The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	0	2882	1702054		Rhizobium_phage(100.0%)	2	NA	NA
WP_002987659.1|234_1590_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_011054084.1|1745_2882_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	24.7	9.1e-24
>prophage 2
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	10953	14788	1702054	tRNA	Phaeocystis_globosa_virus(50.0%)	3	NA	NA
WP_011106565.1|10953_12240_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	25.8	1.6e-16
WP_002981912.1|12244_12787_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002981901.1|12808_14788_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	47.2	8.8e-107
>prophage 3
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	30167	58292	1702054		Synechococcus_phage(23.08%)	23	NA	NA
WP_109821002.1|30167_30449_-	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	44.3	1.3e-08
WP_002996017.1|31195_32392_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_002986722.1|32644_33607_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	8.2e-42
WP_002986719.1|33792_34548_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002993444.1|34650_35658_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002993445.1|35650_35893_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_009880325.1|36013_36748_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	40.1	2.3e-44
WP_047236092.1|36871_40597_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	28.7	3.5e-40
WP_023080049.1|40757_42212_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.7e-54
WP_023080052.1|42239_43262_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	9.0e-63
WP_002986700.1|43429_43984_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_023610065.1|44167_45715_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_047236093.1|45773_46898_-	CHAP domain-containing protein	NA	A0A1S5PRY3	Streptococcus_phage	33.1	7.7e-07
WP_023080273.1|47150_48416_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48693_49185_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
WP_080342298.1|49135_50239_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002987721.1|50259_51600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986683.1|51968_53261_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	1.1e-17
WP_014635220.1|53391_54303_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002986679.1|54522_55521_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	1.0e-07
WP_002994668.1|55658_56096_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012560369.1|56118_56520_+	membrane protein	NA	NA	NA	NA	NA
WP_038431188.1|56516_58292_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.8	6.2e-19
>prophage 4
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	61495	62512	1702054		Tupanvirus(100.0%)	1	NA	NA
WP_020833189.1|61495_62512_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.9	1.1e-25
>prophage 5
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	88337	101542	1702054	tRNA	Bacillus_virus(25.0%)	7	NA	NA
WP_002986585.1|88337_89057_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.3e-15
WP_002987764.1|89049_89865_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_038431192.1|89904_90279_-	HIT family protein	NA	NA	NA	NA	NA
WP_002987768.1|90337_91594_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.8	1.5e-72
WP_002987769.1|91685_93998_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002993467.1|94261_97828_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.0	1.2e-50
WP_011527438.1|97918_101542_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.6	1.6e-66
>prophage 6
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	108653	113693	1702054	tRNA	Streptococcus_phage(66.67%)	8	NA	NA
WP_002992745.1|108653_109424_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.0	8.0e-32
WP_002992747.1|109471_110539_-	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002986521.1|110648_110813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002992749.1|111003_111288_+	DUF4651 domain-containing protein	NA	NA	NA	NA	NA
WP_002992751.1|111284_111602_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002992754.1|111619_112264_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_002987809.1|112396_112792_+	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	47.0	5.8e-26
WP_002986504.1|113051_113693_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	49.5	2.4e-53
>prophage 7
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	143979	149232	1702054		Streptococcus_phage(50.0%)	4	NA	NA
WP_002986415.1|143979_145242_-	tellurite resistance protein	NA	M1PLC8	Streptococcus_phage	67.9	5.0e-148
WP_014635244.1|145254_146133_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	40.2	1.7e-25
WP_038431198.1|146569_147862_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.3	3.3e-70
WP_076644546.1|148203_149232_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	40.7	7.6e-62
>prophage 8
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	155766	159618	1702054	tRNA	Pandoravirus(50.0%)	2	NA	NA
WP_032460950.1|155766_156906_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	29.5	5.7e-18
WP_038431201.1|157116_159618_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.9	0.0e+00
>prophage 9
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	168444	177644	1702054	tRNA	Bacillus_virus(33.33%)	8	NA	NA
WP_023605215.1|168444_169641_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	6.9e-30
WP_002986341.1|169656_171384_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011054150.1|171514_174157_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	35.9	1.5e-64
WP_002986334.1|174343_174799_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002986328.1|174850_175318_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_002986324.1|175419_176283_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002986321.1|176319_176505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986319.1|176501_177644_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	2.9e-86
>prophage 10
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	188219	195842	1702054		Bacillus_phage(75.0%)	7	NA	NA
WP_002986125.1|188219_189119_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	9.6e-77
WP_002986123.1|189151_190168_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002986120.1|190465_190915_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023610146.1|190907_192614_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-36
WP_023610145.1|192616_194401_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	5.6e-44
WP_002986113.1|194518_195286_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_002986111.1|195395_195842_+	dUTP diphosphatase	NA	A0A1P8BLJ0	Lactococcus_phage	52.8	4.5e-35
>prophage 11
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	198991	200437	1702054	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_002993289.1|198991_200437_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L481	Tupanvirus	31.2	6.8e-08
>prophage 12
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	222778	223618	1702054		Streptococcus_phage(100.0%)	1	NA	NA
WP_002992072.1|222778_223618_+	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	30.8	1.4e-05
>prophage 13
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	227825	232478	1702054		Streptococcus_phage(50.0%)	4	NA	NA
WP_002986045.1|227825_229904_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.7	1.6e-63
WP_014635277.1|230243_231254_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000818733.1|231479_231596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002991131.1|231737_232478_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.4e-25
>prophage 14
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	239271	245866	1702054		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_002986023.1|239271_240042_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	1.8e-07
WP_047236100.1|240136_241399_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002991117.1|241429_242656_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.8	3.5e-106
WP_002986018.1|242642_243122_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002986015.1|243114_244533_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002992220.1|244684_245866_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	5.4e-11
>prophage 15
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	252068	254055	1702054		Bacillus_virus(50.0%)	2	NA	NA
WP_002992231.1|252068_253139_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	5.2e-13
WP_002986000.1|253131_254055_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-21
>prophage 16
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	267210	268815	1702054		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_038431571.1|267210_268815_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	5.4e-139
>prophage 17
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	274124	275015	1702054		Klosneuvirus(100.0%)	1	NA	NA
WP_002982880.1|274124_275015_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	37.0	1.5e-37
>prophage 18
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	280350	284692	1702054	tRNA	Cellulophaga_phage(50.0%)	5	NA	NA
WP_047236104.1|280350_282033_-	ribonuclease J	NA	S0A5H7	Cellulophaga_phage	31.3	1.1e-06
WP_002982907.1|282034_282265_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002992279.1|282548_283247_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011106599.1|283248_283674_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002988178.1|283663_284692_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.7	2.5e-57
>prophage 19
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	289148	293893	1702054		Staphylococcus_phage(50.0%)	7	NA	NA
WP_011106601.1|289148_290318_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	53.0	5.5e-16
WP_011184937.1|290471_291053_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_020837730.1|291062_291689_+	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	28.2	1.7e-11
WP_002992265.1|291841_292579_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002992264.1|292635_292935_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002992262.1|293127_293502_-	helix-turn-helix transcriptional regulator	NA	A0A097BY95	Leuconostoc_phage	51.6	2.1e-17
WP_002988211.1|293671_293893_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	41.2	4.8e-06
>prophage 20
