The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	0	2851	1791306		Rhizobium_phage(100.0%)	2	NA	NA
WP_002987659.1|204_1560_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_002987661.1|1714_2851_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	24.9	1.2e-23
>prophage 2
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	10922	14757	1791306	tRNA	Phaeocystis_globosa_virus(50.0%)	3	NA	NA
WP_012560360.1|10922_12209_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	25.8	1.2e-16
WP_002981912.1|12213_12756_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002981901.1|12777_14757_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	47.2	8.8e-107
>prophage 3
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	29776	58262	1791306		Streptococcus_phage(21.43%)	23	NA	NA
WP_110002949.1|29776_29980_-	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	52.2	2.3e-07
WP_111687937.1|30138_30420_-	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	43.0	2.3e-08
WP_012560362.1|31166_32363_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_009880326.1|32615_33578_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	8.2e-42
WP_023611321.1|33763_34519_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_047235602.1|34621_35629_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002986713.1|35621_35864_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_011284401.1|35984_36719_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	40.1	6.7e-44
WP_047235603.1|36842_40568_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.9	4.6e-40
WP_047235604.1|40728_42183_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	1.7e-54
WP_002987707.1|42210_43233_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	4.0e-63
WP_002987709.1|43400_43955_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_023612984.1|44138_45686_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_002986694.1|45744_46869_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_032467308.1|47121_48387_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48664_49156_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
WP_080262123.1|49106_50216_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_023612869.1|51935_53228_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	1.4e-17
WP_014635220.1|53361_54273_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002986679.1|54492_55491_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	1.0e-07
WP_002994668.1|55628_56066_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_047235605.1|56088_56490_+	membrane protein	NA	NA	NA	NA	NA
WP_002987732.1|56486_58262_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.2	4.0e-18
>prophage 4
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	61464	62481	1791306		Tupanvirus(100.0%)	1	NA	NA
WP_020904823.1|61464_62481_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.9	6.7e-26
>prophage 5
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	88305	101511	1791306	tRNA	Bacillus_virus(25.0%)	7	NA	NA
WP_010921791.1|88305_89025_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.3e-15
WP_021340473.1|89017_89833_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_047235609.1|89872_90256_-	HIT family protein	NA	NA	NA	NA	NA
WP_047235610.1|90306_91563_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.5	6.4e-71
WP_002987769.1|91654_93967_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002986567.1|94230_97797_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.0	1.2e-50
WP_047235611.1|97887_101511_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.6	1.6e-66
>prophage 6
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	108622	113663	1791306	tRNA	Streptococcus_phage(66.67%)	8	NA	NA
WP_032464773.1|108622_109393_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.0	6.2e-32
WP_032464774.1|109440_110508_-	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002986521.1|110617_110782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002992749.1|110972_111257_+	DUF4651 domain-containing protein	NA	NA	NA	NA	NA
WP_002986515.1|111253_111571_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_023613126.1|111588_112215_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_003053955.1|112366_112762_+	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	46.2	1.3e-25
WP_023613129.1|113021_113663_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	49.5	3.1e-53
>prophage 7
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	149364	154618	1791306		Streptococcus_phage(50.0%)	4	NA	NA
WP_023610867.1|149364_150627_-	toxic anion resistance protein TelA	NA	M1PLC8	Streptococcus_phage	67.9	1.5e-147
WP_014635244.1|150639_151518_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	40.2	1.7e-25
WP_011284453.1|151955_153248_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.5	4.3e-70
WP_080343570.1|153589_154618_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	40.5	2.2e-61
>prophage 8
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	161965	165817	1791306	tRNA	Pandoravirus(50.0%)	2	NA	NA
WP_011017287.1|161965_163105_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	29.5	4.4e-18
WP_047235628.1|163315_165817_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
>prophage 9
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	174661	184069	1791306		Bacillus_virus(25.0%)	8	NA	NA
WP_023605215.1|174661_175858_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	6.9e-30
WP_002986341.1|175873_177601_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047235631.1|177731_180374_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	35.9	1.5e-64
WP_002986334.1|180560_181016_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002986328.1|181067_181535_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_009880534.1|181690_181990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047235632.1|182211_183546_+	phosphoadenosine phosphosulfate reductase	NA	L0P6Z6	Lactobacillus_phage	39.7	4.0e-87
WP_002987925.1|183538_184069_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	68.6	7.1e-64
>prophage 10
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	188331	191985	1791306	transposase,tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_080343573.1|188331_189564_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.8	2.6e-64
WP_047235635.1|189760_190624_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002986321.1|190660_190846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528208.1|190842_191985_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	3.8e-86
>prophage 11
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	203883	211506	1791306		Bacillus_phage(75.0%)	7	NA	NA
WP_002986125.1|203883_204783_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	9.6e-77
WP_002986123.1|204815_205832_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002986120.1|206129_206579_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031488680.1|206571_208278_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-36
WP_047235639.1|208280_210065_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	7.3e-44
WP_011054158.1|210182_210950_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_002986111.1|211059_211506_+	dUTP diphosphatase	NA	A0A1P8BLJ0	Lactococcus_phage	52.8	4.5e-35
>prophage 12
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	214656	216102	1791306	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_047235640.1|214656_216102_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L481	Tupanvirus	31.2	5.2e-08
>prophage 13
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	238819	239659	1791306		Streptococcus_phage(100.0%)	1	NA	NA
WP_002992072.1|238819_239659_+	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	30.8	1.4e-05
>prophage 14
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	243866	248527	1791306		Streptococcus_phage(50.0%)	4	NA	NA
WP_002986045.1|243866_245945_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.7	1.6e-63
WP_002986042.1|246292_247303_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000818733.1|247528_247645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002991131.1|247786_248527_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.4e-25
>prophage 15
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	255320	261915	1791306		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_002986023.1|255320_256091_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	26.4	1.8e-07
WP_047235656.1|256185_257448_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011054183.1|257478_258705_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.8	7.9e-106
WP_002986018.1|258691_259171_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_002986015.1|259163_260582_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_047235657.1|260733_261915_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	5.4e-11
>prophage 16
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	268117	270104	1791306		Bacillus_virus(50.0%)	2	NA	NA
WP_009880666.1|268117_269188_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	4.0e-13
WP_002986000.1|269180_270104_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.2e-21
>prophage 17
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	283253	284858	1791306		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_002988149.1|283253_284858_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.4	5.4e-139
