The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	0	65742	5002781	terminase,lysis,capsid,holin,plate,tail,tRNA,head	Escherichia_phage(42.86%)	58	NA	NA
WP_021525811.1|24_1797_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085948.1|1970_2825_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248561.1|2883_3957_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
WP_000988633.1|4802_5312_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|5311_5515_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|5518_5800_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_047335199.1|5799_6297_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.0e-92
WP_047335200.1|6311_6737_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	93.6	4.0e-57
WP_047335201.1|6724_7150_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_001440152.1|7121_7295_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_047335202.1|7257_7725_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	6.7e-82
WP_001001780.1|7717_8170_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_047335203.1|8382_9126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047335204.1|9209_9845_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	93.8	2.5e-108
WP_000127163.1|9841_10189_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121486.1|10193_11102_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	1.3e-161
WP_047335205.1|11094_11625_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	1.2e-100
WP_016234132.1|11635_14395_+|tail	phage tail fiber protein	tail	Q858V4	Yersinia_virus	76.5	0.0e+00
WP_001164158.1|14398_14926_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	2.2e-89
WP_047335206.1|15147_15741_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.5	2.6e-107
WP_001286717.1|16070_17261_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251406.1|17273_17792_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	4.2e-93
WP_001031303.1|17848_18124_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|18156_18276_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_047335207.1|18268_20716_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.8	0.0e+00
WP_000978915.1|20730_21210_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_047335208.1|21209_22373_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.2	3.8e-203
WP_001292822.1|22991_25274_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_047335209.1|25328_26186_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194828.1|26591_28352_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642837.1|28481_29174_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057124.1|29372_30461_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
WP_000445244.1|30531_31815_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001313710.1|31984_32749_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|32921_33605_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|33715_35389_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|35548_35833_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705727.1|36038_38303_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|38339_40088_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570549.1|40084_41071_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056555.1|41107_42340_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|42391_42574_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011611.1|42570_43317_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436900.1|43470_44364_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|44340_45120_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001555859.1|45255_46041_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288856.1|46037_47360_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|47340_48045_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572616.1|48044_52505_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000926021.1|52765_54613_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|54793_55342_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|55368_56016_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|56065_57256_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977927.1|57440_58529_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|59130_60531_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001298298.1|60699_61902_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193873.1|62167_64780_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	1.2e-18
WP_001090487.1|64974_65742_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 2
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	74497	76405	5002781		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|74497_76405_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 3
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	89004	91059	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_001350178.1|89004_91059_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 4
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	95293	95953	5002781	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|95293_95953_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 5
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	106947	119465	5002781		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|106947_107160_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|107170_107359_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|107333_107564_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|107553_107727_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818464.1|107775_108849_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054739.1|108931_111664_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	5.4e-38
WP_001264953.1|111746_112775_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|112747_113440_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|113569_114742_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063164.1|114741_117288_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000210216.1|117284_117884_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|118239_118545_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|118544_119465_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 6
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	122495	124489	5002781		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001273658.1|122495_122669_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001028100.1|123994_124489_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
>prophage 7
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	138949	139873	5002781		Cronobacter_phage(100.0%)	1	NA	NA
WP_001304747.1|138949_139873_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.1e-91
>prophage 8
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	146693	149542	5002781	integrase	Bacillus_phage(50.0%)	2	147569:147583	150901:150915
WP_000409834.1|146693_148061_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.5	9.6e-20
147569:147583	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_000279880.1|148339_149542_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000279880.1|148339_149542_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
150901:150915	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
>prophage 9
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	179981	183767	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_113705736.1|179981_183767_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
>prophage 10
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	204021	207094	5002781		Yersinia_phage(25.0%)	6	NA	NA
WP_001234585.1|204021_204843_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.6	1.1e-47
WP_001164966.1|204842_205088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|205181_205655_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186727.1|205670_206147_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|206209_206431_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000086759.1|206449_207094_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.7	2.7e-25
>prophage 11
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	213010	213844	5002781		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|213010_213844_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 12
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	217977	218511	5002781		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|217977_218511_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 13
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	227818	228739	5002781		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|227818_228739_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 14
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	233401	233647	5002781		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|233401_233647_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 15
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	249527	250469	5002781		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001331933.1|249527_250469_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 16
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	262825	264007	5002781		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|262825_263560_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|263770_264007_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 17
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	267278	268921	5002781		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257012.1|267278_267920_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.4	3.8e-27
WP_001267963.1|267916_268921_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 18
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	281243	281501	5002781		Erwinia_phage(100.0%)	1	NA	NA
WP_000800132.1|281243_281501_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 19
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	288790	292513	5002781		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|288790_289492_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251363.1|289491_290736_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291301.1|290764_291676_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|291691_292513_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 20
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	295788	297766	5002781		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|295788_296646_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|296629_297766_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 21
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	302787	350036	5002781	terminase,lysis,capsid,portal,protease,integrase,tRNA,tail,head	Enterobacteria_phage(53.45%)	68	297474:297489	357829:357844
297474:297489	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_000423737.1|302787_304158_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001295971.1|304161_304803_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|304838_305945_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|305998_306460_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|306469_307123_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|307294_308545_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|308658_309801_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|309790_310027_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|310166_310406_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|310389_310716_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|310715_310937_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|311323_311515_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|311487_311670_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|311666_312347_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|312343_313129_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|313134_313431_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|313506_313650_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|313618_313783_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|313855_314224_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|314406_314607_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|314820_315402_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|315418_315691_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|315668_315851_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|316127_316880_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|316876_317434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|317473_318169_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|318244_318460_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|318601_318898_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|318930_319830_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|319826_320528_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|320524_320815_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|320888_321329_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|321325_321853_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|321849_322026_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|322028_322370_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950951.1|322362_322557_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|322576_322939_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|322935_323076_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|323161_323545_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|323733_324816_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|325404_325620_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_016239222.1|325619_326114_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.3e-88
WP_001228695.1|326330_326513_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|326603_326897_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|327377_327704_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|327910_328093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|328654_329203_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_047335212.1|329174_331103_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.5e-260
WP_000258997.1|331086_331293_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|331289_332882_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|332871_334377_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|334413_334761_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|334818_335847_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|335898_336273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|336265_336619_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|336630_337209_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|337205_337601_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|337608_338349_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|338364_338787_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|338768_339203_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000840269.1|339195_341757_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|341753_342083_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|342082_342781_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|342786_343530_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|343466_344099_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|344159_347642_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_047335213.1|347700_349761_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	1.5e-125
WP_000654167.1|349757_350036_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
357829:357844	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 22
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	355809	357580	5002781		Phage_21(50.0%)	4	NA	NA
WP_000539892.1|355809_355962_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001445545.1|356045_356171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|356223_356628_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332310.1|356848_357580_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
>prophage 23
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	371815	373503	5002781		Morganella_phage(50.0%)	2	NA	NA
WP_000897380.1|371815_372235_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	2.6e-37
WP_000457594.1|372234_373503_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.0	5.3e-206
>prophage 24
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	389531	390290	5002781		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_047335215.1|389531_390290_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	6.7e-15
>prophage 25
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	402737	405489	5002781		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033350.1|402737_404417_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|404541_405489_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 26
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	408625	414894	5002781		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|408625_409708_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456474.1|409707_410541_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|410537_410930_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257054.1|410933_411743_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|411778_412633_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|412780_412888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313768.1|413293_414394_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|414663_414894_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 27
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	426025	522888	5002781	transposase,terminase,lysis,capsid,portal,protease,holin,integrase,tail,head	Escherichia_phage(29.31%)	104	421951:421970	530975:530994
421951:421970	attL	TTTAGTTACAACATACTAAT	NA	NA	NA	NA
WP_000702647.1|426025_427564_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
WP_000571681.1|427560_428271_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|428270_428948_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001111620.1|429000_430200_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|430992_431835_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|431884_432343_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|432455_433361_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|433452_434466_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|434667_435576_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|435719_436133_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|436736_437354_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|438811_441487_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|441963_442611_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001297114.1|443348_444980_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|445065_445986_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|446000_446909_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|446920_447934_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|447930_448935_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|448987_449317_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|449351_450812_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|450954_451128_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|451182_452436_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|452735_453032_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|453255_453972_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|454011_454410_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|454515_455055_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|455084_455828_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|456183_456822_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|456867_457998_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|457975_458224_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|458288_460760_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|460852_461044_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|461040_461229_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|461629_461794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|461794_462016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|462175_462331_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|462623_462962_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|463353_463596_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|463579_464005_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|464076_465147_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|465187_465610_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|465801_466764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|466779_467781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|468189_468297_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|468341_468554_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|468721_469000_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|469001_470048_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|470060_470435_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|470431_471253_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|471477_471675_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|471825_472875_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|474149_474377_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_001331708.1|474334_474496_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	2.3e-13
WP_000372595.1|474645_474861_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|474865_475210_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|475175_475448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992052.1|475553_476087_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001082537.1|476385_476850_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|477157_477568_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|477624_477858_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|478244_478793_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622378.1|478764_480693_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.2e-259