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	298700	299648	1702054		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_010922640.1|298700_299648_+	aquaporin family protein	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.9	7.6e-24
>prophage 21
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	303072	328817	1702054		Bacillus_phage(20.0%)	26	NA	NA
WP_002988233.1|303072_305400_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	33.4	4.2e-116
WP_020837721.1|305608_306703_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_020837717.1|306795_307278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002993256.1|307369_309823_-	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	28.6	1.4e-58
WP_002983074.1|309880_310474_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002993253.1|310484_311387_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_002993251.1|311543_311852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983087.1|311854_312400_+	CvpA family protein	NA	NA	NA	NA	NA
WP_012560934.1|312548_314888_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	46.8	4.8e-19
WP_011528944.1|314888_315392_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011018190.1|315472_315787_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.3	5.1e-17
WP_020837707.1|315838_316426_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_028797157.1|316602_317727_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	1.3e-22
WP_002983113.1|317924_318218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983117.1|318390_318681_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002993238.1|318702_319194_+	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.8	1.3e-59
WP_002983142.1|319358_319598_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_047236107.1|319728_320385_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983147.1|320517_321462_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_038431557.1|321664_324493_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	7.7e-306
WP_038431556.1|324608_325682_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.2	1.7e-16
WP_002988493.1|325716_326178_+	hypothetical protein	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
WP_002988496.1|326273_326831_+	elongation factor P	NA	NA	NA	NA	NA
WP_002983163.1|326876_327266_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002988501.1|327258_327711_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002988504.1|327851_328817_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	8.0e-21
>prophage 22
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	340909	342010	1702054		Yellowstone_lake_mimivirus(100.0%)	1	NA	NA
WP_002983202.1|340909_342010_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.0	3.3e-31
>prophage 23
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	349886	364899	1702054		Organic_Lake_phycodnavirus(28.57%)	12	NA	NA
WP_002983218.1|349886_350909_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	2.0e-14
WP_002983221.1|350905_351742_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.9e-17
WP_047236108.1|351738_353502_+	ABC transporter ATP-binding protein/permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	1.3e-21
WP_023079703.1|353494_355165_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.6	3.4e-19
WP_002995377.1|355161_355755_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002983239.1|355751_356432_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002995374.1|356428_357823_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.2e-12
WP_023605259.1|358197_360213_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_002991995.1|360505_361408_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	3.9e-38
WP_002988556.1|361420_362125_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002992573.1|362473_363439_-	asparaginase	NA	NA	NA	NA	NA
WP_047236109.1|363510_364899_+	Cof-type HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	37.1	9.4e-23
>prophage 24
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	368064	368619	1702054		Bacillus_virus(100.0%)	1	NA	NA
WP_002988559.1|368064_368619_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.5	2.6e-24
>prophage 25
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	377812	381056	1702054		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_002993774.1|377812_379639_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.3	1.1e-130
WP_002993772.1|379919_381056_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	27.3	2.8e-17
>prophage 26
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	385962	386697	1702054		Bacillus_phage(100.0%)	1	NA	NA
WP_047236110.1|385962_386697_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	39.5	3.2e-06
>prophage 27
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	392135	393413	1702054	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_023611943.1|392135_393413_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.0	4.7e-93
>prophage 28
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	398523	399984	1702054		Moraxella_phage(100.0%)	1	NA	NA
WP_038431532.1|398523_399984_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.3	2.4e-37
>prophage 29
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	403344	404070	1702054		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_038431527.1|403344_404070_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	1.3e-20
>prophage 30
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	409350	417916	1702054		Cafeteria_roenbergensis_virus(33.33%)	8	NA	NA
WP_002983491.1|409350_412212_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.2	4.5e-19
WP_003062050.1|412411_412768_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_038431523.1|412901_413888_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011054926.1|414059_414494_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_075340221.1|414523_416725_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.4	3.5e-112
WP_002994306.1|416738_416942_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011184859.1|416948_417119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983505.1|417145_417916_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	6.4e-21
>prophage 31
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	424752	431356	1702054		Streptococcus_phage(50.0%)	6	NA	NA
WP_010922569.1|424752_425310_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	60.3	3.2e-14
WP_002988852.1|425602_426445_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	61.9	1.3e-91
WP_014635642.1|426573_427296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047236112.1|427497_429129_+	Na/Pi cotransporter family protein	NA	A0A1B1ITU5	uncultured_Mediterranean_phage	38.8	2.7e-05
WP_021299064.1|429246_430395_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002983539.1|430516_431356_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	2.5e-50
>prophage 32
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	440392	441094	1702054		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002988870.1|440392_441094_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	37.5	5.2e-30
>prophage 33
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	444163	452000	1702054	bacteriocin	Streptococcus_phage(50.0%)	7	NA	NA
WP_002994258.1|444163_444808_+	fructose-6-phosphate aldolase	NA	A0A0C5AMY8	Cyanophage	44.7	5.9e-44
WP_038431740.1|445025_447011_+	transketolase	NA	NA	NA	NA	NA
WP_002983572.1|447203_447470_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_038431507.1|447503_448238_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	2.8e-26
WP_038431506.1|448242_449871_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023611731.1|449935_450757_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.8	4.7e-38
WP_038431504.1|450749_452000_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.3	3.5e-117
>prophage 34
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	457235	470386	1702054		Bacillus_virus(42.86%)	11	NA	NA
WP_011184835.1|457235_458579_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	28.4	1.8e-42
WP_011888658.1|458773_459577_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002983603.1|459576_460320_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	1.0e-28
WP_002988906.1|460423_460648_+	DUF4059 family protein	NA	NA	NA	NA	NA
WP_011018071.1|460711_461629_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	3.1e-91
WP_002988920.1|461797_463177_+	amino acid permease	NA	NA	NA	NA	NA
WP_038431500.1|463346_464807_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.6	7.9e-97
WP_011054845.1|464803_465628_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.1	1.5e-71
WP_011054844.1|465812_467150_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	37.0	1.4e-68
WP_014635625.1|467616_469791_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002983622.1|469777_470386_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.9	3.2e-23
>prophage 35
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	476612	498650	1702054	tRNA	Streptococcus_phage(33.33%)	21	NA	NA
WP_009880832.1|476612_477392_-	3-hydroxybutyrate dehydrogenase	NA	G8EDD5	Acanthamoeba_castellanii_mamavirus	26.7	3.1e-07
WP_002988946.1|477424_478084_-	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_002988948.1|478085_478736_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_009880833.1|478759_479947_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_038431495.1|480147_481041_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	1.2e-07
WP_002988954.1|481170_482778_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_002983649.1|482887_483523_+	guanylate kinase	NA	S4VT50	Pandoravirus	45.3	4.9e-11
WP_002983650.1|483538_483856_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_038431492.1|483920_486305_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_010922540.1|486366_487302_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
WP_002983657.1|487291_488614_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002983660.1|488651_489392_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_038431490.1|489388_491287_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	B5LWE2	Feldmannia_species_virus	30.7	1.4e-21
WP_002983667.1|491358_492102_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_038431487.1|492098_493103_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002983671.1|493095_493737_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023079249.1|493773_495174_+	bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.5	5.4e-26
