The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011342	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4622342	247628	296312	4622342	integrase,transposase	Streptococcus_phage(20.0%)	49	262114:262173	296422:296481
WP_000006255.1|247628_248126_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248349_250089_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250033_250819_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250889_251945_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|251996_252290_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252292_252691_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252700_253153_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253458_253725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|253657_254194_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254250_255708_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255968_256427_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256518_257763_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257820_258222_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258260_259316_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259603_260707_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260718_261972_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262114:262173	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262543_262885_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|262905_263223_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263241_263463_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263471_263948_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|263963_264422_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264519_264759_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|264835_265303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265325_265769_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|265768_265996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266399_267221_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267312_268176_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268504_269398_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|269818_270970_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|273316_274333_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274540_275944_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|275930_276863_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276971_278018_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279239_279578_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279600_279951_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280044_281199_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281493_282402_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|282416_284384_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284610_285993_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286004_287615_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287619_288378_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288516_289521_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290715_291447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291537_292164_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292435_293134_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293160_294015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294133_294358_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294354_294795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|294911_296312_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
296422:296481	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP011342	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4622342	517927	580886	4622342	protease,lysis,integrase,terminase,transposase,tRNA	Enterobacteria_phage(50.0%)	66	563544:563590	584846:584892
WP_001295836.1|517927_518551_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|518521_519208_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|519204_521619_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|522049_526330_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|526369_526738_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|527428_527689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|528920_530015_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|530083_531010_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|531239_531722_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|531799_532615_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|532704_534486_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|534498_535275_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|535374_536253_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|536421_537876_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|537935_539297_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|539353_540655_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|540676_541822_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|542049_542835_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|542845_544081_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|544102_545152_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|545468_547136_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|547145_548405_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|548415_549231_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|549227_550121_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|550315_551383_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|551379_551889_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|552006_552729_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|552731_553226_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|553399_554785_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|554820_555342_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|555449_555662_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|555663_556530_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|557000_557543_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|557762_558455_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|558485_561089_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|561067_562108_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|562118_562634_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|562636_563269_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
563544:563590	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|563603_564767_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|564886_565150_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|565472_565568_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|565630_565930_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|565926_566793_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|567103_567436_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|567483_567633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|567690_569217_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|569681_570233_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570242_571040_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571156_571258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571254_571710_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|571709_571880_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|571872_572163_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572159_572522_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|572518_572659_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|572744_573128_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_077866150.1|573525_574542_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000737282.1|574546_575614_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|576186_576402_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|576401_576899_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|577115_577298_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|577388_577682_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|577972_578383_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|578668_578875_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|579039_579234_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|579622_580168_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|580142_580886_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
584846:584892	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP011342	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4622342	1377943	1418761	4622342	lysis,integrase,tail,transposase,tRNA	Escherichia_phage(45.16%)	43	1379090:1379108	1409465:1409483
WP_010723085.1|1377943_1378960_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1379090:1379108	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1379232_1379490_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1379539_1380490_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1380641_1381394_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1381588_1382104_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1382114_1383641_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1383677_1385123_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1385122_1386433_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1386608_1387517_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1387846_1388410_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1388430_1389663_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1389917_1390901_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1391378_1392752_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1392880_1393816_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1393867_1395103_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1395104_1395320_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1395398_1395608_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1395600_1395795_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1395851_1396661_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1396653_1399254_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1399355_1399631_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1399705_1399876_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1399875_1400097_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1400538_1401027_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1401023_1401179_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1401632_1402109_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1402232_1402529_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1402551_1402974_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1402986_1403844_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1403850_1404597_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1404619_1405180_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1405267_1405453_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1405649_1407107_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1407244_1407508_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1407488_1407848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1409613_1410594_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1409465:1409483	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1410916_1414279_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885611.1|1414278_1414854_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|1414951_1415542_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1415858_1416092_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1416160_1416274_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1417052_1417487_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1417627_1418761_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
