The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011546	Corynebacterium uterequi strain DSM 45634 chromosome, complete genome	2419437	1842237	1884517	2419437	integrase,protease,transposase	Shigella_phage(40.0%)	36	1870497:1870523	1878789:1878815
WP_047260453.1|1842237_1843473_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082121330.1|1844824_1845166_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_082121331.1|1846111_1846786_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_082121332.1|1846786_1847491_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_047260070.1|1847494_1848625_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_082121333.1|1848694_1849345_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_047260071.1|1849322_1851023_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_052844158.1|1851138_1853985_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_144412297.1|1854138_1855605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412340.1|1855685_1856348_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_047260074.1|1856701_1858048_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.4	6.8e-26
WP_047260075.1|1858126_1859311_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_047260076.1|1860243_1861332_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047260077.1|1861377_1862736_-	gluconate permease GntP	NA	NA	NA	NA	NA
WP_047260078.1|1862880_1864287_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_047260079.1|1864283_1865672_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.0e-29
WP_047260732.1|1865883_1867935_+	cytidylate kinase family protein	NA	NA	NA	NA	NA
WP_047260080.1|1868132_1868648_+	gluconokinase	NA	NA	NA	NA	NA
WP_047260081.1|1868669_1869227_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_047260733.1|1869247_1869532_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_047260082.1|1869619_1870093_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_047260083.1|1870089_1870497_-	holo-ACP synthase	NA	NA	NA	NA	NA
1870497:1870523	attL	TCGTGCGCCCGGGGGGACTTGAACCCC	NA	NA	NA	NA
WP_144412298.1|1871480_1872134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412299.1|1872139_1873087_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_144412218.1|1873128_1874353_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.9	7.5e-40
WP_144412218.1|1876312_1877538_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.9	7.5e-40
WP_082121334.1|1877579_1878644_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CI94	Actinomyces_phage	26.1	6.3e-19
WP_144412300.1|1878952_1879405_+	hypothetical protein	NA	NA	NA	NA	NA
1878789:1878815	attR	TCGTGCGCCCGGGGGGACTTGAACCCC	NA	NA	NA	NA
WP_047260087.1|1879397_1879787_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_047260088.1|1879792_1880419_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_047260089.1|1880422_1881166_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_047260090.1|1881195_1881963_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_047260091.1|1882014_1882857_-	glutamate racemase	NA	NA	NA	NA	NA
WP_144412301.1|1882888_1883605_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_047260092.1|1883616_1884180_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_082121423.1|1884217_1884517_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