WP_002991882.1|495173_495551_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038431485.1|495568_496510_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	77.6	2.1e-130
WP_002988970.1|496637_497270_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.3	4.2e-63
WP_002988971.1|497324_498650_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	51.1	2.4e-116
>prophage 36
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	509189	510545	1702054		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002991789.1|509189_510545_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.0	1.1e-73
>prophage 37
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	527054	528779	1702054		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002983729.1|527054_528779_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.9	2.6e-14
>prophage 38
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	536838	537912	1702054		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002989016.1|536838_537912_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	31.6	7.3e-31
>prophage 39
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	542115	544764	1702054	tRNA	Catovirus(100.0%)	1	NA	NA
WP_038431470.1|542115_544764_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.5	1.9e-149
>prophage 40
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	551555	554026	1702054		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_047236115.1|551555_552296_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	32.4	8.0e-05
WP_038431467.1|552292_554026_+	HAMP domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	33.2	2.3e-26
>prophage 41
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	564753	569304	1702054		Heterosigma_akashiwo_virus(33.33%)	5	NA	NA
WP_002994813.1|564753_565746_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.2	2.6e-51
WP_002983819.1|565868_566408_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_002983821.1|566397_566889_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	33.8	2.0e-15
WP_010922499.1|566875_567913_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_002994809.1|568326_569304_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.9	3.6e-21
>prophage 42
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	574820	576662	1702054		Streptococcus_phage(100.0%)	1	NA	NA
WP_002983847.1|574820_576662_+	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	31.4	2.0e-20
>prophage 43
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	587330	601675	1702054	protease,tRNA	Moumouvirus(14.29%)	11	NA	NA
WP_038431449.1|587330_590132_+|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.9	3.2e-70
WP_002983878.1|590396_590699_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002993341.1|590749_591205_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002983882.1|591332_593615_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_002983885.1|593912_594143_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_011054708.1|594269_594956_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989107.1|594955_595690_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_047236117.1|595838_597248_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	4.4e-60
WP_002993334.1|597425_599120_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_002989114.1|599327_600182_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.4	4.4e-39
WP_002992349.1|600334_601675_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
>prophage 44
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	607037	613092	1702054		Staphylococcus_phage(25.0%)	6	NA	NA
WP_002989125.1|607037_607877_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
WP_010922483.1|607851_608712_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989129.1|608689_609277_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|609375_609651_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
WP_038431443.1|609994_611857_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	1.2e-89
WP_038431441.1|612156_613092_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	1.0e-65
>prophage 45
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	621404	696064	1702054	protease,transposase,tRNA,integrase	Enterococcus_phage(15.79%)	67	642869:642884	694437:694452
WP_002989155.1|621404_622949_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.1e-35
WP_002989158.1|623255_624875_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_002994363.1|625001_627002_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	1.3e-65
WP_002989164.1|627025_627304_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_002994360.1|627293_628070_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_080342301.1|628109_628928_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002995626.1|629127_629790_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_002995623.1|629770_632014_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	59.2	1.8e-55
WP_011054659.1|632084_633125_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_002983977.1|633221_633827_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	1.8e-58
WP_002983979.1|633993_634227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014635564.1|634263_634455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038431440.1|634451_635042_+	peptidase S11	NA	NA	NA	NA	NA
WP_038431438.1|635155_636376_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_002995782.1|636382_637411_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002995779.1|637612_638317_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_038431436.1|638435_639152_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002983995.1|639446_640409_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_038431433.1|640421_642227_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002995765.1|642602_643799_+	OFA family MFS transporter	NA	NA	NA	NA	NA
642869:642884	attL	TGGTTTAGCGATTGAT	NA	NA	NA	NA
WP_011017939.1|643864_644572_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
WP_011184661.1|644634_645690_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_047236119.1|646076_648695_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	5.1e-62
WP_002989220.1|649055_649271_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002995750.1|650046_650742_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_033888125.1|652086_653400_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002993434.1|653374_654334_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.2	1.8e-126
WP_002993430.1|654666_656826_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.7	2.1e-263
WP_002989242.1|656845_657064_-	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
WP_002984031.1|657456_657720_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_020837320.1|657724_659458_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_011284931.1|659642_661070_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_020837316.1|661164_662439_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_047236120.1|662548_663634_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	5.4e-34
WP_002984060.1|663731_664358_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_002989257.1|664437_664701_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_047236121.1|664753_665563_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_009881127.1|665707_666205_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_021733069.1|666204_667875_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.6	5.1e-47
WP_012560785.1|667970_668174_+	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
WP_002984078.1|668148_669090_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_038431426.1|669293_671651_+	internalin	NA	NA	NA	NA	NA
WP_002989292.1|672186_673383_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
WP_002989295.1|673556_674816_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_047236122.1|675173_676163_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002984095.1|676400_676943_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002989302.1|676951_678235_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_038431424.1|678250_679111_+	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_023609958.1|679112_680078_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011054628.1|680179_681472_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002989310.1|681464_681956_+	shikimate kinase	NA	NA	NA	NA	NA
WP_002984109.1|682163_683615_+	LCP family protein	NA	NA	NA	NA	NA
WP_032466998.1|683663_685055_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	98.9	1.7e-261
WP_111679872.1|685322_685535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111679839.1|685541_685985_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	96.6	1.2e-77
WP_002984115.1|686069_686471_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_002995506.1|686575_688060_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_038431421.1|688432_689653_+	MFS transporter	NA	NA	NA	NA	NA
WP_002984124.1|689772_690138_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_002989522.1|690249_690984_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_023611383.1|691000_691114_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079891374.1|691153_691351_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	49.2	3.7e-10
WP_136026551.1|691426_691621_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012560415.1|691755_692049_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002984130.1|692126_693437_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_002992869.1|693660_694533_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
694437:694452	attR	TGGTTTAGCGATTGAT	NA	NA	NA	NA
WP_111679873.1|694832_696064_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.1	6.3e-63
>prophage 46
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	706641	707382	1702054		Planktothrix_phage(100.0%)	1	NA	NA
WP_002989563.1|706641_707382_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.2e-35
>prophage 47
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	712158	713697	1702054		Tupanvirus(100.0%)	1	NA	NA
WP_020837260.1|712158_713697_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.4	1.9e-40
>prophage 48
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	717977	718964	1702054	transposase	Staphylococcus_prophage(100.0%)	1	NA	NA
WP_047236123.1|717977_718964_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.0	1.7e-34