WP_000259002.1|480676_480883_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|480879_482472_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253958.1|482461_483967_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256823.1|484003_484351_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|484408_485437_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|485488_485872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|485864_486218_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|486233_486767_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|486763_487159_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_021528565.1|487166_487919_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	1.1e-134
WP_021530079.1|487932_488364_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	69.4	1.6e-42
WP_000533402.1|488390_488804_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|488784_491358_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|491354_491684_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|491683_492382_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|492386_493130_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|493066_493669_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|493742_494081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515773.1|494147_497627_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233195.1|497694_498294_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|498445_501553_+	membrane protein	NA	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|501552_502137_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240997.1|502191_502860_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|502916_503186_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079492.1|503958_504465_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|504510_505011_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|505096_505276_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|505656_506463_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|506462_507656_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|507667_509026_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|509029_510625_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|510624_512187_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|512278_512323_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|512460_513342_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|513338_513959_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|513986_515882_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|516094_516970_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|517009_517600_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|517596_518355_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|518574_519624_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|519659_519911_-	YciN family protein	NA	NA	NA	NA	NA
WP_001304419.1|520290_522888_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
530975:530994	attR	TTTAGTTACAACATACTAAT	NA	NA	NA	NA
>prophage 28
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	527798	528389	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|527798_528389_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 29
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	536202	538137	5002781		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485006.1|536202_538137_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	4.8e-33
>prophage 30
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	547071	549089	5002781		Salmonella_phage(50.0%)	2	NA	NA
WP_021038110.1|547071_548235_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	6.2e-28
WP_000573407.1|548282_549089_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 31
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	568431	569514	5002781		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057991.1|568431_569514_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-23
>prophage 32
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	586738	587254	5002781		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|586738_587254_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 33
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	592016	601437	5002781	tRNA	Bacillus_phage(20.0%)	7	NA	NA
WP_001350888.1|592016_593249_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|593503_594487_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|594761_594935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123782.1|594964_596338_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157413.1|596466_597402_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001295593.1|599728_600163_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|600303_601437_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 34
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	606396	607386	5002781		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|606396_607386_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 35
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	626256	630159	5002781		Klosneuvirus(100.0%)	1	NA	NA
WP_000139522.1|626256_630159_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 36
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	634099	635048	5002781		Escherichia_phage(50.0%)	2	NA	NA
WP_001350640.1|634099_634630_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|634874_635048_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 37
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	646599	648561	5002781		Phage_TP(100.0%)	1	NA	NA
WP_001441964.1|646599_648561_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 38
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	652190	653204	5002781		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220436.1|652190_653204_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 39
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	658700	660803	5002781		Salmonella_phage(100.0%)	1	NA	NA
WP_000689338.1|658700_660803_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.1	6.6e-137
>prophage 40
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	665428	667834	5002781		Ralstonia_phage(100.0%)	1	NA	NA
WP_000053647.1|665428_667834_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.6	8.4e-27
>prophage 41
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	674317	675862	5002781		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|674317_675862_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 42
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	687286	689045	5002781		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|687286_687571_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605675.1|687570_687849_-	hypothetical protein	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000642412.1|688034_689045_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
>prophage 43
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	692451	694851	5002781		Klosneuvirus(100.0%)	1	NA	NA
WP_001362858.1|692451_694851_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	2.1e-09
>prophage 44
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	700319	707255	5002781		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_000402827.1|700319_703115_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	4.4e-19
WP_000832485.1|703159_705532_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001304373.1|705569_707255_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
>prophage 45
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	728730	730149	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_000558461.1|728730_730149_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.4e-18
>prophage 46
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	736892	739022	5002781		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091198.1|736892_737276_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803537.1|737307_737526_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012592.1|737582_739022_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.8e-30
>prophage 47
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	746523	747414	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_000592858.1|746523_747414_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 48
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	751801	766226	5002781		Escherichia_phage(44.44%)	16	NA	NA
WP_000214712.1|751801_752005_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000526706.1|752040_753501_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	5.1e-43
WP_001350651.1|753589_753868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015952996.1|753851_753944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836075.1|754001_755021_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001298659.1|755032_756247_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
WP_001304355.1|756452_756779_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705201.1|756913_757255_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|757289_757850_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001296084.1|757852_758563_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778146.1|758670_758976_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041666.1|759174_761601_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
WP_001468025.1|761661_764085_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000213028.1|764095_764713_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526507.1|764714_765569_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148695.1|765611_766226_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
>prophage 49
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	783967	785269	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_000732519.1|783967_785269_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 50
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	795164	796976	5002781		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945903.1|795164_796976_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 51
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	816668	817943	5002781	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001339629.1|816668_817943_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 52
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	824854	826353	5002781		Salmonella_phage(50.0%)	2	NA	NA
WP_001350654.1|824854_825376_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250643.1|825456_826353_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 53
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	830768	839560	5002781		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101200.1|830768_831584_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	9.8e-20
WP_000007283.1|831711_832293_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701049.1|832438_833608_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|833773_833863_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|834161_835187_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269493.1|835183_836116_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|836228_837440_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|837730_838879_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|838918_839560_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 54
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	845065	847332	5002781		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587583.1|845065_845878_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069965.1|845881_846667_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001362847.1|846663_847332_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 55
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	855621	860705	5002781		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|855621_856842_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_021525913.1|856838_858110_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948883.1|858084_858831_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.1	5.1e-07
WP_047335221.1|858840_860328_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367158.1|860336_860705_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
>prophage 56
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	879123	898717	5002781	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553669.1|879123_880824_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
WP_000069409.1|880880_883259_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|883591_884425_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|884581_885628_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001313872.1|885759_885951_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175635.1|885954_887391_-	YdiU family protein	NA	NA	NA	NA	NA
WP_047335222.1|887453_888155_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209783.1|888414_888879_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_000029464.1|888956_889706_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154199.1|889705_890257_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|890318_891299_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|891399_891699_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672426.1|891703_894091_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|894105_895089_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|895372_895417_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|895539_895896_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|895948_896146_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|896242_896785_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|896788_898717_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 57
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	908093	910355	5002781		Tupanvirus(100.0%)	1	NA	NA
WP_000077882.1|908093_910355_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.9e-143
>prophage 58
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	916480	917308	5002781		Bacillus_virus(100.0%)	1	NA	NA
WP_000175056.1|916480_917308_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	3.5e-73
>prophage 59
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	924784	926005	5002781		Klosneuvirus(100.0%)	1	NA	NA
WP_000081990.1|924784_926005_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 60
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	932768	933422	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|932768_933422_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 61
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	937812	939768	5002781		Streptococcus_phage(100.0%)	1	NA	NA
WP_001332112.1|937812_939768_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 62
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	944694	948780	5002781		Tupanvirus(50.0%)	4	NA	NA
WP_001135068.1|944694_945336_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_001313906.1|945428_946787_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|946904_947663_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723732.1|947799_948780_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	6.7e-07
>prophage 63
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	957593	958448	5002781		Indivirus(100.0%)	1	NA	NA
WP_001332110.1|957593_958448_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 64
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	961766	966343	5002781		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|961766_963050_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621390.1|963196_964672_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766137.1|964852_966343_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 65
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	975310	983416	5002781	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_088412573.1|975310_976996_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|977200_977782_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220977.1|977821_978517_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128839.1|978574_980485_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.0e-91
WP_001351125.1|980616_980961_+	RidA family protein	NA	NA	NA	NA	NA
WP_001304301.1|981322_981682_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|981801_981981_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855011.1|982054_983416_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	2.3e-42
>prophage 66
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	987278	988835	5002781		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|987278_988835_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 67
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	994474	994684	5002781		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|994474_994684_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 68
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1000017	1002066	5002781		Moraxella_phage(100.0%)	1	NA	NA
WP_001055805.1|1000017_1002066_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	4.0e-86
>prophage 69
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1009562	1014030	5002781		Escherichia_phage(33.33%)	7	NA	NA
WP_000812741.1|1009562_1010219_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.4e-56
WP_000984819.1|1010613_1010955_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879320.1|1010967_1011840_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|1011843_1012218_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1012356_1012587_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|1012688_1013345_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1013367_1014030_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 70
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1022086	1023562	5002781		Cyanophage(100.0%)	1	NA	NA
WP_000301724.1|1022086_1023562_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
>prophage 71
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1027560	1034695	5002781		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|1027560_1028883_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|1028898_1029831_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1029909_1030665_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|1030661_1031447_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1031663_1032674_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1032682_1033294_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|1033432_1033498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024939.1|1033569_1034172_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1034173_1034695_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 72
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1038588	1112733	5002781	terminase,capsid,portal,holin,integrase,tRNA,tail,plate,head	Enterobacteria_phage(69.39%)	86	1076054:1076113	1113676:1113799
WP_000639256.1|1038588_1039407_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_001313931.1|1039459_1039855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1039895_1040639_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564725.1|1040635_1041607_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176867.1|1041771_1044201_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214282.1|1044225_1045326_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185753.1|1045713_1046460_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001304291.1|1046473_1047040_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025351.1|1047255_1048989_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	3.7e-85
WP_001202075.1|1049041_1049434_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|1049433_1051512_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278942.1|1051504_1052653_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1052861_1053506_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763860.1|1053516_1053906_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_000036385.1|1053920_1054970_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204321.1|1054972_1055833_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001350672.1|1056123_1057785_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.5	1.6e-08
WP_000147302.1|1057929_1058433_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001362840.1|1058453_1060418_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795632.1|1060422_1061349_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|1061345_1062233_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1062359_1062938_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1062940_1063291_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122412.1|1064070_1064499_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001332091.1|1064505_1065930_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001298457.1|1065904_1066705_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987903.1|1066871_1067861_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187785.1|1067872_1069387_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.1e-12
WP_001298461.1|1069456_1070446_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1071242_1071746_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1071823_1072075_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1072189_1072276_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237882.1|1072539_1072863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1073034_1073532_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1073569_1073809_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1073999_1075211_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1075261_1075927_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1076054:1076113	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|1076283_1077285_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865386.1|1077290_1077638_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290349.1|1077667_1078318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1078333_1078738_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1078827_1078965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1079036_1079240_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|1079261_1079612_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159462.1|1079622_1079901_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000514274.1|1079912_1080155_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000021655.1|1080151_1080265_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991915.1|1080357_1080774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985144.1|1080797_1081001_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000153711.1|1080997_1081264_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000108349.1|1081260_1081560_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	5.3e-40
