634995_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_001680560.1|1635213_1635696_-	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	93.1	3.4e-73
WP_000403803.1|1635692_1636322_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	6.8e-114
WP_000256103.1|1636311_1636620_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001276090.1|1636606_1637011_-	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_021515102.1|1637317_1640437_-	endo-alpha-sialidase	NA	A5VW57	Enterobacteria_phage	95.6	0.0e+00
WP_001188252.1|1640632_1640890_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_000932553.1|1640914_1641421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164248.1|1641410_1641830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127505.1|1642275_1642971_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	100.0	5.4e-128
WP_000856391.1|1643111_1643744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|1643842_1644004_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000723561.1|1644033_1644885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123343.1|1644886_1648276_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.9	1.4e-184
WP_001145645.1|1648275_1651023_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	6.9e-118
WP_000336178.1|1651022_1651601_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	79.8	7.1e-57
WP_000568022.1|1651600_1652065_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.1e-84
WP_001018550.1|1652064_1654536_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000179261.1|1654535_1655141_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	100.0	2.1e-112
1654703:1654720	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_000424491.1|1655140_1655464_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	100.0	2.4e-54
WP_000012377.1|1655514_1655850_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000627073.1|1655860_1656298_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	1.4e-73
WP_000268708.1|1656349_1657336_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	1.2e-186
WP_001048087.1|1657350_1658046_-	peptidase	NA	G9L6C4	Escherichia_phage	99.6	3.0e-94
WP_000133160.1|1658048_1658345_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_000852424.1|1658341_1660021_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.9	1.8e-302
WP_000335899.1|1660035_1660242_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000848286.1|1660944_1661367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132536.1|1661410_1662886_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.6	3.4e-297
WP_024187282.1|1662882_1663557_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	4.4e-119
WP_001129690.1|1663596_1663935_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	1.3e-58
WP_000002105.1|1663927_1664209_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	98.9	1.5e-49
WP_000253289.1|1664201_1664486_-	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000161575.1|1664485_1665058_-	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000445438.1|1665356_1665878_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	53.9	3.4e-34
WP_001231315.1|1665939_1666287_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	95.7	1.3e-58
WP_001680564.1|1666404_1667190_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	2.1e-152
WP_001680565.1|1667186_1668002_-	hypothetical protein	NA	Q286X4	Escherichia_phage	96.0	2.0e-118
WP_001282459.1|1668368_1668599_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|1668753_1669338_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001102251.1|1669646_1669946_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_000805233.1|1669942_1670149_+	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	86.0	6.7e-18
WP_001091670.1|1670145_1670967_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.8	2.8e-160
WP_000063823.1|1670963_1671845_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	5.2e-160
WP_000675390.1|1671894_1672143_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|1672300_1672552_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_001077943.1|1673190_1673385_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
WP_000954559.1|1673388_1674639_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	7.2e-240
WP_000138282.1|1674831_1676409_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1676477_1677944_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
1684875:1684892	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 7
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	1761818	1849171	5006568	holin,capsid,protease,lysis,tRNA,plate,terminase,portal,tail,head	Shigella_phage(42.86%)	95	NA	NA
WP_000083664.1|1761818_1762556_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1762687_1764022_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|1764054_1764936_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|1765038_1765626_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1765681_1766065_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1766369_1767059_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|1767106_1768144_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1768350_1768770_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|1768838_1769537_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|1769568_1772229_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1772342_1773698_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|1773743_1774067_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|1774063_1775362_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|1783850_1786424_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|1786553_1787285_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079114.1|1787281_1788262_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1788396_1789134_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1789403_1789745_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1789848_1789896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|1789994_1791155_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|1791197_1792319_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|1792329_1793400_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|1793609_1793975_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|1794123_1794642_+	YfiR family protein	NA	NA	NA	NA	NA
WP_088458313.1|1794631_1795858_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|1795873_1796356_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1796432_1796780_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1796821_1797589_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1797619_1798168_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1798186_1798435_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1798571_1799933_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1800099_1800891_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1800911_1802198_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|1802252_1802846_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|1802968_1803847_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|1803932_1805594_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1805742_1806084_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|1806145_1806436_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|1806425_1806902_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1807033_1807516_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|1808672_1809461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|1809548_1809842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|1810052_1810826_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|1811877_1813767_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|1814020_1814512_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|1814514_1814958_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|1814929_1815532_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|1815531_1816275_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|1816278_1816863_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|1816853_1817912_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|1817898_1818324_-	