>prophage 18
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	290165	291056	1791306		Klosneuvirus(100.0%)	1	NA	NA
WP_023612377.1|290165_291056_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	37.0	8.7e-38
>prophage 19
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	296392	300734	1791306	tRNA	Cellulophaga_phage(50.0%)	5	NA	NA
WP_047235664.1|296392_298075_-	ribonuclease J	NA	S0A5H7	Cellulophaga_phage	31.3	1.5e-06
WP_002982907.1|298076_298307_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002992279.1|298590_299289_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011106599.1|299290_299716_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002988178.1|299705_300734_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.7	2.5e-57
>prophage 20
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	305189	313690	1791306		Staphylococcus_phage(40.0%)	11	NA	NA
WP_047235667.1|305189_306359_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	53.0	5.5e-16
WP_030126283.1|306619_306958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030126284.1|307025_309008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020905458.1|309004_309628_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.0	7.2e-23
WP_014407827.1|309624_310116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011184937.1|310268_310850_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_011285141.1|310859_311486_+	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	28.7	3.4e-12
WP_011018201.1|311638_312376_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010922643.1|312432_312732_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002992262.1|312924_313299_-	helix-turn-helix transcriptional regulator	NA	A0A097BY95	Leuconostoc_phage	51.6	2.1e-17
WP_002988211.1|313468_313690_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	41.2	4.8e-06
>prophage 21
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	318467	319415	1791306		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_011018197.1|318467_319415_+	aquaporin family protein	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	33.3	2.1e-26
>prophage 22
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	322809	348556	1791306		Bacillus_phage(20.0%)	26	NA	NA
WP_047235669.1|322809_325137_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	33.4	4.2e-116
WP_047235670.1|325346_326441_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_023612380.1|326533_327016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235671.1|327106_329560_-	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	28.6	1.9e-58
WP_002983074.1|329617_330211_-	signal peptidase I	NA	NA	NA	NA	NA
WP_020905449.1|330221_331124_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_002993251.1|331280_331589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983087.1|331591_332137_+	CvpA family protein	NA	NA	NA	NA	NA
WP_047235672.1|332285_334625_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	47.7	2.8e-19
WP_021775467.1|334628_335129_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011018190.1|335209_335524_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.3	5.1e-17
WP_047235673.1|335575_336163_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_030126906.1|336339_337464_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	1.3e-22
WP_002983113.1|337661_337955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983117.1|338127_338418_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002983122.1|338439_338931_+	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
WP_002983142.1|339095_339335_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002983144.1|339467_340124_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983147.1|340256_341201_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_047235674.1|341403_344232_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	1.7e-305
WP_047235675.1|344347_345421_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.8	7.8e-17
WP_047235676.1|345455_345917_+	competence protein ComE	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
WP_002988496.1|346012_346570_+	elongation factor P	NA	NA	NA	NA	NA
WP_002983163.1|346615_347005_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002988501.1|346997_347450_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_014635676.1|347590_348556_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	8.0e-21
>prophage 23
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	361924	364641	1791306		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_010922619.1|361924_363025_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.0	2.0e-31
WP_047235684.1|363111_364641_+	CHAP domain-containing protein	NA	W5R8Q8	Staphylococcus_phage	41.7	2.6e-05
>prophage 24
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	370899	385912	1791306		Organic_Lake_phycodnavirus(28.57%)	12	NA	NA
WP_002995381.1|370899_371922_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	2.0e-14
WP_002983221.1|371918_372755_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.9e-17
WP_023611724.1|372751_374515_+	ABC transporter ATP-binding protein/permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	1.7e-21
WP_047235687.1|374507_376178_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.1	9.9e-19
WP_002983234.1|376174_376768_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002983239.1|376764_377445_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_023611719.1|377441_378836_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	2.6e-12
WP_002983248.1|379210_381226_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_002991995.1|381518_382421_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	3.9e-38
WP_047235688.1|382433_383138_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047235689.1|383486_384452_-	asparaginase	NA	NA	NA	NA	NA
WP_002992572.1|384523_385912_+	Cof-type HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	37.1	2.1e-22
>prophage 25
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	389077	389632	1791306		Bacillus_virus(100.0%)	1	NA	NA
WP_002983281.1|389077_389632_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.5	2.0e-24
>prophage 26
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	398822	402066	1791306		Powai_lake_megavirus(50.0%)	2	NA	NA
WP_002983316.1|398822_400649_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.5	1.1e-130
WP_002993772.1|400929_402066_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	27.3	2.8e-17
>prophage 27
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	406972	407707	1791306		Bacillus_phage(100.0%)	1	NA	NA
WP_011018156.1|406972_407707_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	W8CYX9	Bacillus_phage	40.8	1.1e-06
>prophage 28
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	413145	414423	1791306	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002983351.1|413145_414423_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.0	4.7e-93
>prophage 29
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	419533	420994	1791306		Moraxella_phage(100.0%)	1	NA	NA
WP_012560892.1|419533_420994_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	28.6	1.2e-36
>prophage 30
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	424354	425080	1791306		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002983379.1|424354_425080_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-20
>prophage 31
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	430360	438926	1791306		Cafeteria_roenbergensis_virus(33.33%)	8	NA	NA
WP_047235697.1|430360_433222_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.2	4.5e-19
WP_003062050.1|433421_433778_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_021733873.1|433911_434898_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011054926.1|435069_435504_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_080343575.1|435533_437735_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.4	2.4e-113
WP_002994306.1|437748_437952_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011184859.1|437958_438129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983505.1|438155_438926_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	6.4e-21
>prophage 32
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	445786	452390	1791306		Streptococcus_phage(50.0%)	6	NA	NA
WP_010922569.1|445786_446344_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	60.3	3.2e-14
WP_002983528.1|446636_447479_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	61.9	1.3e-91
WP_030126332.1|447607_448330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988856.1|448531_450163_+	Na/Pi cotransporter family protein	NA	A0A1B1ITU5	uncultured_Mediterranean_phage	38.8	2.7e-05
WP_047235699.1|450280_451429_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_047235700.1|451550_452390_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.4e-50
>prophage 33
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	461430	462132	1791306		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002988870.1|461430_462132_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	37.5	5.2e-30
>prophage 34