>prophage 49
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	723107	767877	1702054	holin,integrase	Streptococcus_phage(31.71%)	51	729135:729194	761457:761552
WP_002992583.1|723107_724127_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	5.7e-17
WP_002992582.1|724240_725734_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_002992581.1|725768_728033_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_002989605.1|728289_728910_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
729135:729194	attL	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGA	NA	NA	NA	NA
WP_011054595.1|729272_730361_-|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	4.7e-203
WP_011285585.1|730481_731375_-	hypothetical protein	NA	A0A1I9LJQ0	Stx_converting_phage	47.5	1.2e-68
WP_011285584.1|731410_732235_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	91.6	1.2e-131
WP_011285583.1|732591_732750_+	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	100.0	4.8e-24
WP_011284882.1|732779_733379_-	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011284881.1|733432_733642_+	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
WP_011054589.1|733630_734017_-	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
WP_002992770.1|734090_734291_+	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	59.6	2.7e-08
WP_011017885.1|734400_734610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017884.1|734740_735250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|735508_735718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023079659.1|735893_736112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002995990.1|736254_736431_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011017882.1|736508_736805_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_002984309.1|736801_736939_+	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	97.8	4.9e-17
WP_002984312.1|737019_737349_+	hypothetical protein	NA	A1EAC2	Streptococcus_phage	41.6	2.7e-13
WP_002984315.1|737348_737543_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_002984318.1|737539_737824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984321.1|737820_738504_+	AAA family ATPase	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
WP_075340263.1|738539_739943_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
WP_002984328.1|739947_740430_+	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
WP_002984332.1|740447_742001_+	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.4	4.3e-210
WP_020833541.1|742278_743148_+	hypothetical protein	NA	A0A1P8BME8	Lactococcus_phage	65.2	9.8e-103
WP_002984338.1|743101_743452_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	89.4	2.6e-46
WP_047236124.1|743435_743795_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	92.2	7.0e-55
WP_032462877.1|744147_744501_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	47.7	4.7e-19
WP_002988428.1|744542_744872_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	5.7e-11
WP_032462878.1|744886_748522_+	tape measure protein	NA	U6E979	Streptococcus_phage	29.6	5.2e-04
WP_032462880.1|748553_749333_+	hypothetical protein	NA	A3F655	Streptococcus_phage	53.6	4.7e-64
WP_032462881.1|749329_751381_+	hypothetical protein	NA	A3F656	Streptococcus_phage	84.6	0.0e+00
WP_047236125.1|751377_752382_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	62.7	3.4e-107
WP_032462883.1|752396_754283_+	phage hyaluronidase	NA	Q938J9	Temperate_phage	82.6	4.0e-210
WP_011184582.1|754294_754723_+	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.9	8.6e-68
WP_011184581.1|754725_755331_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	92.5	9.3e-84
WP_002988455.1|755346_755802_+|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	5.2e-63
WP_011184580.1|755913_756471_+	glycoside hydrolase family 73 protein	NA	Q938J4	Temperate_phage	87.0	4.1e-94
WP_002994484.1|756703_757396_+	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
WP_023080015.1|757505_758150_+	CHAP domain-containing protein	NA	A7J2B5	Streptococcus_phage	77.2	4.0e-93
WP_011054728.1|759016_759796_+	streptococcal pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	100.0	5.4e-145
WP_011054727.1|760271_760847_+	hypothetical protein	NA	Q938J0	Temperate_phage	100.0	1.7e-111
WP_011106694.1|760840_761128_+	hypothetical protein	NA	Q938I9	Temperate_phage	100.0	2.4e-29
WP_011184577.1|761192_761414_+	hypothetical protein	NA	A3F673	Streptococcus_phage	83.1	9.0e-21
WP_002989607.1|761972_762587_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
761457:761552	attR	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGATTACTTACGGTAAGCATTGATGGAGCTGGTGGGAGT	NA	NA	NA	NA
WP_002984433.1|762717_763503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002992425.1|763512_764211_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002989617.1|764210_764582_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984441.1|764766_767877_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.8	1.4e-119
>prophage 50
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	771485	775218	1702054		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_038431383.1|771485_773300_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.9	3.1e-98
WP_002989626.1|773495_773831_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_038431381.1|773937_774579_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002992415.1|774588_775218_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.8e-28
>prophage 51
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	780788	788147	1702054		Bacillus_phage(33.33%)	10	NA	NA
WP_047236128.1|780788_783080_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-131
WP_002984469.1|783451_783700_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_011106783.1|783736_784348_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984473.1|784358_784547_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984475.1|784559_785099_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|785139_785340_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984478.1|785347_785839_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984480.1|786001_786643_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984482.1|786785_787328_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989664.1|787445_788147_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
>prophage 52
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	794927	820240	1702054		Bacillus_virus(27.27%)	24	NA	NA
WP_002989679.1|794927_795860_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.6	6.4e-07
WP_002984496.1|795902_796307_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002984499.1|796575_797364_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_047236131.1|797366_798677_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_038431374.1|798815_799682_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	M1U9L0	Synechococcus_phage	24.2	7.7e-07
WP_021733442.1|799692_800628_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_023610004.1|800617_801505_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002984509.1|801520_802324_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.9e-15
WP_002993892.1|802336_803095_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.8e-15
WP_002984514.1|803162_803816_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011054529.1|804020_806558_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.9	1.9e-74
WP_002984519.1|806904_807579_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011054528.1|807571_808882_+	HAMP domain-containing histidine kinase	NA	A0A2K9L5I4	Tupanvirus	25.3	1.2e-06
WP_002989695.1|809006_809240_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010922353.1|809308_810229_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.0	3.5e-34
WP_002989699.1|810496_811090_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002984531.1|811740_812130_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002992954.1|812223_813276_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	38.8	1.9e-55
WP_010922350.1|813414_814947_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.0	4.0e-14
WP_038431371.1|814939_816004_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010922349.1|816005_816962_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_030126666.1|817174_818893_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	84.3	1.2e-277
WP_002984543.1|819068_819638_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002984544.1|819694_820240_-	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	35.2	9.1e-22
>prophage 53
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	824514	827267	1702054		Tupanvirus(50.0%)	3	NA	NA
WP_038431369.1|824514_825327_+	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	42.9	2.5e-31
WP_047236132.1|825319_826201_+	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_038431368.1|826247_827267_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.6	1.5e-09
>prophage 54
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	831874	839504	1702054		Streptococcus_phage(33.33%)	6	NA	NA
WP_011054517.1|831874_833143_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	52.8	7.1e-102
WP_002992577.1|833232_834099_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_002989733.1|834076_834634_+	membrane protein	NA	NA	NA	NA	NA
WP_080007621.1|834746_836312_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	7.1e-51
WP_020905214.1|836676_837900_+	aminoacyltransferase	NA	NA	NA	NA	NA
WP_002993734.1|837941_839504_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.9	8.4e-20
>prophage 55
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	844026	846265	1702054		Streptococcus_phage(50.0%)	2	NA	NA
WP_014635476.1|844026_844725_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	48.5	1.2e-58
WP_002984598.1|845194_846265_+	tyrosine recombinase XerS	NA	A0A2D2W391	Mycobacterium_phage	26.7	5.2e-05
>prophage 56
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	864124	868053	1702054		Cafeteria_roenbergensis_virus(66.67%)	3	NA	NA
WP_002984618.1|864124_866254_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.3	1.5e-99
WP_002995009.1|866360_867197_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.1	4.2e-34
WP_002995007.1|867261_868053_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	2.8e-24
>prophage 57
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	873593	907031	1702054		Bacillus_phage(17.65%)	33	NA	NA