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|1818323_1818872_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|1818871_1819951_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|1819947_1821276_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|1821336_1823172_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|1823313_1823583_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|1823582_1823939_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|1823938_1825435_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|1825418_1825589_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|1825597_1826158_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|1826154_1826661_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|1826635_1827046_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|1827042_1827366_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|1827368_1827569_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|1827618_1828824_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|1828838_1829489_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|1829466_1830708_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|1830707_1830890_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|1830901_1832398_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|1832631_1833126_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|1833251_1833602_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_001332386.1|1834250_1834502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|1834572_1835010_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|1835006_1835483_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|1835469_1835775_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|1835926_1836262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|1836447_1837200_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|1837213_1838203_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|1838210_1839008_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|1839027_1839417_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|1839413_1839740_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|1839736_1840390_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|1840389_1840884_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|1840880_1841822_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|1841811_1841991_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|1842166_1842718_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|1842761_1842962_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1843052_1843727_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|1843929_1844442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|1844910_1845273_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|1845338_1846163_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|1846290_1846815_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|1846923_1847790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|1847831_1848038_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|1847998_1849171_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 8
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	1924691	1931831	5006568		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|1924691_1927253_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|1927358_1928015_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|1928065_1928833_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|1929028_1929937_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|1929933_1931196_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|1931192_1931831_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 9
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	3683009	3693931	5006568	integrase	Enterobacteria_phage(88.89%)	14	3673043:3673058	3697809:3697824
3673043:3673058	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000776997.1|3683009_3684275_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.5	2.2e-74
WP_000418440.1|3684332_3685226_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000932801.1|3685234_3685750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205027.1|3685947_3686259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|3686568_3687141_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|3687214_3687715_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|3687711_3688446_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|3688996_3689263_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|3689259_3689850_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244669.1|3689842_3690130_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	1.5e-47
WP_000459302.1|3690122_3690578_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|3690713_3691034_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_047335273.1|3691048_3693382_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_044815386.1|3693736_3693931_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
3697809:3697824	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 10
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	4383004	4436782	5006568	holin,integrase,capsid,lysis,protease,tRNA,terminase,portal,tail,head	Enterobacteria_phage(40.35%)	70	4423207:4423221	4437969:4437983
WP_000912345.1|4383004_4384390_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|4384425_4384947_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4385054_4385267_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4385268_4386135_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001298992.1|4386497_4387661_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_012599996.1|4387516_4387972_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_000206813.1|4387887_4388193_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|4388192_4388555_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008237.1|4388545_4389082_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	1.8e-99
WP_000081271.1|4389209_4390034_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	1.3e-149
WP_000135682.1|4390099_4390462_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|4390932_4391448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000167381.1|4391832_4392909_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	59.9	3.4e-121
WP_001535858.1|4393079_4393784_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.9	3.4e-69
WP_001535859.1|4393890_4394154_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	4.2e-09
WP_014639455.1|4394182_4394740_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	1.5e-96
WP_001250269.1|4394915_4395095_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104985.1|4395084_4396041_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	96.5	7.6e-149
WP_001573323.1|4396037_4396532_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|4396531_4396858_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|4396854_4397244_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061427.1|4397263_4398106_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_047340697.1|4398113_4399103_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	1.2e-192