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	465201	473038	1791306	bacteriocin	Streptococcus_phage(50.0%)	7	NA	NA
WP_002983569.1|465201_465846_+	fructose-6-phosphate aldolase	NA	A0A0C5AMY8	Cyanophage	44.2	2.2e-43
WP_047236076.1|466064_468050_+	transketolase	NA	NA	NA	NA	NA
WP_002983572.1|468241_468508_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002988881.1|468541_469276_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	3.3e-27
WP_047235705.1|469280_470909_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002988886.1|470973_471795_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.8	4.7e-38
WP_047235706.1|471787_473038_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.1	4.5e-117
>prophage 35
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	478273	491413	1791306		Bacillus_virus(42.86%)	11	NA	NA
WP_047235708.1|478273_479617_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	28.4	3.0e-42
WP_002983600.1|479811_480615_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_047235709.1|480614_481358_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	6.1e-29
WP_002994231.1|481461_481686_+	DUF4059 family protein	NA	NA	NA	NA	NA
WP_047235710.1|481749_482667_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.2	2.6e-90
WP_047235711.1|482835_484215_+	amino acid permease	NA	NA	NA	NA	NA
WP_047235712.1|484384_485845_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.8	2.7e-97
WP_047235713.1|485841_486666_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.8	7.2e-71
WP_047235714.1|486850_488188_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	37.0	1.4e-68
WP_047235715.1|488652_490818_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002983622.1|490804_491413_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.9	3.2e-23
>prophage 36
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	497638	519686	1791306	tRNA	Streptococcus_phage(33.33%)	21	NA	NA
WP_002983637.1|497638_498418_-	3-hydroxybutyrate dehydrogenase	NA	G8EDD5	Acanthamoeba_castellanii_mamavirus	26.3	4.1e-07
WP_030126348.1|498450_499110_-	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_002988948.1|499111_499762_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011528859.1|499785_500973_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_014407745.1|501078_502023_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	1.5e-08
WP_002988954.1|502196_503804_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_002983649.1|503913_504549_+	guanylate kinase	NA	S4VT50	Pandoravirus	45.3	4.9e-11
WP_002983650.1|504564_504882_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_047235719.1|504946_507331_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002988958.1|507392_508328_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
WP_047235720.1|508317_509640_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002983660.1|509677_510418_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_047235721.1|510414_512322_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	B5LWE2	Feldmannia_species_virus	30.7	1.4e-21
WP_002983667.1|512393_513137_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002991890.1|513133_514138_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_047235722.1|514130_514772_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023079249.1|514808_516209_+	bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.5	5.4e-26
WP_009880466.1|516208_516586_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009880467.1|516603_517545_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	77.2	1.7e-129
WP_009880468.1|517672_518305_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.3	3.2e-63
WP_047235723.1|518360_519686_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	51.1	1.8e-116
>prophage 37
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	530227	531583	1791306		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_012560848.1|530227_531583_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.0	1.1e-73
>prophage 38
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	548093	549818	1791306		Enterobacteria_phage(100.0%)	1	NA	NA
WP_023605192.1|548093_549818_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.9	2.6e-14
>prophage 39
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	557894	558968	1791306		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_047235733.1|557894_558968_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	31.9	1.6e-30
>prophage 40
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	562089	564738	1791306	tRNA	Catovirus(100.0%)	1	NA	NA
WP_047235735.1|562089_564738_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.2	1.1e-149
>prophage 41
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	576163	578634	1791306		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_047235742.1|576163_576904_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	33.3	6.2e-05
WP_047235743.1|576900_578634_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.2	2.3e-26
>prophage 42
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	589358	593909	1791306		Heterosigma_akashiwo_virus(33.33%)	5	NA	NA
WP_002983817.1|589358_590351_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.5	2.4e-52
WP_002983819.1|590473_591013_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_002983821.1|591002_591494_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	33.8	2.0e-15
WP_047235746.1|591480_592518_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_002994809.1|592931_593909_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.9	3.6e-21
>prophage 43
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	599425	601267	1791306		Streptococcus_phage(100.0%)	1	NA	NA
WP_002983847.1|599425_601267_+	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	31.4	2.0e-20
>prophage 44
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	611936	626280	1791306	protease,tRNA	Moumouvirus(14.29%)	11	NA	NA
WP_047235754.1|611936_614738_+|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.9	7.1e-70
WP_002983878.1|615002_615305_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002989103.1|615355_615811_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_047235755.1|615938_618221_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.2	4.1e-124
WP_002983885.1|618518_618749_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_047235756.1|618875_619562_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989107.1|619561_620296_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_002993337.1|620444_621854_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	5.7e-60
WP_002993334.1|622031_623726_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_047235757.1|623932_624787_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.6e-39
WP_031488537.1|624939_626280_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	1.1e-39
>prophage 45
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	631633	637689	1791306		Staphylococcus_phage(25.0%)	6	NA	NA
WP_080343576.1|631633_632473_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
WP_011184743.1|632447_633308_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989129.1|633285_633873_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|633971_634247_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
WP_047235759.1|634591_636454_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.1	2.4e-90
WP_047235760.1|636753_637689_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	1.3e-65
>prophage 46
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	646001	658423	1791306	tRNA	Streptococcus_phage(33.33%)	10	NA	NA
WP_047235763.1|646001_647546_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	8.3e-36
WP_047235764.1|647852_649472_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_023612776.1|649598_651599_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	5.8e-66
WP_002989164.1|651622_651901_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_080251042.1|651890_652667_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_079891393.1|652706_653525_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002983967.1|653723_654386_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_047235765.1|654366_656610_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.7	9.8e-54
WP_011054659.1|656680_657721_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_002983977.1|657817_658423_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	1.8e-58
>prophage 47
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	668425	673256	1791306	tRNA	Mycobacterium_phage(50.0%)	3	NA	NA
WP_047235770.1|668425_669133_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	8.8e-09
WP_047235771.1|669195_670251_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_047235772.1|670637_673256_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	1.1e-61
>prophage 48
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	677935	681496	1791306		Enterococcus_phage(100.0%)	3	NA	NA
WP_002987365.1|677935_678895_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
WP_002984018.1|679098_681258_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	64.0	8.6e-265
WP_002989242.1|681277_681496_-	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
>prophage 49
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	686980	692307	1791306	protease	Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	6	NA	NA