WP_011054496.1|873593_876080_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	8.7e-104
WP_002984645.1|876270_877254_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002984646.1|877411_878782_-	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	1.1e-10
WP_047236134.1|879022_880750_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	8.1e-48
WP_021733682.1|880746_882471_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	9.2e-36
WP_002984653.1|882480_883080_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.6	1.1e-20
WP_002984655.1|883080_884058_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_014635463.1|884064_885321_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	2.2e-95
WP_038431351.1|885310_885763_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011054488.1|885780_886371_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	30.1	4.0e-15
WP_011054487.1|886354_887194_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011054486.1|887193_888273_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_002989802.1|888307_888877_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	57.0	1.8e-52
WP_002984671.1|889014_889200_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_002994961.1|889252_890191_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_038431347.1|890254_891538_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.7	6.0e-32
WP_002984677.1|891537_892119_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011054482.1|892423_893407_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	74.8	2.5e-139
WP_080032277.1|893684_895217_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003054030.1|895203_895932_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.1	1.0e-15
WP_002984687.1|896351_897041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038431342.1|897234_897990_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	4.7e-08
WP_002984691.1|898116_899112_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_002989820.1|899115_900021_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.4	6.2e-07
WP_002993124.1|900017_900854_-	NAD kinase	NA	NA	NA	NA	NA
WP_002984696.1|900828_901500_-	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	28.9	2.4e-08
WP_002994406.1|901588_902167_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002984700.1|902306_903287_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	33.7	1.1e-36
WP_002994404.1|903283_904411_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	30.1	7.1e-37
WP_002989831.1|904400_904748_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_002984705.1|904999_905644_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002994402.1|905653_906349_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_002984709.1|906350_907031_-	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	24.2	2.5e-13
>prophage 58
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	914170	928973	1702054		Dickeya_phage(16.67%)	15	NA	NA
WP_038431340.1|914170_915502_-	malate permease	NA	A0A140XAH4	Dickeya_phage	55.4	7.4e-17
WP_038431339.1|915662_917204_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002995342.1|917184_917850_+	response regulator	NA	W8CYM9	Bacillus_phage	29.1	7.2e-05
WP_002984738.1|917904_918978_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047236135.1|918970_919747_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023080262.1|919743_920538_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047236136.1|920521_921676_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.8	1.2e-34
WP_002995339.1|921721_922609_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_038431337.1|922740_923259_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_002984761.1|923255_923615_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011528620.1|923630_924422_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.0	8.0e-27
WP_076636747.1|924430_925039_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	50.8	2.2e-45
WP_014635451.1|925049_926327_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_038431334.1|926659_927622_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_080342305.1|927737_928973_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.0	3.2e-14
>prophage 59
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	939481	941131	1702054		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038431325.1|939481_941131_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	1.8e-12
>prophage 60
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	947452	949285	1702054		Tupanvirus(100.0%)	1	NA	NA
WP_002989943.1|947452_949285_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
>prophage 61
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	966594	967584	1702054		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002992006.1|966594_967584_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	25.2	8.2e-13
>prophage 62
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	970906	972670	1702054		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_014407532.1|970906_972670_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.5	1.5e-33
>prophage 63
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	976900	978808	1702054		Tupanvirus(100.0%)	1	NA	NA
WP_038431301.1|976900_978808_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	3.4e-55
>prophage 64
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	981992	986966	1702054		Pithovirus(50.0%)	5	NA	NA
WP_009880825.1|981992_982751_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.0	1.3e-10
WP_002991975.1|982747_983617_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109821051.1|983792_983903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431300.1|983961_984960_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002991968.1|985313_986966_+	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
>prophage 65
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	990197	992944	1702054		Escherichia_phage(66.67%)	3	NA	NA
WP_014635423.1|990197_991238_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.6	5.5e-68
WP_002990099.1|991481_992075_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_014407521.1|992074_992944_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	5.4e-101
>prophage 66
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	996336	999979	1702054		Temperate_phage(33.33%)	3	NA	NA
WP_002984890.1|996336_997020_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_020833433.1|997100_997619_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_020833432.1|997768_999979_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.0	8.7e-71
>prophage 67
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1011683	1019070	1702054		Bacillus_virus(66.67%)	5	NA	NA
WP_038431286.1|1011683_1014143_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.9	7.1e-98
WP_021734029.1|1014233_1016186_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.0	2.5e-122
WP_002984911.1|1016317_1016959_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002994026.1|1017016_1018285_-	dihydroorotase	NA	NA	NA	NA	NA
WP_002984913.1|1018416_1019070_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	40.1	2.3e-40
>prophage 68
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1028069	1038293	1702054	protease	Bacillus_phage(33.33%)	11	NA	NA
WP_014635415.1|1028069_1028879_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.9	3.3e-52
WP_023605079.1|1028862_1029303_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	54.5	5.8e-35
WP_023605078.1|1029321_1030533_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_021733827.1|1030609_1031293_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_021733828.1|1031670_1033770_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.4	5.1e-121
WP_002984942.1|1033827_1034571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984945.1|1034718_1035318_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002984948.1|1035327_1036557_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.5	7.8e-138
WP_002984950.1|1036686_1036857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984955.1|1036876_1037374_-	dihydrofolate reductase	NA	W5QU76	Bacillus_phage	34.4	8.6e-11
WP_011017679.1|1037453_1038293_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.2	1.7e-83
>prophage 69
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1046491	1054494	1702054	transposase,tRNA	Bacillus_phage(25.0%)	8	NA	NA
WP_002984985.1|1046491_1047160_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.8	2.3e-19
WP_011054374.1|1047162_1047813_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_047236142.1|1048032_1050045_+	5'-nucleotidase	NA	NA	NA	NA	NA
WP_002990188.1|1050126_1050537_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	30.6	6.9e-06
WP_002990190.1|1050792_1051011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107114784.1|1051245_1051404_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002990191.1|1051426_1053304_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.7	3.9e-64
WP_074375308.1|1053300_1054494_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.0	4.0e-38
>prophage 70
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1058751	1067287	1702054		Clostridium_botulinum_C_phage(25.0%)	8	NA	NA
WP_002990206.1|1058751_1059459_-	glycoside hydrolase family 73 protein	NA	Q332B8	Clostridium_botulinum_C_phage	36.4	1.9e-11
WP_010922159.1|1059610_1060210_-	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	33.8	3.6e-11
WP_011054367.1|1060302_1062249_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_047236143.1|1062245_1063157_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_038431276.1|1063153_1063867_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.1	1.5e-19
WP_010922156.1|1064122_1065046_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002985048.1|1065058_1066117_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_011054365.1|1066294_1067287_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.9	8.2e-29
>prophage 71
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1078698	1079385	1702054		Planktothrix_phage(100.0%)	1	NA	NA
WP_047236173.1|1078698_1079385_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.4	3.3e-37
>prophage 72
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1084308	1107046	1702054	protease,tRNA	Streptococcus_phage(30.77%)	24	NA	NA
WP_002985087.1|1084308_1085391_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.9	4.7e-62
WP_023609852.1|1085434_1086370_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.6	3.0e-25