WP_122985482.1|1081571_1082189_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|1082185_1082575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001608.1|1082571_1085355_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.8	0.0e+00
WP_000502620.1|1085535_1086657_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_001140702.1|1086680_1088906_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000087833.1|1089398_1090445_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	98.9	1.8e-204
WP_000613787.1|1090444_1092196_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262673.1|1092350_1093187_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055089.1|1093210_1094263_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_000632330.1|1094308_1095109_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	2.4e-124
WP_000063082.1|1095211_1095706_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864900.1|1095705_1095906_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	7.9e-32
WP_000104350.1|1095908_1096232_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072340.1|1096228_1096621_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.2e-70
WP_000780570.1|1096617_1097025_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	3.4e-66
WP_000920586.1|1097162_1097630_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000356339.1|1097622_1098258_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271919.1|1098254_1098836_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.2e-99
WP_000213455.1|1098832_1099183_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	1.0e-58
WP_001111930.1|1099186_1100083_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
WP_000071708.1|1100075_1100606_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	3.3e-93
WP_047335224.1|1100608_1102594_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	94.1	2.2e-174
WP_000972183.1|1102596_1103130_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
WP_001164115.1|1103158_1103686_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	2.5e-93
WP_032147172.1|1103689_1104394_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	95.3	3.0e-126
WP_047335225.1|1104630_1105230_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.8	7.2e-97
WP_000979954.1|1105256_1105745_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853425.1|1105757_1108565_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.1	0.0e+00
WP_000333494.1|1108551_1108707_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000393173.1|1108715_1109081_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.1e-55
WP_000290450.1|1109135_1109648_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005425.1|1109647_1110832_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000132830.1|1110989_1112099_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|1112141_1112402_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1112592_1112733_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
1113676:1113799	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 73
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1118991	1119744	5002781		Bacillus_virus(100.0%)	1	NA	NA
WP_001273001.1|1118991_1119744_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 74
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1132010	1134274	5002781		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000334564.1|1132010_1132679_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.2e-79
WP_000737290.1|1133191_1134274_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 75
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1150603	1163029	5002781		Bacillus_phage(33.33%)	11	NA	NA
WP_001514281.1|1150603_1152298_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000922683.1|1152729_1153647_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1153819_1154740_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1154728_1155199_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157275.1|1155179_1156598_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365553.1|1156664_1157360_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	7.3e-08
WP_001447259.1|1157399_1157765_-	permease	NA	NA	NA	NA	NA
WP_000824356.1|1158330_1159446_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.2e-91
WP_000218046.1|1160041_1160893_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826721.1|1160999_1162358_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001353857.1|1162357_1163029_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.8e-32
>prophage 76
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1167300	1208716	5002781	terminase,capsid,portal,protease,holin,integrase,tail,head	Escherichia_phage(36.59%)	50	1178121:1178135	1216612:1216626
WP_000859544.1|1167300_1167873_-	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_000734593.1|1167869_1168691_-	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000358619.1|1168687_1169401_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000355702.1|1169900_1170191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204579.1|1170200_1170479_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
WP_047335227.1|1170475_1172542_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	66.9	8.4e-161
WP_001233170.1|1172606_1173206_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	8.5e-106
WP_000515673.1|1173273_1176972_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	75.6	0.0e+00
WP_014639483.1|1177032_1177641_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.9e-101
WP_000140743.1|1177577_1178321_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
1178121:1178135	attL	GACCAGCGCCACAAT	NA	NA	NA	NA
WP_001152449.1|1178326_1179025_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	1.3e-129
WP_001330090.1|1179024_1179381_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001552446.1|1179358_1182586_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.0	0.0e+00
WP_047335229.1|1183321_1184026_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.0	6.3e-116
WP_001206306.1|1184086_1184431_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_014639219.1|1184427_1184877_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|1184873_1185212_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|1185220_1185538_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766108.1|1185614_1186832_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
WP_000999828.1|1186846_1187446_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923131.1|1187438_1188665_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	4.1e-203
WP_001140907.1|1188812_1190570_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001552442.1|1190569_1191052_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001140099.1|1191199_1191550_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_032145233.1|1191654_1191837_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
WP_001274714.1|1192053_1192587_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_000193273.1|1192642_1192957_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839572.1|1192961_1193177_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000342820.1|1193901_1194615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235237.1|1194860_1195682_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	8.5e-80
WP_001217427.1|1195678_1196053_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	3.4e-36
WP_001265292.1|1196065_1197115_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.9e-109
WP_024193993.1|1197116_1197395_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_047335230.1|1197562_1197775_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	5.6e-28
WP_000150294.1|1197955_1198621_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151152.1|1198795_1199221_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	5.4e-62
WP_001262357.1|1199261_1200332_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693918.1|1200403_1200829_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887447.1|1200812_1201085_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	8.5e-13
WP_001329851.1|1201194_1201596_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.3e-12
WP_000100899.1|1201623_1201815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000936799.1|1201814_1202102_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379609.1|1202372_1202525_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_001553098.1|1202536_1202911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202161.1|1202900_1203122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935606.1|1203689_1204538_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	56.4	5.7e-55
WP_000560231.1|1204583_1204805_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	79.5	8.1e-30
WP_000048602.1|1204948_1207429_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.1e-58
WP_000096344.1|1207487_1207691_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533613.1|1207690_1208716_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	1.2e-102
1216612:1216626	attR	GACCAGCGCCACAAT	NA	NA	NA	NA
>prophage 77
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1214147	1234742	5002781		Bacillus_phage(50.0%)	5	NA	NA
WP_001304269.1|1214147_1215950_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001327954.1|1215936_1217649_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.4e-31
WP_000140405.1|1217905_1218865_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623043.1|1219055_1225163_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000369485.1|1225250_1234742_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 78
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1254213	1255485	5002781	integrase	Stenotrophomonas_phage(100.0%)	1	1250572:1250585	1269188:1269201
1250572:1250585	attL	GATATGGCGGTGAT	NA	NA	NA	NA
WP_000055670.1|1254213_1255485_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
WP_000055670.1|1254213_1255485_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
1269188:1269201	attR	ATCACCGCCATATC	NA	NA	NA	NA
>prophage 79
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1261043	1283609	5002781		Tupanvirus(75.0%)	6	NA	NA
WP_001327259.1|1261043_1265411_-	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
WP_000217768.1|1265407_1266847_-	precolibactin export MATE transporter ClbM	NA	NA	NA	NA	NA
WP_001297937.1|1266908_1268372_-	colibactin biosynthesis amidase ClbL	NA	NA	NA	NA	NA
WP_001533427.1|1268364_1275687_-	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	26.7	3.7e-94
WP_000829570.1|1275730_1278763_-	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
WP_001304254.1|1278812_1283609_-	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	3.0e-44
>prophage 80
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1289853	1299474	5002781		Tupanvirus(100.0%)	1	NA	NA
WP_001518711.1|1289853_1299474_-	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 81
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1310454	1312307	5002781		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502870.1|1310454_1311099_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001362826.1|1311083_1312307_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
>prophage 82
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1331790	1333592	5002781	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001297947.1|1331790_1332570_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_001297914.1|1332569_1333592_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
>prophage 83
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1337102	1337870	5002781		Bacillus_virus(100.0%)	1	NA	NA
WP_000016205.1|1337102_1337870_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 84
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1349002	1351342	5002781		Yersinia_phage(33.33%)	4	NA	NA
WP_001234570.1|1349002_1349824_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.1	7.5e-44
WP_000855074.1|1350086_1350560_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	1.3e-11
WP_001351157.1|1350575_1351052_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|1351120_1351342_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 85
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1363047	1363947	5002781		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1363047_1363947_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 86
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1371389	1374209	5002781		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704868.1|1371389_1372556_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.0e-110
WP_000043506.1|1372802_1374209_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 87
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1378601	1387410	5002781		Enterobacteria_phage(57.14%)	8	NA	NA
WP_105453002.1|1378601_1379747_-	O18ab/O18ac family O-antigen polymerase	NA	Q9AYY5	Salmonella_phage	42.9	5.3e-80
WP_000052607.1|1379848_1381096_-	O18 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100795.1|1381092_1381650_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-50
WP_000857501.1|1381657_1382533_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023638.1|1382590_1383490_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699397.1|1383489_1384575_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
WP_000183053.1|1384947_1385841_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_001116035.1|1386015_1387410_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	6.3e-19
>prophage 88
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1393121	1399915	5002781		Bacillus_phage(25.0%)	6	NA	NA
WP_001327393.1|1393121_1394492_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	9.9e-33
WP_047335232.1|1394684_1396121_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.7e-46
WP_000699671.1|1396123_1397347_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_014639487.1|1397343_1397823_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000089911.1|1397825_1398791_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_000048190.1|1398793_1399915_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 89
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1404232	1415130	5002781		Catovirus(33.33%)	10	NA	NA
WP_000654487.1|1404232_1405072_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137169.1|1405200_1407363_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482918.1|1407365_1407809_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1407814_1408954_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001361575.1|1409611_1411195_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001227699.1|1411269_1411608_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000687871.1|1411597_1411888_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_001252295.1|1411940_1413794_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|1413815_1414397_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|1414488_1415130_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 90
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1419857	1421210	5002781		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469710.1|1419857_1421210_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 91
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1434317	1436440	5002781		Bacillus_phage(100.0%)	2	NA	NA
WP_000675178.1|1434317_1435721_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|1435717_1436440_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
>prophage 92
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1442279	1496133	5002781	terminase,portal,integrase,tRNA,tail	Escherichia_phage(38.46%)	51	1443786:1443813	1468765:1468792
WP_000476019.1|1442279_1443641_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
1443786:1443813	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|1443913_1444132_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047335208.1|1444214_1445378_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.2	3.8e-203
WP_000978915.1|1445377_1445857_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_047335207.1|1445871_1448319_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.8	0.0e+00
WP_000785970.1|1448311_1448431_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1448463_1448739_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251406.1|1448795_1449314_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	4.2e-93
WP_001286717.1|1449326_1450517_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_047335206.1|1450846_1451440_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.5	2.6e-107
WP_001164158.1|1451661_1452189_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	2.2e-89
WP_016234132.1|1452192_1454952_-|tail	phage tail fiber protein	tail	Q858V4	Yersinia_virus	76.5	0.0e+00
WP_047335205.1|1454962_1455493_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	1.2e-100
WP_021525811.1|1456650_1458423_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_047335233.1|1458422_1459457_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	3.5e-200
WP_047335234.1|1459781_1461635_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_047335235.1|1461621_1462869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027672.1|1465103_1465379_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
WP_001113264.1|1465375_1465600_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_047335237.1|1465900_1466125_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.0e-32
WP_000217677.1|1466188_1466689_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000043869.1|1466866_1467142_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|1467256_1467556_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985260.1|1467671_1468685_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001350699.1|1469119_1469437_-	hypothetical protein	NA	NA	NA	NA	NA
1468765:1468792	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807360.1|1469852_1470752_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_000178556.1|1470833_1471613_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844241.1|1471712_1472753_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490666.1|1472800_1474156_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823289.1|1474159_1474444_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182910.1|1474474_1474927_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853836.1|1474936_1476199_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289810.1|1476227_1477082_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1477310_1478363_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858523.1|1478619_1479897_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846205.1|1479893_1480898_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
WP_000011936.1|1480894_1481860_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434049.1|1481833_1482580_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297940.1|1482631_1483450_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822262.1|1483514_1484315_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195614.1|1484311_1485100_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|1485322_1485595_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134614.1|1485715_1486540_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|1486758_1487097_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405724.1|1487178_1488213_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_047335238.1|1488228_1490709_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677332.1|1490724_1491399_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830454.1|1491479_1492022_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001046487.1|1492314_1492596_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|1492858_1493968_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001350700.1|1494099_1496133_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 93
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1508224	1517669	5002781		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|1508224_1509361_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|1509357_1511361_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|1511485_1511947_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1511987_1512458_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1512504_1513224_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1513220_1514906_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|1515127_1515859_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|1515918_1516026_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|1516006_1516738_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|1516742_1517669_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 94
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1538019	1539540	5002781		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|1538019_1539540_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 95
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1543234	1547020	5002781		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1543234_1543903_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425456.1|1544160_1544997_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489277.1|1545028_1547020_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 96
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1551088	1551946	5002781		Catovirus(100.0%)	1	NA	NA
WP_000873879.1|1551088_1551946_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 97
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1565333	1569635	5002781		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_001332203.1|1565333_1566800_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_000198797.1|1566917_1567904_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000241011.1|1569068_1569635_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 98