WP_047235777.1|686980_688066_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	2.1e-33
WP_002984060.1|688163_688790_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_002989257.1|688869_689133_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002989260.1|689185_689995_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_047235778.1|690139_690637_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011184646.1|690636_692307_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.6	6.6e-47
>prophage 50
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	696639	697836	1791306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002989292.1|696639_697836_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
>prophage 51
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	707863	710188	1791306		Streptococcus_phi-m46.1-like_phage(100.0%)	2	NA	NA
WP_033888380.1|707863_709255_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	98.7	3.7e-261
WP_080343542.1|709573_710188_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	96.5	5.2e-90
>prophage 52
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	715236	716469	1791306	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_080343578.1|715236_716469_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.8	2.6e-64
>prophage 53
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	727046	727787	1791306		Planktothrix_phage(100.0%)	1	NA	NA
WP_002984187.1|727046_727787_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.5e-35
>prophage 54
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	732563	734102	1791306		Tupanvirus(100.0%)	1	NA	NA
WP_002984203.1|732563_734102_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.2	5.0e-41
>prophage 55
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	743305	755750	1791306		Enterobacteria_phage(20.0%)	9	NA	NA
WP_002992583.1|743305_744325_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	5.7e-17
WP_023611443.1|744439_745933_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_014407632.1|745967_748232_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_011888831.1|748488_749109_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_002989607.1|749849_750464_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
WP_011017835.1|750590_751376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984437.1|751385_752084_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002989617.1|752083_752455_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047235786.1|752639_755750_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	29.3	2.4e-119
>prophage 56
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	759358	763091	1791306		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_002984451.1|759358_761173_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.9	5.2e-98
WP_002989626.1|761368_761704_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002992417.1|761810_762452_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002984457.1|762461_763091_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
>prophage 57
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	768661	776037	1791306		Bacillus_phage(33.33%)	10	NA	NA
WP_011284831.1|768661_770980_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	2.7e-131
WP_002984469.1|771341_771590_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002984470.1|771626_772238_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_011888836.1|772248_772437_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984475.1|772449_772989_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|773029_773230_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984478.1|773237_773729_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984480.1|773891_774533_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984482.1|774675_775218_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989664.1|775335_776037_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
>prophage 58
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	782808	808125	1791306		Bacillus_virus(27.27%)	25	NA	NA
WP_002984494.1|782808_783741_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.6	6.4e-07
WP_002984496.1|783783_784188_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_047235791.1|784189_784468_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_002984499.1|784457_785246_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_047235792.1|785248_786559_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_002989684.1|786697_787564_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	M1U9L0	Synechococcus_phage	24.2	1.0e-06
WP_047235793.1|787574_788510_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002989688.1|788499_789387_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002984509.1|789402_790206_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.9e-15
WP_002993892.1|790218_790977_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.8e-15
WP_002984514.1|791044_791698_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_047235794.1|791902_794440_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.9	2.5e-74
WP_002984519.1|794786_795461_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011054528.1|795453_796764_+	HAMP domain-containing histidine kinase	NA	A0A2K9L5I4	Tupanvirus	25.3	1.2e-06
WP_002989695.1|796888_797122_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_023612940.1|797190_798111_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.4	1.2e-34
WP_002989699.1|798378_798972_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002984531.1|799624_800014_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_012560741.1|800107_801160_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	38.8	2.4e-55
WP_047235796.1|801298_802831_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.0	4.0e-14
WP_002984537.1|802823_803888_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002989705.1|803889_804846_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032462908.1|805058_806777_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	84.6	3.7e-279
WP_023612472.1|806952_807522_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_010922347.1|807579_808125_-	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	35.7	5.3e-22
>prophage 59
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	812399	815152	1791306		Tupanvirus(50.0%)	3	NA	NA
WP_009880444.1|812399_813212_+	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.5	6.5e-32
WP_002992884.1|813204_814086_+	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_047235798.1|814132_815152_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.6	5.1e-10
>prophage 60
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	819760	827390	1791306		Streptococcus_phage(33.33%)	6	NA	NA
WP_047235799.1|819760_821029_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	52.8	7.1e-102
WP_047235800.1|821118_821985_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_011017797.1|821962_822520_+	membrane protein	NA	NA	NA	NA	NA
WP_080343544.1|822632_824198_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.6e-50
WP_047235802.1|824562_825786_+	aminoacyltransferase	NA	NA	NA	NA	NA
WP_002993734.1|825827_827390_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.9	8.4e-20
>prophage 61
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	831912	834151	1791306		Streptococcus_phage(50.0%)	2	NA	NA
WP_014635476.1|831912_832611_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SD15	Streptococcus_phage	48.5	1.2e-58
WP_027968836.1|833080_834151_+	tyrosine recombinase XerS	NA	A0A2D2W391	Mycobacterium_phage	26.7	8.9e-05
>prophage 62
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	853505	859978	1791306		Cafeteria_roenbergensis_virus(50.0%)	6	NA	NA
WP_047235809.1|853505_854498_-	D-lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	34.1	6.5e-42
WP_094979375.1|855118_855217_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989766.1|855493_855976_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_047235810.1|856050_858180_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	36.8	8.0e-98
WP_047235811.1|858285_859122_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.5	3.2e-34
WP_002995007.1|859186_859978_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	2.8e-24
>prophage 63
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	865453	898886	1791306		Bacillus_phage(12.5%)	32	NA	NA
WP_047235814.1|865453_867940_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.8	8.7e-104
WP_002984645.1|868130_869114_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002989788.1|869272_870643_-	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.0	8.2e-11
WP_047235815.1|870883_872611_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.3	4.3e-49
WP_047235816.1|872607_874332_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	1.3e-37
WP_002984655.1|874940_875918_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_047235817.1|875924_877181_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	9.9e-96
WP_002984660.1|877170_877623_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011054488.1|877640_878231_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	30.1	4.0e-15