WP_004218945.1|1086430_1087690_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	36.2	2.7e-61
WP_002985093.1|1087705_1088227_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_011054355.1|1088621_1089512_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	2.7e-07
WP_002985097.1|1089501_1089960_-	signal peptidase II	NA	NA	NA	NA	NA
WP_002990246.1|1089956_1090871_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002985110.1|1091222_1091516_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002985112.1|1091543_1091870_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002985116.1|1091881_1092196_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011017643.1|1092409_1093702_-	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	30.8	2.9e-34
WP_002985121.1|1093739_1094954_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002985123.1|1094965_1096108_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
WP_014407485.1|1096342_1096783_+	membrane protein	NA	NA	NA	NA	NA
WP_038431265.1|1096812_1098081_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_038431263.1|1098168_1099521_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.3e-29
WP_011054350.1|1099741_1100083_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.3	1.3e-18
WP_002985136.1|1100143_1101310_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1101403_1102090_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1102086_1103250_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_011054348.1|1103357_1105568_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
WP_002985149.1|1105858_1106218_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002985151.1|1106276_1106474_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002985152.1|1106515_1107046_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.8	3.5e-10
>prophage 73
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1113556	1114252	1702054		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_002985169.1|1113556_1114252_-	glycosyltransferase family 2 protein	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	28.2	8.3e-12
>prophage 74
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1119675	1133892	1702054		Staphylococcus_phage(20.0%)	12	NA	NA
WP_002985176.1|1119675_1120881_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.5e-12
WP_010922132.1|1120880_1121642_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002992707.1|1121686_1122619_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002985181.1|1122608_1123763_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_002992705.1|1123881_1124736_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.3	6.8e-32
WP_002990295.1|1124873_1125212_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_002985187.1|1125447_1126557_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	35.1	2.0e-36
WP_023609869.1|1126565_1128344_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	28.6	2.6e-41
WP_020833401.1|1128500_1128875_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_000048058.1|1128990_1129167_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014635388.1|1129307_1130120_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038431734.1|1130259_1133892_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.3	1.6e-21
>prophage 75
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1137254	1138942	1702054		Rhodococcus_phage(50.0%)	2	NA	NA
WP_002993034.1|1137254_1138172_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.0e-33
WP_011285473.1|1138273_1138942_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-30
>prophage 76
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1143581	1144625	1702054	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_038431259.1|1143581_1144625_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	1.0e-29
>prophage 77
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1154658	1158347	1702054		Catovirus(33.33%)	3	NA	NA
WP_002985252.1|1154658_1155681_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
WP_012560579.1|1155694_1157653_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	5.8e-103
WP_002985256.1|1157846_1158347_-	queuosine transporter QueT	NA	E7DN70	Pneumococcus_phage	31.8	5.4e-05
>prophage 78
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1164179	1165103	1702054		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002990429.1|1164179_1165103_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
>prophage 79
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1170893	1180378	1702054		Streptococcus_phage(75.0%)	7	NA	NA
WP_002985288.1|1170893_1172201_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
WP_002990451.1|1172427_1172886_+	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002990455.1|1173017_1174742_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_038431254.1|1175109_1177062_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.3	1.2e-143
WP_023612339.1|1177062_1177623_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002985298.1|1178653_1179001_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_038431732.1|1179115_1180378_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	50.8	1.4e-94
>prophage 80
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1188406	1201967	1702054	tRNA	Streptococcus_phage(57.14%)	11	NA	NA
WP_011054317.1|1188406_1189318_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.0e-105
WP_002985431.1|1189314_1190292_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	2.1e-138
WP_002985434.1|1190288_1191179_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_002985437.1|1191593_1192940_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_011054315.1|1192960_1194154_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_028797137.1|1194488_1196990_-	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.1	1.7e-203
WP_020833379.1|1196999_1197089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021733554.1|1198412_1199177_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_020833376.1|1199344_1200043_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	63.3	2.7e-79
WP_010922049.1|1200352_1201291_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002985455.1|1201274_1201967_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
>prophage 81
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1204972	1209049	1702054		Synechococcus_phage(50.0%)	5	NA	NA
WP_002985463.1|1204972_1205629_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.7	1.2e-12
WP_012560560.1|1205918_1206554_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_014635371.1|1206558_1207560_-	sugar kinase	NA	NA	NA	NA	NA
WP_002985472.1|1207588_1208230_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_014635370.1|1208254_1209049_-	gluconate 5-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	3.1e-18
>prophage 82
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1216278	1220959	1702054		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_011054302.1|1216278_1218960_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.1	6.4e-68
WP_002985505.1|1219189_1219576_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_009880543.1|1219657_1220959_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.3	3.1e-28
>prophage 83
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1225770	1226967	1702054		Hokovirus(100.0%)	1	NA	NA
WP_003054233.1|1225770_1226967_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.2	1.6e-31
>prophage 84
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1231721	1236082	1702054		Streptococcus_phage(33.33%)	5	NA	NA
WP_012560550.1|1231721_1233521_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	36.7	2.2e-109
WP_038431246.1|1233513_1233993_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.0	1.6e-22
WP_002990551.1|1234038_1234422_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_011184321.1|1234405_1234909_-	membrane protein	NA	NA	NA	NA	NA
WP_038431245.1|1235233_1236082_+	glycosyl hydrolase 25 family protein	NA	A0A223LJI5	Bacillus_phage	31.3	1.9e-18
>prophage 85
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1239630	1243210	1702054	tRNA	Tupanvirus(33.33%)	3	NA	NA
WP_038431730.1|1239630_1241124_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	42.0	1.1e-90
WP_002985548.1|1241502_1241715_-	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	46.9	9.0e-10
WP_020833358.1|1241923_1243210_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.6	7.1e-41
>prophage 86
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1262425	1263551	1702054	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_136300775.1|1262425_1263551_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.4	7.6e-31
>prophage 87
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1268780	1271543	1702054		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_009880291.1|1268780_1268990_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	63.1	4.4e-17
WP_002990649.1|1269092_1270301_-	MFS transporter	NA	NA	NA	NA	NA
WP_009880289.1|1270385_1271543_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	M1GX70	Paramecium_bursaria_Chlorella_virus	40.8	1.4e-75
>prophage 88
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1283780	1287773	1702054		Bacillus_phage(50.0%)	4	NA	NA
WP_002985639.1|1283780_1284473_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	34.7	3.8e-25
WP_002985641.1|1284904_1285714_-	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	37.4	4.8e-35
WP_002985643.1|1285717_1287070_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	35.0	4.7e-35
WP_002985645.1|1287062_1287773_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.0	3.7e-39
>prophage 89
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1293728	1304125	1702054	tRNA	Brazilian_cedratvirus(25.0%)	9	NA	NA
WP_011054266.1|1293728_1294721_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	8.2e-13
WP_012560525.1|1294861_1296805_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.9	2.1e-121
WP_002985676.1|1297226_1298561_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985678.1|1298562_1299561_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985680.1|1299691_1300693_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.5	6.1e-24
WP_012560524.1|1300866_1301952_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012560523.1|1302000_1302666_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002985686.1|1302676_1303054_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011017477.1|1303198_1304125_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.5	2.0e-77