WP_001047122.1|4399116_4399869_+	antitermination protein	NA	Q8SBE4	Shigella_phage	97.6	8.4e-135
WP_000966854.1|4400023_4400554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317671.1|4400736_4400931_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
WP_000799651.1|4401080_4402142_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.7	2.7e-203
WP_000502162.1|4403023_4403215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284486.1|4403237_4403453_+|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_000250557.1|4403457_4403802_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	3.5e-35
WP_000370548.1|4403767_4404040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992182.1|4404145_4404679_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	2.6e-98
WP_001228695.1|4404895_4405078_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738425.1|4405168_4405462_-	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_000830178.1|4405942_4406269_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4406475_4406658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453587.1|4407222_4407768_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027346.1|4407742_4409668_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.8	0.0e+00
WP_000198153.1|4409664_4409871_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001680328.1|4409867_4411469_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.6e-308
WP_000123294.1|4411449_4412769_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	99.1	1.9e-235
WP_001345004.1|4412778_4413111_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063261.1|4413166_4414192_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	2.5e-190
WP_000158890.1|4414233_4414629_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	4.1e-56
WP_000753007.1|4414640_4414994_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000975070.1|4415005_4415584_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683145.1|4415580_4415976_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_014639458.1|4415983_4416724_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	1.2e-128
WP_000479183.1|4416739_4417162_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	6.5e-68
WP_000459457.1|4417143_4417578_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840362.1|4417570_4420150_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.9	0.0e+00
WP_047340698.1|4420146_4420476_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	5.2e-57
WP_021038075.1|4420475_4421174_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_047340699.1|4421178_4421922_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_023277304.1|4421819_4422467_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_021038077.1|4422527_4426007_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
4423207:4423221	attL	TCGGCAGCCAGCAGG	NA	NA	NA	NA
WP_001233118.1|4426075_4426675_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	6.5e-106
WP_021525875.1|4426739_4428800_+|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	66.0	1.1e-152
WP_001204581.1|4428796_4429075_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355700.1|4429084_4429378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|4429417_4429516_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000742376.1|4429570_4430227_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|4430295_4430601_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226381.1|4430784_4432269_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201822.1|4432455_4433409_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001331488.1|4433883_4434192_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001304815.1|4434211_4434511_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_000259980.1|4434568_4434874_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_000239877.1|4434928_4435597_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201816.1|4435828_4436782_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
4437969:4437983	attR	TCGGCAGCCAGCAGG	NA	NA	NA	NA
>prophage 11
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	4714197	4786018	5006568	capsid,integrase,lysis,protease,plate,terminase,portal,tail,head	Salmonella_phage(65.38%)	78	4713724:4713749	4743747:4743772
4713724:4713749	attL	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290938.1|4714197_4715229_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
WP_001513672.1|4715418_4715610_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|4715625_4716195_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|4716320_4716542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|4716574_4717084_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|4717091_4717292_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001504055.1|4717255_4717597_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_001244163.1|4717664_4717898_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_047340703.1|4717897_4718125_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.0e-35
WP_047340704.1|4718121_4718979_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	2.8e-158
WP_047340705.1|4718975_4721390_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_001154434.1|4721544_4721733_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4721743_4721977_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_047340706.1|4722361_4723402_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.8	3.5e-171
WP_001098431.1|4723401_4725168_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_047340707.1|4725310_4726144_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.6	6.3e-123
WP_000742510.1|4726160_4727219_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_047340708.1|4727222_4727873_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_047340709.1|4727968_4728433_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	2.1e-75
WP_000868175.1|4728432_4728636_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4728639_4728855_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|4728874_4729348_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_047340710.1|4729349_4729727_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	1.8e-16
WP_001080918.1|4729723_4730152_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
WP_088458319.1|4730247_4730679_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	4.9e-71
WP_047340712.1|4730671_4731118_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	1.3e-61
WP_001552634.1|4731186_4731765_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	1.1e-94
WP_000177581.1|4731761_4732121_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	2.8e-51
WP_001552638.1|4732107_4733016_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.6e-143
WP_047340713.1|4733008_4733614_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_047340714.1|4733610_4735017_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	75.0	9.8e-153
WP_006655262.1|4735019_4735445_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	60.0	3.3e-43
WP_001535207.1|4735827_4736394_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.9e-86
WP_000046120.1|4736534_4737707_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|4737716_4738232_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001552643.1|4738286_4738589_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	87.0	1.7e-38
WP_000763311.1|4738603_4738723_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282787.1|4738715_4741793_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_001552644.1|4741789_4742275_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_001011804.1|4742271_4743372_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.2e-175