WP_011054487.1|878214_879054_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011054486.1|879053_880133_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_002989802.1|880167_880737_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	57.0	1.8e-52
WP_002984671.1|880874_881060_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_047235818.1|881112_882051_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_011054483.1|882114_883398_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.4	1.8e-31
WP_002984677.1|883397_883979_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047235819.1|884283_885267_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	73.8	1.4e-137
WP_076612450.1|885544_887077_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_002984684.1|887063_887792_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.9	2.9e-15
WP_011528628.1|888208_888898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047235820.1|889090_889846_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	2.0e-06
WP_002984691.1|889972_890968_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_002989820.1|890971_891877_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.4	6.2e-07
WP_002993124.1|891873_892710_-	NAD kinase	NA	NA	NA	NA	NA
WP_002984696.1|892684_893356_-	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	28.9	2.4e-08
WP_011528626.1|893443_894022_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002984700.1|894161_895142_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	33.7	1.1e-36
WP_002989829.1|895138_896266_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.8	2.1e-36
WP_002984704.1|896255_896603_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_002984705.1|896854_897499_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_047235821.1|897508_898204_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_002984709.1|898205_898886_-	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	24.2	2.5e-13
>prophage 64
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	906025	920827	1791306		Dickeya_phage(16.67%)	15	NA	NA
WP_047235823.1|906025_907357_-	malate permease	NA	A0A140XAH4	Dickeya_phage	55.4	5.7e-17
WP_014612235.1|907517_909059_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002995342.1|909039_909705_+	response regulator	NA	W8CYM9	Bacillus_phage	29.1	7.2e-05
WP_047235824.1|909759_910833_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047235825.1|910825_911602_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047235826.1|911598_912393_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002989863.1|912376_913531_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.7	5.2e-35
WP_002995339.1|913576_914464_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002984757.1|914613_915114_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_002984761.1|915110_915470_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_047235827.1|915485_916277_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.0	8.0e-27
WP_002984765.1|916285_916894_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	50.8	1.3e-45
WP_009880428.1|916904_918182_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011017736.1|918512_919475_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_021299410.1|919591_920827_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.5	4.2e-14
>prophage 65
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	924586	925276	1791306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_010922274.1|924586_925276_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.2	1.6e-52
>prophage 66
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	929494	935685	1791306		Indivirus(33.33%)	5	NA	NA
WP_047235830.1|929494_931285_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.1	6.9e-18
WP_011528609.1|931399_931540_-	lantibiotic streptin	NA	NA	NA	NA	NA
WP_002984805.1|931696_933043_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002984807.1|933035_933722_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.3	4.5e-18
WP_021299387.1|935334_935685_-	DNA cytosine methyltransferase	NA	Q8LTM9	Lactococcus_phage	73.3	2.3e-26
>prophage 67
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	947012	948662	1791306		Enterobacteria_phage(100.0%)	1	NA	NA
WP_023079409.1|947012_948662_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	1.8e-12
>prophage 68
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	954944	1037368	1791306	portal,transposase,terminase,integrase,head,tail	Streptococcus_phage(64.15%)	85	992371:992392	1034594:1034615
WP_032460137.1|954944_956777_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
WP_024623376.1|956836_956941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002987950.1|956945_958079_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_047235835.1|958124_958373_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_011528586.1|958440_958572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984851.1|959135_959768_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002984852.1|959767_960532_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_011527617.1|960531_961284_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_002989962.1|961293_962424_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_023611160.1|962486_963128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184463.1|963251_964607_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_047235836.1|964660_965617_-	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_002989969.1|965613_966465_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_023605089.1|966577_967915_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_020905130.1|967914_968706_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_047235837.1|968814_969804_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	23.9	4.1e-12
WP_047235838.1|970036_972454_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_002989978.1|973126_974890_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.5	1.2e-33
WP_011284736.1|974922_975210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047235839.1|975220_976630_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_002989981.1|976814_977813_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002989983.1|977871_978840_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_047235840.1|979124_981032_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	1.3e-54
WP_002989987.1|981077_981404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235841.1|981433_982219_-	esterase family protein	NA	NA	NA	NA	NA
WP_002984872.1|982351_984013_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002989991.1|984216_984975_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
WP_011017706.1|984971_985841_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080343549.1|986017_986197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184452.1|986186_987185_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047235843.1|987538_989191_+	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_002984878.1|989249_990497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984879.1|990486_991668_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002984880.1|991725_992202_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
992371:992392	attL	AAAGAACCTTGTCATATCAACG	NA	NA	NA	NA
WP_010922229.1|992805_993516_-	streptococcal pyrogenic exotoxin SpeH	NA	NA	NA	NA	NA
WP_047373492.1|993541_994219_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
WP_011284838.1|994492_995827_-	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_002990010.1|995938_996124_-	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_002990012.1|996120_996417_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_047235844.1|996426_997038_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	94.6	6.5e-85
WP_047235845.1|997040_997469_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	82.9	4.0e-57
WP_047235846.1|997477_999361_-	phage hyaluronidase	NA	Q938J9	Temperate_phage	75.9	4.5e-185
WP_047235847.1|999375_1000491_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	74.7	4.7e-142
WP_047235848.1|1000487_1002467_-	peptidase	NA	A7J2A7	Streptococcus_phage	92.7	0.0e+00
WP_047235849.1|1002476_1003319_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.5	1.1e-156
WP_047235850.1|1003330_1007713_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	75.9	3.0e-224
WP_011054867.1|1007727_1007961_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
WP_023079225.1|1008035_1008491_-	phage protein	NA	A7J2A3	Streptococcus_phage	98.7	1.2e-75
WP_011054869.1|1008544_1009144_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054870.1|1009155_1009515_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011106640.1|1009518_1009863_-	hypothetical protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054872.1|1009859_1010138_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011054873.1|1010148_1010505_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	100.0	4.6e-59
WP_002983429.1|1010516_1011404_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011054874.1|1011416_1011986_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	99.5	7.4e-83
WP_011054875.1|1012153_1012420_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