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1575389	1583039	5002781		Vibrio_phage(50.0%)	7	NA	NA
WP_000194888.1|1575389_1576979_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|1576982_1577327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|1577660_1578851_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1578878_1579574_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578103.1|1579723_1581484_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	9.9e-102
WP_000494186.1|1581608_1581893_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1582031_1583039_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 99
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1592942	1593560	5002781		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|1592942_1593560_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 100
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1602328	1608094	5002781		Bacillus_phage(25.0%)	5	NA	NA
WP_000422239.1|1602328_1603972_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	1.6e-13
WP_000884927.1|1604047_1604698_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
WP_000872522.1|1604697_1605762_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.2	3.1e-18
WP_000406059.1|1605835_1606891_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865556.1|1607002_1608094_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.3	2.7e-118
>prophage 101
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1612257	1617100	5002781		Hokovirus(50.0%)	2	NA	NA
WP_000876050.1|1612257_1615107_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	3.2e-41
WP_001296244.1|1615273_1617100_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 102
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1632023	1645899	5002781		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281253.1|1632023_1634651_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990768.1|1634797_1635520_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_047335310.1|1635659_1639418_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.2	3.3e-22
WP_001075170.1|1640099_1642385_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|1642531_1643662_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|1643661_1643916_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301034.1|1643969_1644620_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|1644822_1645899_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 103
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1651791	1656362	5002781	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140576.1|1651791_1652751_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.6e-69
WP_000150339.1|1652763_1652949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992976.1|1652989_1653793_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001297939.1|1653810_1655100_-	MFS transporter	NA	NA	NA	NA	NA
WP_001350710.1|1655156_1656362_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 104
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1659965	1664969	5002781		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|1659965_1660568_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_047335311.1|1660875_1662015_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.2	7.2e-29
WP_000461633.1|1662018_1662987_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_000860295.1|1662986_1664969_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 105
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1699930	1703158	5002781		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|1699930_1700530_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1700588_1702421_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|1702507_1703158_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 106
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1713717	1715577	5002781		Sodalis_phage(50.0%)	2	NA	NA
WP_000156130.1|1713717_1714608_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	53.1	4.0e-67
WP_001293612.1|1714803_1715577_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 107
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1719788	1721306	5002781		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|1719788_1721306_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 108
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1728055	1729192	5002781		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699136.1|1728055_1729192_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
>prophage 109
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1737728	1738814	5002781		Pandoravirus(100.0%)	1	NA	NA
WP_001331783.1|1737728_1738814_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 110
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1755216	1761459	5002781	transposase,integrase	Enterobacteria_phage(75.0%)	4	1755364:1755377	1761227:1761240
WP_000368123.1|1755216_1756149_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
1755364:1755377	attL	AAAGAGCTGGAACG	NA	NA	NA	NA
WP_000958671.1|1756460_1757618_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_016235118.1|1757857_1758634_-	acyltransferase	NA	C7U0V2	Enterobacteria_phage	99.1	3.0e-79
WP_088412575.1|1760245_1761459_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	3.7e-164
1761227:1761240	attR	CGTTCCAGCTCTTT	NA	NA	NA	NA
>prophage 111
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1765077	1772654	5002781		Bacillus_phage(50.0%)	4	NA	NA
WP_001331804.1|1765077_1768671_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001331805.1|1768726_1769872_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1769945_1770890_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283509.1|1770959_1772654_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 112
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1776347	1777268	5002781		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|1776347_1777268_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 113
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1781086	1781824	5002781		Clostridioides_phage(100.0%)	1	NA	NA
WP_001314031.1|1781086_1781824_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
>prophage 114
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1807363	1829091	5002781		Streptococcus_phage(25.0%)	22	NA	NA
WP_000443708.1|1807363_1809379_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	2.9e-150
WP_001317975.1|1809449_1810448_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1810677_1811439_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1811623_1812595_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1812978_1813236_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623142.1|1813280_1815008_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|1815048_1815558_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|1815600_1816452_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000724596.1|1816556_1816925_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|1816927_1817839_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|1817973_1819071_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
WP_000852686.1|1819060_1819936_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|1819935_1820769_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290262.1|1820768_1821785_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|1821942_1822734_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175632.1|1823013_1823910_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040463.1|1823913_1825338_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000084590.1|1825515_1826415_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838948.1|1826510_1827086_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001331810.1|1827146_1827596_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|1827582_1828008_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|1828221_1829091_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 115
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1847745	1848696	5002781		Cyanophage(100.0%)	1	NA	NA
WP_047335247.1|1847745_1848696_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	7.4e-11
>prophage 116
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1865937	1866651	5002781		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1865937_1866651_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 117
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1874130	1878131	5002781		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|1874130_1875420_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|1875505_1876132_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001350863.1|1876455_1877493_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	2.8e-72
WP_001028626.1|1877492_1878131_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 118
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1884378	1890868	5002781		Escherichia_phage(66.67%)	7	NA	NA
WP_000017553.1|1884378_1884531_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|1884548_1884740_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|1885050_1885569_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|1885584_1886124_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|1886217_1887795_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|1887863_1889330_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937882.1|1889491_1890868_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	9.0e-42
>prophage 119
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1911374	1911806	5002781		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|1911374_1911806_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 120
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1921691	1928029	5002781		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133562.1|1921691_1922975_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|1923033_1923234_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|1923245_1923581_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1923582_1925433_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1925449_1925965_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1926060_1926384_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1926400_1926787_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1926814_1928029_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 121
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1938146	1939658	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493462.1|1938146_1939658_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	5.3e-11
>prophage 122
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1945416	1956725	5002781		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1945416_1946670_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883117.1|1946998_1948189_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|1948233_1948572_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001305238.1|1948632_1949967_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.4e-10
WP_001215879.1|1949956_1950670_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001350885.1|1950834_1952262_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970064.1|1952837_1956725_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	6.5e-130
>prophage 123
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1960845	1961106	5002781		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|1960845_1961106_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 124
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1964565	1968302	5002781		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1964565_1965246_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1965512_1966487_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|1966502_1968302_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 125
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	1973204	2060556	5002781	terminase,lysis,capsid,portal,protease,holin,plate,tRNA,tail,head	Shigella_phage(42.86%)	95	NA	NA
WP_000083664.1|1973204_1973942_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1974073_1975408_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|1975440_1976322_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|1976424_1977012_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|1977067_1977451_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|1977755_1978445_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|1978492_1979530_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1979736_1980156_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|1980224_1980923_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|1980954_1983615_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1983728_1985084_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464873.1|1985108_1985453_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|1985449_1986748_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|1995235_1997809_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|1997938_1998670_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079114.1|1998666_1999647_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1999781_2000519_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2000788_2001130_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2001233_2001281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|2001379_2002540_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2002582_2003704_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|2003714_2004785_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2004994_2005360_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2005508_2006027_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|2006016_2007243_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2007258_2007741_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2007817_2008165_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2008206_2008974_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2009004_2009553_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2009571_2009820_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2009956_2011318_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|2011409_2012276_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2012296_2013583_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|2013637_2014231_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2014353_2015232_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2015317_2016979_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2017127_2017469_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2017530_2017821_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2017810_2018287_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2018418_2018901_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|2020057_2020846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|2020933_2021227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2021437_2022211_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|2023262_2025152_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|2025405_2025897_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|2025899_2026343_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|2026314_2026917_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|2026916_2027660_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_047335250.1|2027663_2028248_-	YmfQ family protein	NA	O22003	Shigella_phage	97.9	5.0e-111
WP_000785328.1|2028238_2029297_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|2029283_2029709_-	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2029708_2030257_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2030256_2031336_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2031332_2032661_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2032721_2034557_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|2034698_2034968_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2034967_2035324_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|2035323_2036820_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|2036803_2036974_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|2036982_2037543_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|2037539_2038046_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2038020_2038431_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2038427_2038751_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2038753_2038954_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2039003_2040209_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2040223_2040874_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|2040851_2042093_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|2042092_2042275_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2042286_2043783_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2044016_2044511_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2044636_2044987_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_001332386.1|2045635_2045887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|2045957_2046395_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2046391_2046868_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|2046854_2047160_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|2047311_2047647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|2047832_2048585_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|2048598_2049588_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|2049595_2050393_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2050412_2050802_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2050798_2051125_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|2051121_2051775_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|2051774_2052269_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|2052265_2053207_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|2053196_2053376_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2053551_2054103_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2054146_2054347_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2054437_2055112_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2055314_2055827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|2056295_2056658_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2056723_2057548_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2057675_2058200_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2058308_2059175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2059216_2059423_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2059383_2060556_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 126
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2067028	2071080	5002781		Klosneuvirus(50.0%)	4	NA	NA
WP_001332373.1|2067028_2068309_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.2e-32
WP_001298180.1|2068546_2069947_+	GABA permease	NA	NA	NA	NA	NA
WP_000156818.1|2069967_2070630_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|2070630_2071080_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 127
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2076886	2082183	5002781		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2076886_2077132_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080951.1|2077128_2077539_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.1e-18
WP_000246589.1|2077511_2079656_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.1e-195
WP_000777929.1|2079665_2080625_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_047335251.1|2080980_2082183_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	2.9e-28
>prophage 128
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2096787	2102173	5002781	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2096787_2096973_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047209.1|2097207_2099838_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
WP_000140506.1|2099965_2100466_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2100534_2101596_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132237.1|2101675_2102173_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	3.4e-31
>prophage 129
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2107641	2108607	5002781		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287404.1|2107641_2108607_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 130
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2116178	2117189	5002781		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024174326.1|2116178_2117189_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	27.8	3.9e-26
>prophage 131
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2136076	2143216	5002781		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|2136076_2138638_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|2138743_2139400_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001272542.1|2139450_2140248_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847997.1|2140413_2141322_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|2141318_2142581_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|2142577_2143216_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 132
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2147589	2151305	5002781		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2147589_2148582_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2148644_2149784_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254701.1|2149923_2150550_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2150543_2151305_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 133
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2154416	2156449	5002781		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|2154416_2155022_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090357.1|2155021_2156449_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
>prophage 134
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2171098	2171884	5002781		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021344.1|2171098_2171884_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.4e-20
>prophage 135