>prophage 90
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1307483	1315230	1702054		Staphylococcus_phage(25.0%)	8	NA	NA
WP_002994152.1|1307483_1307951_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.0	5.7e-41
WP_080281949.1|1307953_1310287_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.8	6.7e-90
WP_002985700.1|1310380_1310617_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002990729.1|1310662_1310809_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011285425.1|1310805_1311999_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_038431229.1|1312120_1313623_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.6	1.5e-74
WP_011017469.1|1313812_1314406_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_038431228.1|1314402_1315230_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.5	1.1e-15
>prophage 91
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1321181	1377188	1702054	protease,bacteriocin,tRNA	Streptococcus_phage(33.33%)	58	NA	NA
WP_002985729.1|1321181_1321382_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_038431726.1|1321394_1321622_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|1322816_1322999_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_038431225.1|1323013_1323259_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011184258.1|1323656_1323911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985741.1|1324216_1324693_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1324712_1325609_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1325728_1326136_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985748.1|1326116_1326614_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011284574.1|1326772_1327348_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_010921967.1|1327393_1328446_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_014635330.1|1328604_1330377_-	oleate hydratase	NA	NA	NA	NA	NA
WP_038431224.1|1330691_1331861_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.5e-16
WP_023605032.1|1332016_1332232_-	YozE family protein	NA	NA	NA	NA	NA
WP_023605031.1|1332228_1332738_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011106872.1|1332810_1333668_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002985763.1|1333776_1334334_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1334362_1335091_-	UMP kinase	NA	NA	NA	NA	NA
WP_038431223.1|1335413_1336103_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1336208_1336634_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_030126115.1|1336877_1337231_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_014635327.1|1337300_1339706_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_002990808.1|1339922_1340729_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_011017448.1|1340876_1341731_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985780.1|1341731_1342457_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_004218965.1|1342520_1343453_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014635325.1|1343598_1344246_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_020833308.1|1344344_1344686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833307.1|1344836_1345532_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002985791.1|1345551_1345803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985793.1|1345802_1346357_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_047236152.1|1346390_1347773_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	8.5e-32
WP_002985796.1|1347946_1349284_-	MFS transporter	NA	NA	NA	NA	NA
WP_038431221.1|1349616_1350576_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_038431220.1|1350651_1351350_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	1.6e-10
WP_002990844.1|1351342_1351579_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_021733635.1|1351939_1352671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340584.1|1352764_1353016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184229.1|1353203_1353644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431219.1|1354100_1354853_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_038431218.1|1355056_1357237_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.2	1.2e-170
WP_002990870.1|1357203_1357692_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_010921941.1|1357695_1358709_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.7	2.5e-97
WP_080342303.1|1359204_1361205_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.0	7.8e-87
WP_002985820.1|1361444_1362152_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_038431722.1|1362254_1362434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431216.1|1362924_1367865_-|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_011184221.1|1368130_1369318_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_038431215.1|1369545_1370373_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	1.7e-128
WP_014407341.1|1370446_1370803_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_009880724.1|1371101_1371731_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1371777_1372170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021733048.1|1372196_1373060_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	3.8e-115
WP_002985838.1|1373064_1373388_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_047236154.1|1374050_1374926_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.6	4.1e-72
WP_014635306.1|1374943_1375579_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.0e-65
WP_002985847.1|1375827_1376103_-	YlbG family protein	NA	NA	NA	NA	NA
WP_002985850.1|1376597_1377188_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
>prophage 92
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1381621	1393899	1702054	tRNA	Staphylococcus_phage(42.86%)	14	NA	NA
WP_011054216.1|1381621_1382404_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	29.7	9.7e-17
WP_002995851.1|1382429_1383362_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047236174.1|1383372_1384404_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.1	4.4e-17
WP_047236155.1|1384364_1385402_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	30.0	4.3e-20
WP_047236156.1|1385446_1386100_-	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002990948.1|1386175_1387111_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_010921923.1|1387241_1388033_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	29.0	5.9e-22
WP_002995844.1|1388110_1389445_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002985878.1|1389577_1390132_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	41.7	8.6e-36
WP_002990957.1|1390170_1391091_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	50.4	2.9e-36
WP_023610381.1|1391383_1392037_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002990963.1|1392038_1392602_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002995840.1|1392912_1393461_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010921920.1|1393638_1393899_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	50.0	1.9e-17
>prophage 93
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1409194	1421372	1702054	protease	Bacillus_phage(40.0%)	10	NA	NA
WP_009880402.1|1409194_1412293_-	DEAD/DEAH box helicase	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	31.3	9.7e-44
WP_002991013.1|1412499_1413810_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002991016.1|1413872_1414775_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.2	3.0e-30
WP_009880401.1|1414775_1415951_-	Replication initiation/membrane attachment protein	NA	NA	NA	NA	NA
WP_002985941.1|1415934_1416429_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002991036.1|1416643_1418146_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.4e-24
WP_002991052.1|1418151_1418838_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	5.1e-30
WP_021733994.1|1419104_1419641_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002985953.1|1419871_1420768_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_038431211.1|1420814_1421372_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	27.6	4.8e-10
>prophage 94
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1427998	1429063	1702054		Planktothrix_phage(100.0%)	1	NA	NA
WP_011184185.1|1427998_1429063_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	1.4e-29
>prophage 95
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1435846	1436479	1702054		Bacillus_virus(100.0%)	1	NA	NA
WP_031488555.1|1435846_1436479_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	34.8	1.1e-21
>prophage 96
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1448116	1453894	1702054		Staphylococcus_phage(66.67%)	3	NA	NA
WP_014635700.1|1448116_1451095_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	21.9	1.7e-24
WP_014635701.1|1451107_1452301_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.3	9.6e-16
WP_014407840.1|1452313_1453894_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.2	1.2e-119
>prophage 97
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1458542	1459810	1702054		Planktothrix_phage(50.0%)	2	NA	NA
WP_009880388.1|1458542_1459280_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.1e-27
WP_079891399.1|1459276_1459810_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.8	1.3e-12
>prophage 98
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1469079	1473666	1702054	integrase	Escherichia_phage(33.33%)	8	1465217:1465230	1476705:1476718
1465217:1465230	attL	AAGATAAAGATACT	NA	NA	NA	NA
WP_009880844.1|1469079_1469853_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	4.3e-17
WP_047236158.1|1470513_1470804_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_009880846.1|1470793_1471129_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011285716.1|1471280_1471463_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_111679863.1|1471864_1472215_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	41.4	1.9e-12
WP_002982716.1|1472382_1472775_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002982710.1|1472795_1473242_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002982695.1|1473459_1473666_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	56.1	2.3e-10
1476705:1476718	attR	AGTATCTTTATCTT	NA	NA	NA	NA
>prophage 99
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1478167	1479511	1702054	tRNA	Catovirus(100.0%)	1	NA	NA
WP_009880545.1|1478167_1479511_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.3	2.9e-53