NZ_CP011342	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4622342	1611142	1630353	4622342	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1611142_1612603_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1612691_1613975_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1614579_1614693_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|1614761_1614995_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|1615311_1615902_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|1615999_1616575_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_001027733.1|1616574_1617537_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1617487_1618057_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1618445_1618679_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1618736_1619147_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1619298_1619472_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1619643_1619799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1619877_1619943_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1619945_1620134_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1620144_1620357_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1620719_1621217_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1621213_1621747_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1621743_1622055_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1622059_1622275_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1623028_1623244_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1623544_1623757_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1623811_1623901_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1624178_1624931_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1624944_1625994_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1625995_1626274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1626340_1626592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1626808_1626964_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1627035_1627323_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1627322_1627562_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1627586_1627892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1628094_1628427_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1628863_1629013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1629309_1629540_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1629623_1630031_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1630197_1630353_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_CP011342	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4622342	2446683	2459154	4622342	integrase,transposase,tail	Enterobacteria_phage(43.75%)	18	2444658:2444674	2462829:2462845
2444658:2444674	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2446683_2447616_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2447927_2449085_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2449237_2449600_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000169527.1|2449748_2450048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|2450044_2450911_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001030215.1|2451774_2453106_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2453140_2453422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2453720_2454161_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2454187_2454706_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2454755_2455031_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2455030_2455525_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2455521_2455890_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2456247_2456610_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2456675_2457500_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2457627_2458164_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2458154_2458517_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2458516_2458822_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2458953_2459154_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2462829:2462845	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP011342	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4622342	2832961	2840100	4622342		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2832961_2835523_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2835628_2836285_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|2836335_2837133_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|2837298_2838207_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2838203_2839370_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2839461_2840100_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
NZ_CP011342	Escherichia coli K-12 substr. GM4792 chromosome, complete genome	4622342	3342180	3407335	4622342	protease,transposase,tRNA	Escherichia_phage(10.0%)	55	NA	NA
WP_010723085.1|3342180_3343197_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001067008.1|3343404_3344121_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_000445111.1|3344305_3345433_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|3345492_3345957_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|3345953_3346829_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3346825_3347515_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108454.1|3347562_3349053_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	6.4e-09
WP_000224714.1|3349161_3350055_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523845.1|3350176_3350968_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000467018.1|3351347_3352715_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000366129.1|3352757_3353255_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|3353260_3353899_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|3354293_3354686_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3354701_3355130_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192332.1|3355348_3356476_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|3356669_3357068_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|3357221_3358589_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3358678_3359746_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|3359808_3360747_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|3361181_3361652_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|3362016_3362280_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|3362335_3362608_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_000510965.1|3362699_3364667_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854021.1|3364672_3365605_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|3365612_3365816_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|3365998_3366928_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055909.1|3367061_3368507_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_001253618.1|3368845_3372646_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123197.1|3372713_3374183_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203105.1|3374172_3374766_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|3374774_3375263_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802511.1|3375262_3376366_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|3376431_3377475_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241469.1|3377779_3379720_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148481.1|3379871_3380846_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000354622.1|3381823_3382294_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|3382304_3383654_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000381173.1|3383762_3384005_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175728.1|3383994_3385446_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145827.1|3385457_3386339_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|3386667_3387633_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3387658_3387955_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001258895.1|3388040_3388925_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
WP_001295275.1|3389008_3389188_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_001129518.1|3389190_3389853_-	multidrug efflux transporter transcriptional repressor AcrS	NA	NA	NA	NA	NA
WP_000160334.1|3390251_3391409_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrE	NA	NA	NA	NA	NA
WP_001273238.1|3391420_3394525_+	multidrug efflux RND transporter permease subunit AcrF	NA	NA	NA	NA	NA
WP_000825639.1|3394777_3394999_+	membrane protein	NA	NA	NA	NA	NA
WP_000019655.1|3396521_3397703_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|3397712_3398816_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|3398823_3399582_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
WP_001286216.1|3405387_3405942_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_047281862.1|3405917_3406160_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_000878218.1|3406172_3407039_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|3407035_3407335_-|transposase	transposase	transposase	NA	NA	NA	NA