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2175458	2176130	5002781		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|2175458_2176130_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 136
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2179939	2182963	5002781		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|2179939_2181238_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2181325_2182963_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 137
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2186996	2191111	5002781		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046816.1|2186996_2188298_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
WP_000186431.1|2188354_2191111_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
>prophage 138
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2198643	2199492	5002781		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|2198643_2199492_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 139
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2204260	2205106	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_001214578.1|2204260_2205106_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.2e-09
>prophage 140
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2216682	2219188	5002781	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001555989.1|2216682_2217888_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.5	5.4e-75
WP_000184272.1|2217887_2218331_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|2218381_2219188_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 141
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2228022	2233160	5002781		Cronobacter_phage(50.0%)	2	NA	NA
WP_000147358.1|2228022_2230668_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.3	1.9e-96
WP_000512742.1|2230679_2233160_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.4	4.9e-06
>prophage 142
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2236482	2236743	5002781		Burkholderia_virus(100.0%)	1	NA	NA
WP_001117814.1|2236482_2236743_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	37.2	5.7e-06
>prophage 143
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2251558	2268173	5002781		Paramecium_bursaria_Chlorella_virus(14.29%)	10	NA	NA
WP_047335254.1|2251558_2252506_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
WP_001066237.1|2252577_2253174_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_000382413.1|2253176_2254352_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|2254351_2255932_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_001314100.1|2255963_2256788_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|2257045_2258299_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2258530_2259862_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775938.1|2259923_2261750_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.0e-24
WP_001331589.1|2261749_2265292_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_047335255.1|2265284_2268173_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	5.3e-68
>prophage 144
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2273650	2280423	5002781		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2273650_2274445_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2274451_2275327_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|2275477_2277724_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2277736_2278267_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|2278951_2279641_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2279709_2280423_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 145
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2290054	2292549	5002781		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|2290054_2291473_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|2291787_2292549_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 146
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2296835	2297591	5002781		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2296835_2297591_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 147
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2321870	2337262	5002781	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|2321870_2323271_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|2323288_2324605_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|2324640_2326008_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|2326043_2326532_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001363023.1|2326531_2328451_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001363024.1|2328886_2330335_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_001050745.1|2330336_2330462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2330458_2330530_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|2330584_2331133_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|2331175_2332693_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2332702_2333801_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813190.1|2333891_2335625_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_000715230.1|2335630_2336341_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806987.1|2336365_2337262_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 148
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2341067	2345540	5002781		Pandoravirus(50.0%)	2	NA	NA
WP_001350137.1|2341067_2342501_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
WP_000195072.1|2342666_2345540_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
>prophage 149
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2353676	2354909	5002781		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2353676_2354909_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 150
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2368404	2369082	5002781		Bacillus_virus(100.0%)	1	NA	NA
WP_000956879.1|2368404_2369082_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	6.4e-09
>prophage 151
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2374134	2375043	5002781		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|2374134_2375043_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 152
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2383197	2384352	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2383197_2384352_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 153
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2408039	2409023	5002781		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001331698.1|2408039_2409023_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 154
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2422604	2423264	5002781		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000590258.1|2422604_2423264_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
>prophage 155
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2479341	2480226	5002781		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2479341_2480226_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 156
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2486069	2493388	5002781		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013152.1|2486069_2486897_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
WP_000691616.1|2487096_2488023_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848521.1|2488073_2488331_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095186.1|2488372_2490592_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438655.1|2490843_2491593_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001331680.1|2491915_2493388_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	1.7e-46
>prophage 157
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2500846	2505886	5002781		Bacillus_virus(50.0%)	4	NA	NA
WP_001281888.1|2500846_2503105_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_001350728.1|2503242_2504850_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183493.1|2504958_2505441_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|2505493_2505886_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 158
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2513728	2526174	5002781		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|2513728_2514712_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940869.1|2514708_2515518_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	2.7e-14
WP_001240663.1|2515891_2518033_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195274.1|2518096_2519989_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|2520017_2520599_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444744.1|2520598_2521426_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2521450_2521873_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2521873_2522503_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|2522707_2524189_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2524336_2525008_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442855.1|2525013_2526174_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	9.1e-88
>prophage 159
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2537408	2538062	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|2537408_2538062_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 160
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2541975	2543409	5002781		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|2541975_2543409_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 161
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2548546	2549785	5002781	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708479.1|2548546_2549785_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 162
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2556193	2572378	5002781	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264377.1|2556193_2557207_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|2557444_2557660_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918851.1|2557770_2559516_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	8.4e-77
WP_000437380.1|2559710_2561552_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2561630_2562137_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065876.1|2562390_2563155_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000120223.1|2563431_2564055_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094730.1|2564208_2565729_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000631993.1|2566035_2567526_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450588.1|2567567_2567900_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|2568118_2569102_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082822.1|2569285_2572378_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	8.5e-157
>prophage 163
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2584039	2585005	5002781		Escherichia_phage(100.0%)	1	NA	NA
WP_001098826.1|2584039_2585005_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 164
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2604883	2607178	5002781		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861709.1|2604883_2607178_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 165
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2613332	2614478	5002781		Streptococcus_phage(100.0%)	1	NA	NA
WP_001298324.1|2613332_2614478_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	2.8e-49
>prophage 166
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2631161	2638957	5002781		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|2631161_2632025_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249171.1|2632089_2634126_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246833.1|2634083_2634479_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|2634498_2635089_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2635098_2635674_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147637.1|2635786_2636827_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|2636899_2637535_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001350722.1|2637662_2638181_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.7e-09
WP_000449450.1|2638160_2638604_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189322.1|2638654_2638957_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 167
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2644659	2646549	5002781		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2644659_2646549_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 168
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2652030	2658669	5002781		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|2652030_2654703_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|2654727_2656215_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2656242_2656695_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207671.1|2657325_2658669_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 169
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2662746	2665619	5002781	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764750.1|2662746_2663595_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	2.6e-23
WP_001107467.1|2663684_2665619_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 170
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2672248	2673731	5002781		Indivirus(50.0%)	2	NA	NA
WP_001047338.1|2672248_2673220_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445401.1|2673452_2673731_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	2.2e-16
>prophage 171
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2677799	2692594	5002781		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2677799_2678609_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922880.1|2678818_2679796_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2679809_2680796_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|2680816_2681383_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2681379_2681955_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2681923_2682481_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_047335258.1|2682487_2683213_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.1e-22
WP_000809051.1|2683260_2684694_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2684716_2685004_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|2685121_2685613_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2685658_2686513_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2686509_2686782_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620407.1|2686995_2687628_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047069.1|2687624_2688353_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719794.1|2688349_2689003_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809780.1|2689232_2691569_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|2691664_2692594_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 172
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2701297	2705308	5002781	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_000108476.1|2701297_2702788_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|2702896_2703790_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|2703911_2704703_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|2704810_2705308_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 173
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2709275	2711800	5002781	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001298588.1|2709275_2710643_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
WP_047335259.1|2710732_2711800_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 174
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2728294	2729338	5002781		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2728294_2729338_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 175
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2738625	2743137	5002781		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000132905.1|2738625_2740125_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.7	5.2e-11
WP_001331656.1|2740185_2741076_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275539.1|2741111_2741966_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|2742306_2743137_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 176
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2748476	2749361	5002781		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258951.1|2748476_2749361_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 177
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2755865	2760019	5002781		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738577.1|2755865_2756891_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
WP_001350717.1|2756958_2758140_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001351032.1|2758149_2759253_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078319.1|2759260_2760019_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
>prophage 178
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2770347	2771819	5002781	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2770347_2770857_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|2770871_2771819_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 179
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2793043	2794996	5002781		Vibrio_phage(100.0%)	1	NA	NA
WP_001514015.1|2793043_2794996_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 180
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2803844	2812411	5002781		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773166.1|2803844_2806547_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	1.5e-40
WP_000031783.1|2806838_2808023_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2808093_2810208_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2810304_2810775_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2810871_2811246_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|2811371_2811659_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820734.1|2811665_2812025_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_001209702.1|2812024_2812411_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	4.3e-18
>prophage 181
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2817981	2827522	5002781		Tupanvirus(25.0%)	9	NA	NA
WP_000634747.1|2817981_2819895_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.1	4.7e-73
WP_000057415.1|2819894_2820917_+	hydrolase	NA	NA	NA	NA	NA
WP_000907086.1|2820910_2821129_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	4.0e-05
WP_001274684.1|2821182_2822052_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2822106_2822511_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2822812_2823445_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001304921.1|2823495_2825586_+	membrane protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_000963803.1|2825652_2826873_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|2826958_2827522_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 182
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2846432	2847269	5002781		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2846432_2847269_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 183
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2864173	2867940	5002781		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|2864173_2865796_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253708.1|2865871_2867224_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2867220_2867940_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 184
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2874516	2875410	5002781		Sodalis_phage(100.0%)	1	NA	NA
WP_000039083.1|2874516_2875410_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 185
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2881570	2883964	5002781		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081889.1|2881570_2883964_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 186
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2888354	2889581	5002781		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105471.1|2888354_2889581_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 187
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2904983	2907431	5002781		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|2904983_2907431_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 188
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2927301	2929112	5002781		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073603.1|2927301_2928045_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.4e-11
WP_000907827.1|2928041_2929112_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 189
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2932653	2934136	5002781		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2932653_2933367_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2933368_2934136_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 190
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2943027	2947754	5002781		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_001332164.1|2943027_2943948_+	phosphoglycerate dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	30.7	3.3e-24
WP_000661262.1|2943947_2944832_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000130217.1|2944935_2945790_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2946034_2947093_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2947085_2947754_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 191
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2950760	2955059	5002781		Dickeya_phage(50.0%)	4	NA	NA
WP_000964729.1|2950760_2951387_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	2.7e-30
WP_000106588.1|2951460_2953659_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	1.0e-119
WP_000130621.1|2953927_2954173_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|2954393_2955059_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 192
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2962952	2963759	5002781		Bacillus_virus(100.0%)	1	NA	NA
WP_000173679.1|2962952_2963759_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 193
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2971198	2973934	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149183.1|2971198_2973934_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 194