WP_000972391.1|4743462_4743681_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|4743916_4745602_-	transporter	NA	NA	NA	NA	NA
4743747:4743772	attR	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|4745871_4746249_+	membrane protein	NA	NA	NA	NA	NA
WP_001195230.1|4746278_4746536_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|4746695_4746983_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|4746966_4747689_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000203025.1|4748738_4749215_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|4749564_4750677_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4750771_4751905_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|4751914_4752868_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4752864_4753710_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4753769_4754258_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|4754298_4755426_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_001295905.1|4755454_4756186_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|4756411_4757080_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|4757079_4757796_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|4757802_4758534_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4758551_4759280_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|4759497_4760013_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4760138_4760462_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|4760458_4761289_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001305933.1|4761285_4762299_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136572.1|4762397_4763828_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566391.1|4763838_4764840_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|4764876_4766595_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178694.1|4766727_4767696_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|4767707_4769360_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|4769503_4770403_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|4770723_4771419_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599804.1|4771844_4773503_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|4773499_4774456_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746477.1|4774606_4775722_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188147.1|4775718_4777665_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4777737_4777962_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4778284_4778605_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4778635_4780912_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|4781804_4782788_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|4782784_4786018_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
>prophage 12
NZ_CP006830	Escherichia coli APEC O18, complete genome	5006568	4791696	4846969	5006568	holin,capsid,integrase,lysis,tRNA,plate,terminase,portal,tail,head	Escherichia_phage(58.33%)	56	4789661:4789678	4853187:4853204
4789661:4789678	attL	GCGGCGTTATTTGCAAAA	NA	NA	NA	NA
WP_001241673.1|4791696_4792401_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202197.1|4792442_4794164_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.6e-14
WP_001043637.1|4794164_4795931_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	9.2e-23
WP_000537432.1|4796053_4797019_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4797562_4798057_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077107.1|4798191_4802235_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4802393_4803005_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4803015_4804359_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4804449_4805742_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_047340716.1|4805980_4808425_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	6.0e-222
WP_000213098.1|4808435_4809053_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534662.1|4809054_4809918_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165876.1|4809953_4810580_-	hydrolase	NA	NA	NA	NA	NA
WP_000109282.1|4810893_4812042_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|4812138_4812936_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|4812967_4813963_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|4814056_4814356_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|4814464_4814821_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_000217670.1|4814998_4815499_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_047335303.1|4815562_4815787_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.8e-32
WP_047340717.1|4815786_4816089_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	6.5e-46
WP_001113270.1|4816088_4816313_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027667.1|4816309_4816585_+	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_047335304.1|4816574_4818830_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_001062015.1|4819005_4820289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389235.1|4820281_4821265_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_033560205.1|4821657_4822692_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.4e-201
WP_021525811.1|4822691_4824464_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085948.1|4824637_4825492_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248561.1|4825550_4826624_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
WP_021525812.1|4826627_4827371_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	96.8	8.1e-122
WP_000988636.1|4827470_4827980_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846409.1|4827979_4828183_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|4828186_4828468_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4828467_4828965_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_047340718.1|4828979_4829405_+	hypothetical protein	NA	M1SV74	Escherichia_phage	94.3	1.7e-55
WP_016239049.1|4829392_4829818_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	97.2	6.1e-66
WP_001440152.1|4829789_4829963_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917151.1|4829925_4830393_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001780.1|4830385_4830838_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_047340719.1|4830904_4831540_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	99.5	5.3e-114
WP_000127163.1|4831536_4831884_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121486.1|4831888_4832797_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	1.3e-161
WP_047335205.1|4832789_4833320_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	1.2e-100
WP_016234132.1|4833330_4836090_+|tail	phage tail fiber protein	tail	Q858V4	Yersinia_virus	76.5	0.0e+00
WP_001164158.1|4836093_4836621_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	2.2e-89
WP_047335206.1|4836842_4837436_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.5	2.6e-107
WP_001286691.1|4837765_4838956_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.2e-223
WP_001251408.1|4838968_4839487_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4839543_4839819_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4839851_4839971_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_033560206.1|4839963_4842411_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.6	0.0e+00
WP_000978907.1|4842425_4842905_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_033560207.1|4842904_4844068_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.9	6.3e-206
WP_000468308.1|4844149_4844368_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|4844686_4846969_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
4853187:4853204	attR	GCGGCGTTATTTGCAAAA	NA	NA	NA	NA