WP_011054876.1|1012424_1012613_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_011054877.1|1012640_1014089_-	hypothetical protein	NA	A7J293	Streptococcus_phage	99.6	1.3e-277
WP_011106638.1|1014048_1015581_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.6	9.9e-292
WP_047235851.1|1015596_1016874_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	98.1	5.4e-243
WP_011106637.1|1016863_1017316_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_002988747.1|1017405_1017822_-	DUF722 domain-containing protein	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
WP_002988743.1|1017818_1018010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023613218.1|1018160_1018427_-	hypothetical protein	NA	A7J287	Streptococcus_phage	62.9	3.5e-19
WP_011054884.1|1018591_1019914_-	DEAD/DEAH box helicase	NA	A7J284	Streptococcus_phage	97.3	7.3e-251
WP_023613183.1|1019910_1020186_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	97.8	1.3e-45
WP_047235852.1|1020555_1022940_-	DNA primase	NA	A7J282	Streptococcus_phage	97.8	2.8e-285
WP_047235853.1|1022944_1024867_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.6	0.0e+00
WP_086934854.1|1024909_1025473_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1025481_1026639_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_047235854.1|1026638_1026938_-	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	8.2e-41
WP_023613207.1|1027026_1027230_-	hypothetical protein	NA	A7J276	Streptococcus_phage	91.0	1.3e-29
WP_000049475.1|1027756_1027960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888947.1|1027952_1028123_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_023613185.1|1028124_1028436_-	hypothetical protein	NA	A1EAC3	Streptococcus_phage	85.3	1.4e-48
WP_011888681.1|1028852_1029572_-	oxidoreductase	NA	M1Q1T4	Streptococcus_phage	70.3	7.4e-88
WP_014635614.1|1029599_1029812_-	DNA-binding protein	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
WP_011888679.1|1030009_1030351_+	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_047235855.1|1030334_1030718_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	75.2	5.9e-52
WP_023613205.1|1030719_1032384_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023613222.1|1032422_1033280_+	DNA adenine methylase	NA	A0A2H4UUI2	Bodo_saltans_virus	29.7	8.1e-17
WP_011888953.1|1033399_1034539_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	1.2e-119
WP_002984881.1|1034621_1035662_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
1034594:1034615	attR	CGTTGATATGACAAGGTTCTTT	NA	NA	NA	NA
WP_002990099.1|1035905_1036499_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_014407521.1|1036498_1037368_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	5.4e-101
>prophage 69
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1040760	1044403	1791306		Temperate_phage(33.33%)	3	NA	NA
WP_002984890.1|1040760_1041444_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_002990109.1|1041524_1042043_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_047235857.1|1042192_1044403_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	3.0e-71
>prophage 70
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1056108	1063495	1791306		Bacillus_virus(66.67%)	5	NA	NA
WP_047235859.1|1056108_1058568_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.9	9.3e-98
WP_080262148.1|1058658_1060611_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.8	2.1e-121
WP_002984911.1|1060742_1061384_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_011285490.1|1061441_1062710_-	dihydroorotase	NA	NA	NA	NA	NA
WP_009880722.1|1062841_1063495_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	40.5	8.0e-41
>prophage 71
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1072497	1082721	1791306	protease	Bacillus_phage(33.33%)	11	NA	NA
WP_047235861.1|1072497_1073307_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	42.2	1.1e-52
WP_002990151.1|1073290_1073731_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	55.3	5.8e-35
WP_002990153.1|1073749_1074961_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_009881270.1|1075037_1075721_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011528518.1|1076098_1078198_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.2	5.1e-121
WP_002984942.1|1078255_1078999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184414.1|1079146_1079746_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002984948.1|1079755_1080985_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.5	7.8e-138
WP_002984950.1|1081114_1081285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984955.1|1081304_1081802_-	dihydrofolate reductase	NA	W5QU76	Bacillus_phage	34.4	8.6e-11
WP_011017679.1|1081881_1082721_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.2	1.7e-83
>prophage 72
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1090918	1098924	1791306	tRNA	Bacillus_phage(25.0%)	7	NA	NA
WP_002984985.1|1090918_1091587_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.8	2.3e-19
WP_002984988.1|1091589_1092240_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_047235864.1|1092459_1094472_+	5'-nucleotidase	NA	NA	NA	NA	NA
WP_002984994.1|1094553_1094964_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	30.6	6.9e-06
WP_011106820.1|1095219_1095438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235865.1|1095856_1097734_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	8.7e-64
WP_080262010.1|1097730_1098924_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.5	3.6e-39
>prophage 73
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1103176	1111711	1791306		Clostridium_botulinum_C_phage(25.0%)	8	NA	NA
WP_047235342.1|1103176_1103884_-	glycoside hydrolase family 73 protein	NA	Q332B8	Clostridium_botulinum_C_phage	36.4	1.9e-11
WP_042765801.1|1104034_1104634_-	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	33.8	3.6e-11
WP_047235866.1|1104726_1106673_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_047235867.1|1106669_1107581_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_020833413.1|1107577_1108291_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.1	1.9e-19
WP_047235868.1|1108546_1109470_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002985048.1|1109482_1110541_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_011054365.1|1110718_1111711_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.9	8.2e-29
>prophage 74
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1123122	1123809	1791306		Planktothrix_phage(100.0%)	1	NA	NA
WP_047236079.1|1123122_1123809_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.0	4.3e-37
>prophage 75
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1128733	1151470	1791306	protease,tRNA	Streptococcus_phage(30.77%)	24	NA	NA
WP_002985087.1|1128733_1129816_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.9	4.7e-62
WP_004218947.1|1129859_1130795_-	aspartate carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	32.6	3.0e-25
WP_047235872.1|1130855_1132115_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.0	3.8e-63
WP_009881107.1|1132130_1132652_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_002985094.1|1133047_1133938_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	3.6e-07
WP_047235873.1|1133927_1134386_-	signal peptidase II	NA	NA	NA	NA	NA
WP_002990246.1|1134382_1135297_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002985110.1|1135644_1135938_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002985112.1|1135965_1136292_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002985116.1|1136303_1136618_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002985117.1|1136831_1138124_-	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	30.8	2.9e-34
WP_011106827.1|1138161_1139376_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_047235874.1|1139387_1140530_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	31.7	5.9e-15
WP_011017641.1|1140764_1141205_+	membrane protein	NA	NA	NA	NA	NA
WP_002992648.1|1141234_1142512_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_047235875.1|1142591_1143944_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	2.7e-30
WP_002990260.1|1144165_1144507_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_002990262.1|1144567_1145734_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1145827_1146514_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1146510_1147674_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_042361490.1|1147781_1149992_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	3.2e-267
WP_002985149.1|1150282_1150642_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002985151.1|1150700_1150898_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002985152.1|1150939_1151470_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.8	3.5e-10
>prophage 76
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1157980	1158676	1791306		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_002985169.1|1157980_1158676_-	glycosyltransferase family 2 protein	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	28.2	8.3e-12
>prophage 77
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1164099	1178326	1791306		Staphylococcus_phage(20.0%)	12	NA	NA
WP_002985176.1|1164099_1165305_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.5e-12