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2983620	2985663	5002781		Indivirus(100.0%)	1	NA	NA
WP_001312164.1|2983620_2985663_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 195
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2988802	2989228	5002781		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000065791.1|2988802_2989228_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
>prophage 196
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	2999899	3001369	5002781		Pithovirus(50.0%)	2	NA	NA
WP_001332154.1|2999899_3000670_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	1.7e-18
WP_000123131.1|3000721_3001369_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 197
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3048134	3050119	5002781		Bacillus_virus(50.0%)	2	NA	NA
WP_000103579.1|3048134_3049139_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196477.1|3049135_3050119_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 198
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3060004	3062338	5002781		Escherichia_phage(100.0%)	1	NA	NA
WP_000013974.1|3060004_3062338_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	3.7e-72
>prophage 199
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3065992	3066205	5002781		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3065992_3066205_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 200
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3070426	3071422	5002781		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182635.1|3070426_3071422_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 201
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3076740	3078282	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146512.1|3076740_3078282_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 202
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3097856	3102468	5002781		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985743.1|3097856_3099152_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	3.7e-21
WP_000741500.1|3099281_3100433_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_047335265.1|3100623_3102468_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 203
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3124594	3134100	5002781		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|3124594_3124846_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|3124986_3125418_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|3125662_3127207_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|3127216_3128500_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483824.1|3128503_3129463_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982107.1|3129449_3130484_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
WP_000646018.1|3130722_3131748_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213847.1|3131757_3132954_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
WP_000587750.1|3133167_3134100_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 204
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3137508	3139602	5002781		Catovirus(50.0%)	2	NA	NA
WP_000064025.1|3137508_3138492_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
WP_000364803.1|3138573_3139602_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
>prophage 205
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3147040	3151603	5002781		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|3147040_3147520_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|3147558_3148368_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3148465_3148633_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3148653_3148890_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|3149106_3149775_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050149.1|3149946_3151167_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
WP_000976066.1|3151144_3151603_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.6e-48
>prophage 206
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3154977	3161728	5002781		Morganella_phage(25.0%)	6	NA	NA
WP_001297973.1|3154977_3155802_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
WP_000924289.1|3156093_3156711_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001363072.1|3156707_3158390_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.4	6.7e-23
WP_001295237.1|3158647_3159271_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3159325_3159601_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|3159619_3161728_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 207
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3166029	3167421	5002781		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3166029_3167421_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 208
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3180682	3181720	5002781		Wolbachia_phage(100.0%)	1	NA	NA
WP_001280586.1|3180682_3181720_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 209
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3187161	3188496	5002781		Moraxella_phage(100.0%)	1	NA	NA
WP_001556060.1|3187161_3188496_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 210
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3195800	3207677	5002781		Micromonas_sp._RCC1109_virus(20.0%)	11	NA	NA
WP_000168473.1|3195800_3197489_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.2e-56
WP_001312198.1|3197594_3197693_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001332269.1|3198093_3199278_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
WP_000148034.1|3199285_3199783_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113443.1|3199779_3200142_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3200131_3200479_-	YidH family protein	NA	NA	NA	NA	NA
WP_047335266.1|3202027_3203743_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	28.8	1.5e-38
WP_001332266.1|3203909_3204776_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|3204865_3206527_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|3206723_3207152_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3207263_3207677_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 211
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3212106	3213255	5002781		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|3212106_3213255_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 212
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3217960	3225329	5002781		Bacillus_virus(33.33%)	8	NA	NA
WP_001298010.1|3217960_3220375_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
WP_000060112.1|3220403_3221477_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3221476_3222577_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3222581_3223985_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122083097.1|3224281_3224362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|3224591_3224732_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3224748_3225108_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3225071_3225329_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 213
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3235526	3236864	5002781		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3235526_3236864_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 214
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3247235	3254750	5002781		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|3247235_3248009_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251985.1|3248099_3248990_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3248989_3249949_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3250035_3251076_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|3251389_3253219_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000933754.1|3253379_3254750_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 215
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3266705	3267698	5002781		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845129.1|3266705_3267698_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	2.2e-50
>prophage 216
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3270866	3276719	5002781		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3270866_3272735_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001350412.1|3272901_3273321_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387779.1|3273328_3274834_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3274838_3275804_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3275828_3276719_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 217
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3290114	3291761	5002781		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012594.1|3290114_3291761_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 218
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3299357	3304771	5002781		Bacillus_phage(33.33%)	4	NA	NA
WP_001238853.1|3299357_3301379_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
WP_001314257.1|3301425_3302910_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3303045_3304311_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3304441_3304771_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 219
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3308813	3314957	5002781		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866674.1|3308813_3309944_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	2.3e-27
WP_000006614.1|3309940_3311203_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
WP_001226621.1|3311202_3312270_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000676056.1|3312288_3313170_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145189.1|3313147_3313822_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612051.1|3313826_3314957_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 220
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3323031	3324687	5002781		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395836.1|3323031_3324687_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 221
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3332804	3341399	5002781		Salmonella_phage(50.0%)	8	NA	NA
WP_001014285.1|3332804_3334121_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	49.1	3.5e-11
WP_001680684.1|3334117_3335587_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	6.6e-43
WP_000799889.1|3335775_3335979_+	lipoprotein	NA	NA	NA	NA	NA
WP_001160654.1|3336015_3336840_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000812795.1|3336836_3337544_+	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_000130676.1|3337540_3338437_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213586.1|3338436_3339153_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|3339236_3341399_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 222
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3348769	3350599	5002781		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3348769_3350599_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 223
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3361059	3362568	5002781		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|3361059_3362568_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 224
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3384563	3387850	5002781		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|3384563_3386204_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|3386282_3386552_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|3386555_3387071_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|3387073_3387850_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 225
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3396731	3397346	5002781		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3396731_3397346_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 226
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3410943	3413730	5002781		uncultured_virus(100.0%)	1	NA	NA
WP_000250046.1|3410943_3413730_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 227
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3417756	3420227	5002781		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|3417756_3419166_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|3419177_3420227_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 228
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3424112	3428842	5002781		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|3424112_3424901_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_001363089.1|3424940_3425837_-	sugar kinase	NA	NA	NA	NA	NA
WP_000190782.1|3426008_3426887_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000094544.1|3426911_3427799_+	aldolase	NA	NA	NA	NA	NA
WP_000357981.1|3427831_3428842_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 229
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3441438	3444489	5002781		Escherichia_phage(100.0%)	1	NA	NA
WP_012579028.1|3441438_3444489_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 230
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3455592	3460453	5002781		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001350871.1|3455592_3456213_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.4e-63
WP_001166063.1|3456472_3457456_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270237.1|3457604_3458279_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3458384_3459758_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3459754_3460453_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 231
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3472063	3476566	5002781		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_047335269.1|3472063_3472909_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3473333_3473579_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3473663_3474149_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3474241_3475168_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3475234_3476566_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 232
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3489776	3494370	5002781		Pandoravirus(100.0%)	3	NA	NA
WP_000859437.1|3489776_3491327_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
WP_000105536.1|3491559_3492684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694065.1|3492816_3494370_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.0e-09
>prophage 233
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3501183	3508430	5002781		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424854.1|3501183_3501846_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
WP_001185153.1|3501857_3504359_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|3504667_3505747_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3505761_3506082_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184865.1|3506132_3508430_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 234
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3520574	3521789	5002781		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691040.1|3520574_3521789_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	27.9	3.8e-44
>prophage 235
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3527229	3533012	5002781	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125464.1|3527229_3528546_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
WP_122083113.1|3528649_3529300_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|3529299_3529659_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187001.1|3529698_3530799_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000591379.1|3531167_3533012_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
>prophage 236
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3541353	3544406	5002781		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3541353_3542304_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3543221_3544406_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 237
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3548401	3556730	5002781		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3548401_3552430_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653952.1|3552506_3556730_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
>prophage 238
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3565024	3566788	5002781		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3565024_3565696_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_021525822.1|3565738_3566329_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3566515_3566788_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 239
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3572150	3573740	5002781		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187584.1|3572150_3573740_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 240
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3587437	3591121	5002781		Dickeya_phage(100.0%)	1	NA	NA
WP_047335270.1|3587437_3591121_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 241
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3615462	3616578	5002781		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3615462_3616578_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 242
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3624018	3624627	5002781		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3624018_3624627_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 243
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3636922	3641045	5002781		Escherichia_phage(25.0%)	4	NA	NA
WP_001296639.1|3636922_3638338_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_001147328.1|3638390_3639470_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000122235.1|3639492_3640050_+	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	28.8	1.7e-15
WP_001331852.1|3640046_3641045_+	AAA family ATPase	NA	K4F711	Cronobacter_phage	30.7	7.0e-28
>prophage 244
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3646503	3647862	5002781		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_045228097.1|3646503_3647862_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	3.9e-37
>prophage 245
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3657806	3661419	5002781		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357763.1|3657806_3660629_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
WP_000168305.1|3660882_3661419_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 246
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3665236	3666586	5002781		Moraxella_phage(100.0%)	1	NA	NA
WP_000106892.1|3665236_3666586_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 247
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3672792	3674751	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078225.1|3672792_3674751_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	2.5e-90
>prophage 248
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3684121	3685649	5002781		Bacillus_virus(50.0%)	2	NA	NA
WP_047335271.1|3684121_3684826_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	7.9e-18
WP_000132446.1|3684812_3685649_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
>prophage 249
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3689566	3691714	5002781		Escherichia_phage(100.0%)	1	NA	NA
WP_011076734.1|3689566_3691714_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 250
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3696958	3703329	5002781		Tetraselmis_virus(50.0%)	4	NA	NA
WP_001350810.1|3696958_3698944_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	4.9e-150
WP_001171671.1|3699218_3700148_-	allose kinase	NA	NA	NA	NA	NA
WP_001314355.1|3700131_3700827_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000235242.1|3701796_3703329_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	4.4e-13
>prophage 251
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3709444	3710994	5002781		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611410.1|3709444_3710125_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075531.1|3710235_3710994_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
>prophage 252
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3716598	3717387	5002781		Pithovirus(100.0%)	1	NA	NA
WP_001193413.1|3716598_3717387_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 253
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3722227	3723730	5002781		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|3722227_3723730_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 254
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3743294	3746506	5002781	tRNA	Catovirus(50.0%)	2	NA	NA
WP_000003806.1|3743294_3744812_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856826.1|3745048_3746506_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
>prophage 255
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3760783	3762767	5002781		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3760783_3761077_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3761120_3762767_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 256
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3766971	3767505	5002781		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|3766971_3767505_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 257
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3772426	3773404	5002781		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3772426_3773404_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 258
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3781400	3781946	5002781		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3781400_3781946_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 259
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3785750	3798781	5002781	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990304.1|3785750_3787088_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	3.3e-17