>prophage 100
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1483994	1484726	1702054		Synechococcus_phage(100.0%)	1	NA	NA
WP_009880549.1|1483994_1484726_-	transaldolase	NA	H8ZNI7	Synechococcus_phage	32.6	2.5e-14
>prophage 101
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1489985	1501438	1702054	protease,tRNA	Synechococcus_phage(25.0%)	8	NA	NA
WP_047236159.1|1489985_1490600_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.8e-13
WP_038431597.1|1490633_1491176_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038431598.1|1491306_1491735_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038431599.1|1491844_1496242_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.7e-17
WP_011184986.1|1496495_1498352_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	24.6	4.1e-05
WP_038431604.1|1498549_1499809_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_038431605.1|1499881_1500676_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002988029.1|1500688_1501438_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.7	7.3e-22
>prophage 102
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1508063	1509197	1702054		Bacillus_virus(100.0%)	1	NA	NA
WP_002993686.1|1508063_1509197_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.9	1.1e-24
>prophage 103
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1512560	1514780	1702054		Vibrio_phage(100.0%)	1	NA	NA
WP_002993702.1|1512560_1514780_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1S6L1R3	Vibrio_phage	39.5	8.9e-07
>prophage 104
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1518532	1520719	1702054		Vibrio_phage(100.0%)	1	NA	NA
WP_038431621.1|1518532_1520719_-	PTS glucose/maltose transporter subunit IIBCA	NA	A0A2I7SAJ6	Vibrio_phage	41.8	2.5e-06
>prophage 105
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1525653	1530586	1702054		Pandoravirus(25.0%)	4	NA	NA
WP_023610186.1|1525653_1527411_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	30.3	2.4e-39
WP_010922701.1|1527443_1528010_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	9.1e-33
WP_011018264.1|1528042_1529311_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.1	1.5e-96
WP_023610175.1|1529884_1530586_+	streptococcal mitogenic exotoxin SmeZ	NA	A0EX09	Staphylococcus_phage	35.7	2.1e-15
>prophage 106
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1534862	1536557	1702054		Anomala_cuprea_entomopoxvirus(33.33%)	3	NA	NA
WP_003059481.1|1534862_1535666_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	6.5e-08
WP_002993600.1|1535649_1536276_+	ABC transporter ATP-binding protein	NA	A0A2H4P6Z4	Pseudomonas_phage	26.6	1.2e-06
WP_002982507.1|1536356_1536557_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	86.4	1.3e-21
>prophage 107
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1552277	1558044	1702054		Staphylococcus_phage(25.0%)	5	NA	NA
WP_038431639.1|1552277_1553906_-	CHAP domain-containing protein	NA	A0A1P8CMP9	Staphylococcus_phage	44.6	4.5e-08
WP_002982466.1|1554007_1555396_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.7	1.6e-09
WP_002991237.1|1555392_1556046_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	2.7e-28
WP_038431640.1|1556139_1557357_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002982458.1|1557369_1558044_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.4e-32
>prophage 108
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1566158	1572172	1702054		Streptococcus_phage(25.0%)	5	NA	NA
WP_010922721.1|1566158_1566974_-	streptodornase B	NA	A7J2B8	Streptococcus_phage	33.3	6.7e-29
WP_002982381.1|1567337_1567847_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.5	1.4e-37
WP_002992097.1|1567928_1569017_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_038431648.1|1569073_1569742_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	33.6	6.3e-25
WP_038431650.1|1569754_1572172_-	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
>prophage 109
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1576507	1577281	1702054		Escherichia_phage(100.0%)	1	NA	NA
WP_002992110.1|1576507_1577281_+	glycyl-radical enzyme activating protein	NA	A0A0U2DAM7	Escherichia_phage	36.2	3.8e-05
>prophage 110
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1581422	1582241	1702054		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_014635762.1|1581422_1582241_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.6	3.1e-05
>prophage 111
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1586899	1595428	1702054	protease	uncultured_virus(25.0%)	7	NA	NA
WP_038431659.1|1586899_1588531_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	2.3e-153
WP_002991292.1|1588566_1588857_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_038431661.1|1589034_1591479_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	38.9	2.7e-121
WP_038431663.1|1591478_1591940_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002991299.1|1592135_1592339_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	80.0	6.1e-24
WP_002982304.1|1593314_1593875_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011889205.1|1593895_1595428_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	37.5	1.4e-43
>prophage 112
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1604579	1606121	1702054		Catovirus(100.0%)	1	NA	NA
WP_002992811.1|1604579_1606121_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.4	9.0e-99
>prophage 113
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1612810	1614706	1702054		Klosneuvirus(100.0%)	1	NA	NA
WP_038431669.1|1612810_1614706_-	endopeptidase	NA	A0A1V0SHG2	Klosneuvirus	27.7	2.0e-68
>prophage 114
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1621260	1626788	1702054		Enterococcus_phage(66.67%)	5	NA	NA
WP_047236167.1|1621260_1621992_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	36.5	6.2e-34
WP_002982219.1|1622165_1622780_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.7	1.5e-52
WP_002991345.1|1622779_1623289_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002992828.1|1623297_1624233_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002992831.1|1624589_1626788_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.9	2.6e-277
>prophage 115
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1630662	1651409	1702054	bacteriocin,tRNA	Streptococcus_phage(22.22%)	20	NA	NA
WP_002992179.1|1630662_1631799_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	1.4e-120
WP_002992182.1|1631887_1633159_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_002992183.1|1633227_1633788_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002992186.1|1633797_1634394_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002992187.1|1634395_1635616_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.6	3.5e-05
WP_038431672.1|1635626_1637609_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	5.1e-62
WP_002993100.1|1637737_1640293_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.3	5.2e-43
WP_002982173.1|1640279_1640486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431673.1|1640628_1641066_-	arginine repressor	NA	NA	NA	NA	NA
WP_002993104.1|1641356_1643048_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	1.9e-73
WP_002993106.1|1643135_1643444_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002982164.1|1643470_1644343_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.6	2.1e-52
WP_002991372.1|1644385_1645264_-	YitT family protein	NA	NA	NA	NA	NA
WP_002993108.1|1645283_1646225_-	YitT family protein	NA	NA	NA	NA	NA
WP_014635787.1|1646217_1647966_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.6	2.7e-11
WP_038431674.1|1648303_1649584_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.9	1.4e-25
WP_000290414.1|1649803_1649986_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002982147.1|1650002_1650152_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011285293.1|1650432_1651059_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002995294.1|1651070_1651409_+	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	33.3	1.0e-10
>prophage 116
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1663564	1664932	1702054		Streptococcus_phage(100.0%)	1	NA	NA
WP_010922787.1|1663564_1664932_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.7	1.0e-154
>prophage 117
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1673977	1694371	1702054	tRNA	Streptococcus_phage(20.0%)	18	NA	NA
WP_002982071.1|1673977_1674592_-	transglycosylase SLT domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	74.1	4.7e-27
WP_002982068.1|1674962_1675763_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002982066.1|1675755_1676598_-	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.8e-16
WP_011018337.1|1676573_1677464_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-20
WP_002992390.1|1677414_1677957_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011055110.1|1677970_1678996_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002982050.1|1679045_1680335_-	insulinase family protein	NA	A0A0G2Y5U8	Acanthamoeba_polyphaga_mimivirus	31.4	3.3e-14
WP_011055112.1|1680336_1681581_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	38.9	1.8e-86
WP_038431685.1|1682019_1683279_+	hyaluronan synthase HasA	NA	NA	NA	NA	NA
WP_002992300.1|1683314_1684523_+	UDP-glucose 6-dehydrogenase HasB	NA	M1HM57	Paramecium_bursaria_Chlorella_virus	46.8	1.5e-96
WP_002982024.1|1684704_1685619_+	UTP--glucose-1-phosphate uridylyltransferase HasC	NA	A0A127AW70	Bacillus_phage	51.5	6.3e-76
WP_010922800.1|1685926_1686340_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	72.0	1.5e-21
WP_014635799.1|1686341_1687448_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_047236168.1|1687504_1688368_-	sugar transporter	NA	NA	NA	NA	NA
WP_002991454.1|1688570_1690052_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	3.4e-95
WP_002991455.1|1690359_1691382_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002982011.1|1691800_1692673_+	YitT family protein	NA	NA	NA	NA	NA
WP_038431711.1|1692751_1694371_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	2.1e-45
>prophage 118
NZ_CP007562	Streptococcus pyogenes strain NGAS327, complete genome	1702054	1697902	1701191	1702054	transposase	Staphylococcus_prophage(50.0%)	3	NA	NA
WP_020837855.1|1697902_1698889_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	3.3e-38
WP_038431713.1|1699277_1699757_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002994926.1|1699967_1701191_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	2.6e-16