WP_010922132.1|1165304_1166066_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023611398.1|1166110_1167043_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023611395.1|1167032_1168187_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_047235879.1|1168305_1169160_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.3	8.9e-32
WP_002990295.1|1169297_1169636_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_002985187.1|1169872_1170982_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	35.1	2.0e-36
WP_047235880.1|1170990_1172805_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	28.6	4.5e-41
WP_002990299.1|1172934_1173297_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_000048058.1|1173424_1173601_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023611426.1|1173741_1174554_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_047236080.1|1174693_1178326_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.0	2.7e-21
>prophage 78
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1181688	1183378	1791306		Rhodococcus_phage(50.0%)	2	NA	NA
WP_012560586.1|1181688_1182606_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-33
WP_047235881.1|1182709_1183378_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	2.2e-30
>prophage 79
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1188018	1189062	1791306	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003057440.1|1188018_1189062_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
>prophage 80
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1200138	1203827	1791306		Catovirus(33.33%)	3	NA	NA
WP_009881010.1|1200138_1201161_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
WP_047235886.1|1201174_1203133_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	5.8e-103
WP_002985256.1|1203326_1203827_-	queuosine transporter QueT	NA	E7DN70	Pneumococcus_phage	31.8	5.4e-05
>prophage 81
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1209659	1210583	1791306		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_002990429.1|1209659_1210583_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
>prophage 82
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1226493	1235959	1791306		Streptococcus_phage(75.0%)	7	NA	NA
WP_003050115.1|1226493_1227801_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.3e-239
WP_047235892.1|1228027_1228486_+	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.7	5.1e-18
WP_047235893.1|1228617_1230342_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_047235894.1|1230709_1232662_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.0	2.6e-143
WP_023612339.1|1232662_1233223_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002985298.1|1234234_1234582_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023610484.1|1234696_1235959_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	50.8	1.1e-94
>prophage 83
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1243984	1256229	1791306	tRNA	Streptococcus_phage(57.14%)	10	NA	NA
WP_002985428.1|1243984_1244896_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.3e-105
WP_020905024.1|1244892_1245870_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	9.6e-139
WP_011284641.1|1245866_1246757_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_002985437.1|1247171_1248518_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_002985439.1|1248538_1249732_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_080343551.1|1250066_1252568_-	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.4	1.2e-204
WP_002990495.1|1252675_1253440_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_011284638.1|1253607_1254306_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.9	1.0e-78
WP_010922049.1|1254614_1255553_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002985455.1|1255536_1256229_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
>prophage 84
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1259235	1263313	1791306		Synechococcus_phage(50.0%)	5	NA	NA
WP_002985463.1|1259235_1259892_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.7	1.2e-12
WP_047235901.1|1260182_1260818_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_047235902.1|1260822_1261824_-	sugar kinase	NA	NA	NA	NA	NA
WP_002985472.1|1261852_1262494_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_047235903.1|1262518_1263313_-	gluconate 5-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	3.1e-18
>prophage 85
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1270554	1275235	1791306		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_002985501.1|1270554_1273236_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.3	4.9e-68
WP_002985505.1|1273465_1273852_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_047235906.1|1273933_1275235_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	1.4e-28
>prophage 86
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1280045	1281242	1791306		Hokovirus(100.0%)	1	NA	NA
WP_002990541.1|1280045_1281242_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.6	2.5e-32
>prophage 87
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1285996	1290357	1791306		Streptococcus_phage(33.33%)	5	NA	NA
WP_047235909.1|1285996_1287796_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	36.3	1.6e-107
WP_015057427.1|1287788_1288268_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.0	5.5e-23
WP_047235910.1|1288313_1288697_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_047235911.1|1288680_1289184_-	membrane protein	NA	NA	NA	NA	NA
WP_012560549.1|1289508_1290357_+	glycosyl hydrolase 25 family protein	NA	A0A223LJI5	Bacillus_phage	31.3	1.9e-18
>prophage 88
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1293905	1297486	1791306	tRNA	Catovirus(33.33%)	3	NA	NA
WP_002990562.1|1293905_1295399_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.7	2.5e-90
WP_002985548.1|1295777_1295990_-	hypothetical protein	NA	A0A223LEC3	Bacillus_phage	46.9	9.0e-10
WP_002990566.1|1296199_1297486_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.9	4.2e-41
>prophage 89
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1321637	1323561	1791306		Moumouvirus(50.0%)	3	NA	NA
WP_011528389.1|1321637_1322462_-	asparagine ligase A	NA	M1PB22	Moumouvirus	33.5	4.3e-23
WP_009880564.1|1322485_1322827_-	Fic family protein	NA	NA	NA	NA	NA
WP_011017509.1|1323228_1323561_-	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	65.9	9.1e-25
>prophage 90
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1328006	1330768	1791306		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_002985621.1|1328006_1328216_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	61.5	1.3e-16
WP_047235918.1|1328317_1329526_-	MFS transporter	NA	NA	NA	NA	NA
WP_047235919.1|1329610_1330768_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	M1GX70	Paramecium_bursaria_Chlorella_virus	40.6	1.2e-74
>prophage 91
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1343002	1347006	1791306		Bacillus_phage(50.0%)	4	NA	NA
WP_002990670.1|1343002_1343695_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	34.7	6.5e-25
WP_002985641.1|1344137_1344947_-	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	37.4	4.8e-35
WP_002990673.1|1344950_1346303_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	35.0	6.1e-35
WP_002985645.1|1346295_1347006_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.0	3.7e-39
>prophage 92
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1352961	1363357	1791306	tRNA	Brazilian_cedratvirus(25.0%)	9	NA	NA
WP_023612151.1|1352961_1353954_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	8.2e-13
WP_002985672.1|1354094_1356038_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.7	1.0e-120
WP_047235925.1|1356459_1357794_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985678.1|1357795_1358794_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985680.1|1358923_1359925_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.5	6.1e-24
WP_047235926.1|1360098_1361184_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002985684.1|1361232_1361898_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047235927.1|1361908_1362286_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_047235928.1|1362430_1363357_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.2	5.8e-77
>prophage 93
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1366713	1374460	1791306		Staphylococcus_phage(25.0%)	8	NA	NA
WP_011054260.1|1366713_1367181_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.0	1.3e-40
WP_080343553.1|1367183_1369517_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.8	5.2e-90
WP_002985700.1|1369610_1369847_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002990729.1|1369892_1370039_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_080343554.1|1370035_1371229_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_047235930.1|1371350_1372853_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.9	1.4e-75
WP_047236084.1|1373042_1373636_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_047235931.1|1373632_1374460_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.8	6.0e-17
>prophage 94
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1385644	1390125	1791306		Erwinia_phage(50.0%)	3	NA	NA
WP_010921967.1|1385644_1386697_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_014635330.1|1386855_1388628_-	oleate hydratase	NA	NA	NA	NA	NA
WP_047235934.1|1388943_1390125_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.6e-16