WP_001298688.1|3787097_3788945_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280359.1|3788937_3789888_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3789973_3790282_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|3790357_3791638_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312482.1|3791723_3792983_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3792985_3793990_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3794071_3794269_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3794372_3795671_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3795875_3796301_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076340.1|3796339_3798781_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 260
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3802623	3803787	5002781		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944012.1|3802623_3803787_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 261
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3846036	3852524	5002781		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|3846036_3846567_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265925.1|3846876_3847833_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205834.1|3847972_3849475_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	6.2e-12
WP_001298067.1|3849488_3850511_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595996.1|3850497_3851493_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3851525_3852524_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 262
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3856842	3859603	5002781		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106233.1|3856842_3857307_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187799.1|3857464_3859603_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 263
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3863241	3869338	5002781		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3863241_3864189_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3864373_3864427_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471858.1|3864567_3867264_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
WP_000047539.1|3867469_3867856_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3867928_3868390_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3868402_3869338_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 264
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3879684	3888864	5002781	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416385.1|3879684_3882540_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3882539_3882983_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3883240_3884752_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_047335272.1|3885018_3886119_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001331766.1|3886118_3887201_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294566.1|3887361_3888864_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
>prophage 265
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3893993	3906378	5002781	integrase	Enterobacteria_phage(80.0%)	15	3885490:3885505	3910256:3910271
3885490:3885505	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_001555771.1|3893993_3895013_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.0	6.4e-45
WP_000776997.1|3895456_3896722_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.5	2.2e-74
WP_000418440.1|3896779_3897673_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000932801.1|3897681_3898197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205027.1|3898394_3898706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|3899015_3899588_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|3899661_3900162_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|3900158_3900893_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|3901443_3901710_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|3901706_3902297_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244669.1|3902289_3902577_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	1.5e-47
WP_000459302.1|3902569_3903025_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|3903160_3903481_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_047335273.1|3903495_3905829_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_044815386.1|3906183_3906378_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
3910256:3910271	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 266
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3910826	3911807	5002781		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991428.1|3910826_3911807_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	2.0e-99
>prophage 267
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3915179	3916856	5002781		Escherichia_phage(100.0%)	2	NA	NA
WP_000790574.1|3915179_3915782_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	4.0e-55
WP_000044708.1|3916259_3916856_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 268
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3925930	3927391	5002781		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208174.1|3925930_3927391_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	1.1e-48
>prophage 269
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3937742	3943996	5002781		Vibrio_phage(33.33%)	5	NA	NA
WP_000559097.1|3937742_3939284_+	carnitine transporter CniT	NA	A0A2I7QNT1	Vibrio_phage	23.9	2.4e-11
WP_000706587.1|3939339_3940482_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.9	1.0e-43
WP_001020468.1|3940556_3941444_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_001051315.1|3941461_3942244_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001338071.1|3942256_3943996_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.6	3.4e-38
>prophage 270
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3959537	3960458	5002781	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181195.1|3959537_3960458_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
>prophage 271
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3975203	3976859	5002781		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919587.1|3975203_3976859_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.2e-12
>prophage 272
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3987485	3988765	5002781		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3987485_3988223_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001350779.1|3988225_3988765_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 273
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	3996595	3999471	5002781		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|3996595_3998185_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|3998577_3999183_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3999309_3999471_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 274
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4005158	4006481	5002781		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477823.1|4005158_4006481_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	3.0e-79
>prophage 275
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4014244	4020054	5002781		Enterococcus_phage(33.33%)	5	NA	NA
WP_000093834.1|4014244_4015477_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000513550.1|4015568_4015901_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|4015902_4016187_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046754.1|4016242_4017910_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409429.1|4018116_4020054_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 276
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4023331	4025445	5002781		Bacillus_phage(50.0%)	2	NA	NA
WP_001188687.1|4023331_4024021_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219586.1|4024020_4025445_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
>prophage 277
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4037092	4038046	5002781		Cyanophage(100.0%)	1	NA	NA
WP_000130187.1|4037092_4038046_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 278
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4041182	4055703	5002781	tRNA	Chrysochromulina_ericina_virus(16.67%)	12	NA	NA
WP_000516135.1|4041182_4043099_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4043187_4044318_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|4044422_4044632_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274823.1|4045186_4045948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047335278.1|4045967_4047461_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	4.7e-28
WP_000494924.1|4047589_4048849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681386.1|4049083_4050250_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000062878.1|4050309_4051215_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|4051310_4051574_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|4051676_4051895_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767329.1|4051902_4052844_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286813.1|4052886_4055703_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.7	4.6e-77
>prophage 279
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4060511	4061660	5002781		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|4060511_4061660_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 280
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4065122	4073533	5002781	transposase	Saccharomonospora_phage(33.33%)	8	NA	NA
WP_000526115.1|4065122_4065581_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000333104.1|4065870_4066266_+	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_000122880.1|4066384_4066975_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000004399.1|4066980_4067766_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001350362.1|4067874_4069428_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.9e-35
WP_000349942.1|4069500_4070718_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4070845_4071988_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|4072018_4073533_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 281
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4081427	4083389	5002781		Bacillus_phage(50.0%)	3	NA	NA
WP_000624375.1|4081427_4081907_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|4081992_4082226_+	antitoxin	NA	NA	NA	NA	NA
WP_000257201.1|4082540_4083389_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 282
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4091166	4096588	5002781		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|4091166_4094073_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035590.1|4094236_4096588_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
>prophage 283
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4104864	4105563	5002781		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916269.1|4104864_4105563_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-21
>prophage 284
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4117041	4118766	5002781		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425644.1|4117041_4118766_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 285
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4144736	4145780	5002781		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4144736_4145780_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 286
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4150026	4150578	5002781		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923703.1|4150026_4150578_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 287
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4162993	4164418	5002781		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4162993_4164418_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 288
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4172238	4178706	5002781		Mamastrovirus(33.33%)	5	NA	NA
WP_001189635.1|4172238_4173789_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
WP_001332319.1|4173835_4176226_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4176431_4176968_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|4177008_4177671_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|4177779_4178706_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 289
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4181968	4182853	5002781		Sodalis_phage(100.0%)	1	NA	NA
WP_000339931.1|4181968_4182853_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.4	1.0e-59
>prophage 290
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4192744	4199550	5002781	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174640.1|4192744_4194163_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937401.1|4194201_4195128_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4195164_4195620_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|4195797_4196502_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|4196516_4197047_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001362943.1|4197120_4199550_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.0e-40
>prophage 291
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4204691	4205489	5002781		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4204691_4205489_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 292
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4211403	4211748	5002781		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4211403_4211748_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 293
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4215677	4217102	5002781	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|4215677_4217102_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 294
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4228679	4229438	5002781		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4228679_4229438_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 295
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4238266	4242382	5002781		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569434.1|4238266_4238863_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_047335280.1|4238899_4242382_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.2e-209
>prophage 296
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4255339	4256371	5002781		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4255339_4256371_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 297
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4262886	4270738	5002781		Indivirus(25.0%)	9	NA	NA
WP_000997016.1|4262886_4263690_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648548.1|4263686_4264601_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047335281.1|4264841_4265642_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211705.1|4265719_4266490_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4266536_4267895_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052741.1|4267966_4268722_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|4268755_4269478_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4269474_4269942_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|4270006_4270738_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
>prophage 298
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4280000	4282760	5002781		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614314.1|4280000_4282760_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	4.7e-82
>prophage 299
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4293450	4295433	5002781		Ralstonia_phage(100.0%)	1	NA	NA
WP_021038061.1|4293450_4295433_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
>prophage 300
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4305013	4308336	5002781		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|4305013_4305592_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|4305796_4306564_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4306534_4307275_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|4307586_4308336_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
>prophage 301
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4314309	4315461	5002781		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001331869.1|4314309_4315461_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
>prophage 302
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4320209	4324605	5002781		Streptococcus_phage(50.0%)	4	NA	NA
WP_000749902.1|4320209_4321265_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|4321553_4322657_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|4322668_4323922_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_000772639.1|4324266_4324605_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
>prophage 303
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4348103	4348955	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|4348103_4348955_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 304
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4355000	4358305	5002781		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295799.1|4355000_4355870_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001298546.1|4356029_4356623_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|4356634_4356871_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_047335282.1|4356979_4358305_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	2.2e-114
>prophage 305
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4368230	4375801	5002781	holin,integrase	Escherichia_phage(33.33%)	5	4366947:4366960	4369943:4369956
4366947:4366960	attL	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001295805.1|4368230_4368794_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159135.1|4369863_4371552_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
4369943:4369956	attR	AACGCATCCTTCCC	NA	NA	NA	NA
WP_001350625.1|4371565_4373038_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|4373051_4373639_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131041.1|4373767_4375801_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 306
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4388540	4393078	5002781		Bacillus_virus(50.0%)	4	NA	NA
WP_000447331.1|4388540_4390025_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818902.1|4390017_4390989_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750346.1|4390985_4391942_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692719.1|4392028_4393078_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 307
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4400609	4402496	5002781		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010273.1|4400609_4402496_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	1.8e-53
>prophage 308
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4407468	4414750	5002781		Herpes_simplex_virus(33.33%)	5	NA	NA
WP_000177872.1|4407468_4410543_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.5	0.0e+00
WP_000805859.1|4410665_4411748_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	2.4e-191
WP_001096705.1|4411949_4412489_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000419070.1|4412714_4413548_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842109.1|4413640_4414750_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 309
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4420042	4420810	5002781		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939359.1|4420042_4420810_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
>prophage 310
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4427718	4428876	5002781		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|4427718_4428876_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 311
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4436291	4437407	5002781		Bacillus_phage(100.0%)	1	NA	NA
WP_000484068.1|4436291_4437407_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 312
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4441696	4451794	5002781		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4441696_4442608_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219315.1|4442732_4443641_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|4443909_4445094_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698877.1|4445219_4448363_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221279.1|4448359_4449562_-	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.1	9.1e-06
WP_000113933.1|4449751_4450441_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|4450498_4451794_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 313
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4458871	4467713	5002781	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4458871_4459999_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4460021_4460354_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|4460381_4462229_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4462239_4463211_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_001317658.1|4463340_4463688_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|4463725_4464610_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|4464907_4465447_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4465597_4466047_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150487.1|4466050_4467154_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.7e-54
WP_001350619.1|4467242_4467713_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 314
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4489146	4494193	5002781	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4489146_4489770_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4489895_4491170_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4491357_4493712_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4493920_4494193_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 315
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4497333	4498029	5002781		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|4497333_4498029_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 316
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4501352	4504899	5002781		Bacillus_phage(100.0%)	2	NA	NA
WP_001235600.1|4501352_4503125_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.4e-50
WP_001256184.1|4503117_4504899_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.0e-41
>prophage 317
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4513736	4516886	5002781		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4513736_4516886_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 318
