The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011343	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4621656	247550	296234	4621656	transposase,integrase	Streptococcus_phage(20.0%)	49	262036:262095	296344:296403
WP_000006255.1|247550_248048_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248271_250011_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|249955_250741_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250811_251867_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|251918_252212_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252214_252613_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252622_253075_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253380_253647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|253579_254116_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254172_255630_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255890_256349_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256440_257685_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257742_258144_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258182_259238_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259525_260629_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260640_261894_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262036:262095	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262465_262807_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|262827_263145_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263163_263385_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263393_263870_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|263885_264344_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264441_264681_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|264757_265225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265247_265691_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|265690_265918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266321_267143_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267234_268098_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268426_269320_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254932.1|269740_270892_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_010723085.1|273238_274255_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274462_275866_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|275852_276785_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276893_277940_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279161_279500_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279522_279873_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|279966_281121_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281415_282324_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|282338_284306_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284532_285915_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|285926_287537_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287541_288300_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288438_289443_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290637_291369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291459_292086_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292357_293056_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293082_293937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294055_294280_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294276_294717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|294833_296234_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
296344:296403	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP011343	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4621656	517491	580450	4621656	lysis,transposase,protease,terminase,integrase,tRNA	Enterobacteria_phage(50.0%)	66	563108:563154	584410:584456
WP_001295836.1|517491_518115_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|518085_518772_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|518768_521183_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|521613_525894_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|525933_526302_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|526992_527253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|528484_529579_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|529647_530574_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|530803_531286_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|531363_532179_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|532268_534050_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|534062_534839_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|534938_535817_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|535985_537440_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|537499_538861_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|538917_540219_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|540240_541386_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|541613_542399_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|542409_543645_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|543666_544716_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|545032_546700_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|546709_547969_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|547979_548795_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|548791_549685_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|549879_550947_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|550943_551453_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|551570_552293_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|552295_552790_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|552963_554349_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|554384_554906_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|555013_555226_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|555227_556094_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|556564_557107_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|557326_558019_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|558049_560653_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|560631_561672_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|561682_562198_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|562200_562833_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
563108:563154	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|563167_564331_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|564450_564714_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|565036_565132_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|565194_565494_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|565490_566357_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|566667_567000_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|567047_567197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|567254_568781_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|569245_569797_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|569806_570604_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|570720_570822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|570818_571274_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|571273_571444_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|571436_571727_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|571723_572086_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|572082_572223_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|572308_572692_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|573089_574106_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|574110_575178_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|575750_575966_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|575965_576463_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|576679_576862_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|576952_577246_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|577536_577947_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|578232_578439_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|578603_578798_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|579186_579732_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|579706_580450_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
584410:584456	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP011343	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4621656	1377003	1417821	4621656	lysis,transposase,integrase,tRNA,tail	Escherichia_phage(45.16%)	43	1378150:1378168	1408525:1408543
WP_010723085.1|1377003_1378020_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1378150:1378168	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1378292_1378550_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1378599_1379550_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1379701_1380454_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1380648_1381164_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1381174_1382701_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1382737_1384183_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1384182_1385493_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1385668_1386577_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1386906_1387470_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1387490_1388723_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1388977_1389961_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1390438_1391812_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1391940_1392876_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1392927_1394163_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1394164_1394380_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1394458_1394668_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1394660_1394855_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1394911_1395721_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1395713_1398314_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1398415_1398691_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1398765_1398936_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1398935_1399157_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1399598_1400087_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1400083_1400239_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1400692_1401169_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1401292_1401589_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1401611_1402034_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1402046_1402904_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1402910_1403657_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1403679_1404240_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1404327_1404513_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1404709_1406167_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1406304_1406568_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1406548_1406908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1408673_1409654_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1408525:1408543	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1409976_1413339_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1413338_1413914_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1414011_1414602_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1414918_1415152_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1415220_1415334_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1416112_1416547_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1416687_1417821_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
NZ_CP011343	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4621656	1610433	1629644	4621656	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1610433_1611894_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1611982_1613266_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1613870_1613984_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1614052_1614286_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1614602_1615193_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1615290_1615866_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1615865_1616828_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1616778_1617348_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1617736_1617970_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1618027_1618438_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1618589_1618763_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1618934_1619090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1619168_1619234_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1619236_1619425_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1619435_1619648_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1620010_1620508_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1620504_1621038_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1621034_1621346_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1621350_1621566_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1622319_1622535_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1622835_1623048_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1623102_1623192_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1623469_1624222_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1624235_1625285_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1625286_1625565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1625631_1625883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1626099_1626255_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1626326_1626614_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1626613_1626853_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1626877_1627183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1627385_1627718_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1628154_1628304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1628600_1628831_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1628914_1629322_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1629488_1629644_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_CP011343	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4621656	2445758	2458229	4621656	transposase,integrase,tail	Enterobacteria_phage(43.75%)	18	2443733:2443749	2461904:2461920
2443733:2443749	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2445758_2446691_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2447002_2448160_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2448312_2448675_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000169527.1|2448823_2449123_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|2449119_2449986_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001030215.1|2450849_2452181_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2452215_2452497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2452795_2453236_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2453262_2453781_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2453830_2454106_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2454105_2454600_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2454596_2454965_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2455322_2455685_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2455750_2456575_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2456702_2457239_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2457229_2457592_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2457591_2457897_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2458028_2458229_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2461904:2461920	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP011343	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4621656	2831969	2839108	4621656		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2831969_2834531_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2834636_2835293_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|2835343_2836141_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|2836306_2837215_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2837211_2838378_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2838469_2839108_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
NZ_CP011343	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4621656	3341435	3406834	4621656	transposase,tRNA,protease	Escherichia_phage(10.0%)	55	NA	NA
WP_010723085.1|3341435_3342452_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001067008.1|3342659_3343376_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_000445111.1|3343560_3344688_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|3344747_3345212_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|3345208_3346084_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3346080_3346770_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108454.1|3346817_3348308_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	6.4e-09
WP_000224714.1|3348416_3349310_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523845.1|3349431_3350223_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000467018.1|3350602_3351970_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000366129.1|3352012_3352510_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|3352515_3353154_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|3353548_3353941_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3353956_3354385_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192332.1|3354603_3355731_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|3355924_3356323_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|3356476_3357844_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3357933_3359001_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|3359063_3360002_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|3360436_3360907_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|3361271_3361535_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|3361590_3361863_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_000510965.1|3361954_3363922_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854021.1|3363927_3364860_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|3364867_3365071_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|3365253_3366183_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|3366316_3367762_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_001253618.1|3368191_3371992_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|3372059_3373529_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203105.1|3373518_3374112_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|3374120_3374609_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802511.1|3374608_3375712_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|3375777_3376821_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241469.1|3377125_3379066_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148481.1|3379217_3380192_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000354622.1|3381169_3381640_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|3381650_3383000_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000381173.1|3383108_3383351_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175728.1|3383340_3384792_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145827.1|3384803_3385685_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|3386013_3386979_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3387004_3387301_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001258895.1|3387386_3388271_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
WP_001295275.1|3388354_3388534_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001129518.1|3388536_3389199_-	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_000160334.1|3389597_3390755_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_001273238.1|3390766_3393871_+	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_000825639.1|3394123_3394345_+	membrane protein	NA	NA	NA	NA	NA
WP_000019655.1|3395867_3397049_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|3397058_3398162_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|3398169_3398928_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001286216.1|3404886_3405441_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_047281862.1|3405416_3405659_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_000878218.1|3405671_3406538_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|3406534_3406834_-|transposase	transposase	transposase	NA	NA	NA	NA