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4523894	4532352	5002781		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4523894_4524446_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|4524574_4526506_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4526558_4526888_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4526887_4527493_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678211.1|4527602_4529477_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.4e-117
WP_001331495.1|4529657_4530302_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250114.1|4530433_4531396_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801795.1|4531392_4532352_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	5.0e-15
>prophage 319
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4541913	4545155	5002781		Escherichia_phage(66.67%)	3	NA	NA
WP_000057524.1|4541913_4542216_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	2.2e-41
WP_000806442.1|4542251_4542593_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083945.1|4542650_4545155_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 320
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4552253	4552931	5002781		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4552253_4552931_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 321
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4556067	4556754	5002781		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110564.1|4556067_4556754_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.9e-32
>prophage 322
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4563007	4564789	5002781		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_047335286.1|4563007_4564789_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	6.0e-38
>prophage 323
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4570979	4572125	5002781		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331490.1|4570979_4572125_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 324
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4583979	4636486	5002781	terminase,portal,protease,holin,integrase,tRNA,tail	Enterobacteria_phage(35.71%)	66	4594790:4594804	4638862:4638876
WP_000912345.1|4583979_4585365_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|4585400_4585922_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4586029_4586242_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|4586243_4587110_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001298992.1|4587472_4588636_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000433949.1|4588491_4588863_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_000206737.1|4588862_4589168_-	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_001242749.1|4589167_4589530_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|4589520_4590057_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|4590184_4591009_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|4591074_4591437_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_047335288.1|4592123_4592798_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.6	1.0e-131
WP_000649477.1|4592888_4593089_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|4593132_4593684_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_021524652.1|4593680_4594517_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	98.9	1.4e-151
WP_024186770.1|4594521_4594746_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	89.2	1.0e-32
WP_000995577.1|4594742_4595042_+	hypothetical protein	NA	NA	NA	NA	NA
4594790:4594804	attL	TCAGCGCCTGATTAT	NA	NA	NA	NA
WP_021524650.1|4595038_4596034_+	hypothetical protein	NA	Q8SBF1	Shigella_phage	87.9	3.8e-50
WP_021524670.1|4596030_4596525_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_021531977.1|4596524_4597178_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_021524668.1|4597174_4597501_+	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
WP_000767103.1|4597497_4597887_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_021531991.1|4597906_4598704_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001223333.1|4598719_4599235_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_021524665.1|4599244_4600234_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	4.4e-192
WP_001204806.1|4600251_4600632_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_077462104.1|4600729_4601062_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_047335289.1|4601844_4603815_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	66.0	5.4e-250
WP_001304601.1|4603949_4604132_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001514225.1|4604169_4604439_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
WP_000284510.1|4604514_4604730_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_021524663.1|4604734_4605079_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_021524662.1|4605044_4605317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992067.1|4605422_4605956_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.1e-99
WP_122986666.1|4606474_4606660_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	7.1e-19
WP_016236020.1|4607174_4607651_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_001077619.1|4607647_4609771_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_000102415.1|4609767_4609980_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_016236019.1|4609979_4611482_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	4.5e-289
WP_128958825.1|4611471_4613451_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	99.4	0.0e+00
WP_001097059.1|4613538_4613865_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_001281346.1|4613857_4614139_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_016236016.1|4614141_4614765_+	hypothetical protein	NA	S5MBY4	Escherichia_phage	98.1	4.7e-99
WP_000682708.1|4614777_4615176_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_047335290.1|4615183_4615930_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.2	3.5e-125
WP_016236015.1|4615948_4616380_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_000533397.1|4616406_4616811_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	6.9e-43
WP_047335291.1|4616800_4619413_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.4	0.0e+00
WP_000847298.1|4619409_4619739_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021524657.1|4619738_4620437_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.9e-128
WP_001528990.1|4620447_4621191_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	3.7e-143
WP_077792027.1|4621136_4621769_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	7.1e-103
WP_047335292.1|4625776_4626376_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	94.5	4.7e-104
WP_047335293.1|4626440_4628504_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.5	1.6e-151
WP_001204581.1|4628500_4628779_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355700.1|4628788_4629082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|4629121_4629220_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000742376.1|4629274_4629931_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937499.1|4629999_4630305_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226381.1|4630488_4631973_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001514119.1|4632159_4633113_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001331488.1|4633587_4633896_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001304815.1|4633915_4634215_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_000259980.1|4634272_4634578_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_000239877.1|4634632_4635301_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201816.1|4635532_4636486_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
4638862:4638876	attR	TCAGCGCCTGATTAT	NA	NA	NA	NA
>prophage 325
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4643380	4645496	5002781		Hokovirus(50.0%)	2	NA	NA
WP_000253820.1|4643380_4644823_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	1.7e-11
WP_000770953.1|4644812_4645496_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 326
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4648641	4651785	5002781		Leptospira_phage(100.0%)	1	NA	NA
WP_000573981.1|4648641_4651785_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	3.7e-59
>prophage 327
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4662737	4668780	5002781		Tupanvirus(50.0%)	3	NA	NA
WP_000077765.1|4662737_4666619_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	1.7e-61
WP_000096768.1|4666834_4667968_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|4667964_4668780_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 328
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4683082	4684905	5002781		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|4683082_4683712_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029771.1|4683684_4684905_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
>prophage 329
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4688010	4690125	5002781		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4688010_4689576_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001308472.1|4689696_4690125_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 330
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4704213	4704860	5002781		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4704213_4704423_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|4704476_4704860_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 331
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4709075	4711515	5002781		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4709075_4710287_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231442.1|4710426_4711515_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 332
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4718525	4723648	5002781	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001362899.1|4718525_4721108_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
WP_001044880.1|4721342_4721825_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207539.1|4721869_4722805_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631389.1|4722922_4723648_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 333
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4731595	4732675	5002781		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4731595_4732675_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 334
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4736775	4738440	5002781		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4736775_4738440_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 335
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4743065	4745012	5002781		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|4743065_4745012_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 336
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4753310	4755956	5002781	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|4753310_4754072_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|4754291_4755956_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 337
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4760108	4760873	5002781		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773263.1|4760108_4760873_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	7.5e-06
>prophage 338
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4767528	4779361	5002781		Hokovirus(40.0%)	10	NA	NA
WP_000186083.1|4767528_4768206_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001350605.1|4768202_4770887_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001331974.1|4770879_4771452_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_047335296.1|4771460_4773509_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.3	2.3e-25
WP_047335297.1|4773531_4775205_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4775204_4775294_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|4775606_4775813_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075783.1|4775913_4776423_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207170.1|4776419_4777838_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	4.7e-62
WP_001032722.1|4777879_4779361_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 339
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4782739	4783531	5002781		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114008.1|4782739_4783531_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.4	3.7e-08
>prophage 340
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4810422	4813942	5002781		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|4810422_4811142_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951260.1|4811138_4812080_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000784341.1|4812193_4812574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109195.1|4812889_4813942_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
>prophage 341
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4818305	4824881	5002781		Tupanvirus(33.33%)	7	NA	NA
WP_001265445.1|4818305_4819322_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	8.0e-80
WP_000096843.1|4819584_4821057_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.6e-12
WP_001147445.1|4821124_4821913_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4822041_4822191_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|4822357_4823131_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604040.1|4823130_4823820_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891671.1|4823822_4824881_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	9.7e-20
>prophage 342
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4835143	4836433	5002781		Klosneuvirus(100.0%)	1	NA	NA
WP_001362906.1|4835143_4836433_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 343
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4842760	4843669	5002781		Streptococcus_phage(100.0%)	1	NA	NA
WP_001331964.1|4842760_4843669_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
>prophage 344
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4854267	4865929	5002781		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_001331962.1|4854267_4856004_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976402.1|4855996_4856995_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001295890.1|4856994_4857666_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007119.1|4857894_4859256_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001218658.1|4859792_4861943_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000386565.1|4861970_4862933_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000253505.1|4863073_4864159_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|4864386_4864647_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|4864911_4865178_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990167.1|4865251_4865929_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	6.9e-19
>prophage 345
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4872492	4877717	5002781		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4872492_4873215_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4873211_4873871_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4874009_4874756_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4875159_4875663_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4875961_4876849_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_122083111.1|4877083_4877149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295296.1|4877201_4877717_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 346
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4882714	4889598	5002781		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|4882714_4884307_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|4884506_4885322_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209353.1|4885467_4887900_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000576971.1|4887905_4888805_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350598.1|4888935_4889598_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 347
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4892813	4894685	5002781		Planktothrix_phage(100.0%)	1	NA	NA
WP_001350597.1|4892813_4894685_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 348
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4906019	4907222	5002781		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001467835.1|4906019_4907222_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.4e-99
>prophage 349
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4915769	4924918	5002781		Vibrio_phage(25.0%)	11	NA	NA
WP_001195230.1|4915769_4916027_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|4916186_4916474_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|4916457_4917180_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4917240_4918143_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4918230_4918707_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|4919056_4920169_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4920263_4921397_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|4921406_4922360_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|4922356_4923202_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4923261_4923750_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|4923790_4924918_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
>prophage 350
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4928043	4930781	5002781		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4928043_4928772_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|4928989_4929505_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4929630_4929954_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|4929950_4930781_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
>prophage 351
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4934368	4936087	5002781		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815373.1|4934368_4936087_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 352
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4945210	4989166	5002781	terminase,capsid,protease,integrase,tRNA,head	Escherichia_phage(15.0%)	36	4934777:4934791	4958382:4958396
4934777:4934791	attL	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000188147.1|4945210_4947157_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4947229_4947454_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000092882.1|4947858_4949097_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	3.1e-126
WP_001206975.1|4949516_4949726_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
WP_002430408.1|4949736_4950654_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000549001.1|4950646_4950874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791984.1|4950879_4951179_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761791.1|4951175_4952924_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	4.6e-91
WP_001260558.1|4953212_4953470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126681.1|4953466_4953889_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000796963.1|4954304_4954511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907460.1|4954510_4955566_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	2.7e-70
WP_000380879.1|4955577_4955913_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224594.1|4955925_4956339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835278.1|4956546_4957089_+|terminase	terminase	terminase	O64316	Escherichia_phage	46.0	9.3e-35
WP_000133395.1|4957345_4957627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002430406.1|4957776_4958037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|4958319_4958640_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
4958382:4958396	attR	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000934041.1|4958670_4960947_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|4961899_4962883_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|4962879_4966113_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|4966442_4967750_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|4968680_4969682_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|4969692_4970247_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|4971288_4971507_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|4971791_4972496_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202197.1|4972537_4974259_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.6e-14
WP_001043637.1|4974259_4976026_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	9.2e-23
WP_000537432.1|4976148_4977114_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4977657_4978152_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_047335301.1|4978286_4982348_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4982506_4983118_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4983128_4984472_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4984562_4985855_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850286.1|4986093_4988538_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000213098.1|4988548_4989166_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 353
NZ_CP007275	Escherichia coli strain O18 chromosome, complete genome	5002781	4992251	4998944	5002781	integrase	Escherichia_phage(33.33%)	9	4979947:4979960	4995716:4995729
4979947:4979960	attL	CTGTTGCAGCAGTA	NA	NA	NA	NA
WP_047335302.1|4992251_4993049_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.0e-21
WP_000023390.1|4993080_4994076_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|4994169_4994469_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|4994577_4994934_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_000217670.1|4995111_4995612_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_047335303.1|4995675_4995900_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.8e-32
4995716:4995729	attR	TACTGCTGCAACAG	NA	NA	NA	NA
WP_001113264.1|4996202_4996427_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4996423_4996699_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_047335304.1|4996688_4998944_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