>prophage 95
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1395564	1400721	1791306		Mycobacterium_phage(33.33%)	4	NA	NA
WP_047235935.1|1395564_1397970_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_002985776.1|1398186_1398993_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_011017448.1|1399140_1399995_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985780.1|1399995_1400721_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
>prophage 96
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1404650	1411530	1791306		Tupanvirus(33.33%)	6	NA	NA
WP_011889106.1|1404650_1406033_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.4	3.8e-32
WP_002993065.1|1406205_1407543_-	MFS transporter	NA	NA	NA	NA	NA
WP_047235939.1|1407875_1408835_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_047235940.1|1408910_1409609_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	9.3e-11
WP_002990844.1|1409601_1409838_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_047235941.1|1410561_1411530_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	52.6	2.0e-88
>prophage 97
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1419493	1425641	1791306	tRNA	Enterococcus_phage(25.0%)	4	NA	NA
WP_047235948.1|1419493_1421674_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.3	1.9e-171
WP_011284545.1|1421640_1422129_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_010921941.1|1422132_1423146_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.7	2.5e-97
WP_080343556.1|1423640_1425641_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.4	1.2e-87
>prophage 98
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1435306	1442949	1791306	protease	Streptococcus_phage(85.71%)	11	NA	NA
WP_047235952.1|1435306_1436134_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
WP_002990897.1|1436207_1436564_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.1e-39
WP_002990900.1|1436862_1437492_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1437538_1437931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235953.1|1437957_1438821_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.3	1.9e-114
WP_002985838.1|1438825_1439149_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_011017422.1|1439553_1439793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235954.1|1439811_1440687_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	41.7	6.9e-56
WP_047235955.1|1440704_1441340_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	5.9e-65
WP_002990928.1|1441570_1441864_-	YlbG family protein	NA	NA	NA	NA	NA
WP_002985850.1|1442358_1442949_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
>prophage 99
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1447381	1459659	1791306	tRNA	Staphylococcus_phage(50.0%)	14	NA	NA
WP_002985861.1|1447381_1448164_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	30.1	7.4e-17
WP_047235956.1|1448189_1449122_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044558082.1|1449132_1450164_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_047235957.1|1450124_1451162_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	29.6	6.2e-19
WP_047235958.1|1451206_1451860_-	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002990948.1|1451935_1452871_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_047236087.1|1453001_1453793_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	29.0	3.5e-22
WP_002990953.1|1453870_1455205_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_047235959.1|1455310_1455892_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	41.7	9.0e-36
WP_002990957.1|1455930_1456851_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	50.4	2.9e-36
WP_002990960.1|1457143_1457797_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002990963.1|1457798_1458362_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_047235960.1|1458672_1459221_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010921920.1|1459398_1459659_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	50.0	1.9e-17
>prophage 100
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1474955	1487133	1791306	protease	Bacillus_phage(40.0%)	10	NA	NA
WP_080343557.1|1474955_1478054_-	DEAD/DEAH box helicase	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	31.1	1.3e-43
WP_002991013.1|1478260_1479571_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002991016.1|1479633_1480536_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.2	3.0e-30
WP_032465854.1|1480536_1481712_-	helicase loader	NA	NA	NA	NA	NA
WP_002985941.1|1481695_1482190_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002991036.1|1482404_1483907_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.4e-24
WP_002991052.1|1483912_1484599_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	5.1e-30
WP_002985951.1|1484865_1485402_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002985953.1|1485632_1486529_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_002985956.1|1486575_1487133_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	27.6	6.2e-10
>prophage 101
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1493760	1494825	1791306		Planktothrix_phage(100.0%)	1	NA	NA
WP_011054194.1|1493760_1494825_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.8e-29
>prophage 102
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1501576	1502209	1791306		Bacillus_virus(100.0%)	1	NA	NA
WP_031488555.1|1501576_1502209_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	34.8	1.1e-21
>prophage 103
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1512528	1518288	1791306		Staphylococcus_phage(66.67%)	3	NA	NA
WP_047235969.1|1512528_1515507_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.2	1.3e-24
WP_047235970.1|1515519_1516695_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.2	1.2e-15
WP_047235971.1|1516707_1518288_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.0	4.7e-119
>prophage 104
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1522946	1524214	1791306		Planktothrix_phage(50.0%)	2	NA	NA
WP_047235974.1|1522946_1523684_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	2.0e-27
WP_080343559.1|1523680_1524214_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.8	7.5e-13
>prophage 105
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1533487	1538059	1791306	integrase	Escherichia_phage(33.33%)	8	1534782:1534795	1536690:1536703
WP_011285171.1|1533487_1534261_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	4.3e-17
1534782:1534795	attL	AAACGGTATCAAAA	NA	NA	NA	NA
WP_002988079.1|1534910_1535198_+	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_047235979.1|1535187_1535523_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_080343560.1|1535674_1535857_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_111690826.1|1536107_1536608_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	34.5	1.2e-20
WP_002982716.1|1536775_1537168_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
1536690:1536703	attR	AAACGGTATCAAAA	NA	NA	NA	NA
WP_002982710.1|1537188_1537635_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002982695.1|1537852_1538059_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	56.1	2.3e-10
>prophage 106
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1542560	1543904	1791306	tRNA	Catovirus(100.0%)	1	NA	NA
WP_047235980.1|1542560_1543904_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.9	1.9e-52
>prophage 107
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1548387	1549119	1791306		Synechococcus_phage(100.0%)	1	NA	NA
WP_080343562.1|1548387_1549119_-	transaldolase	NA	H8ZNI7	Synechococcus_phage	33.8	5.0e-15
>prophage 108
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1554364	1565816	1791306	protease,tRNA	Synechococcus_phage(25.0%)	8	NA	NA
WP_002982624.1|1554364_1554979_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.3e-13
WP_010922679.1|1555012_1555555_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002982615.1|1555684_1556113_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047235986.1|1556222_1560620_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.7e-17
WP_047235987.1|1560873_1562730_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	24.6	4.1e-05
WP_047235988.1|1562927_1564187_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_009881158.1|1564259_1565054_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010922683.1|1565066_1565816_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.7	7.3e-22
>prophage 109
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1572441	1573575	1791306		Bacillus_virus(100.0%)	1	NA	NA
WP_023611835.1|1572441_1573575_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.9	1.1e-24
>prophage 110
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1576914	1579134	1791306		Vibrio_phage(100.0%)	1	NA	NA
WP_047235993.1|1576914_1579134_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1S6L1R3	Vibrio_phage	39.5	8.9e-07
>prophage 111
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1582878	1585065	1791306		Vibrio_phage(100.0%)	1	NA	NA
WP_047235997.1|1582878_1585065_-	PTS system glucose/maltose-specific transporter subunit IIBCA	NA	A0A2I7SAJ6	Vibrio_phage	43.0	1.9e-06
>prophage 112
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1591916	1596848	1791306		Pandoravirus(25.0%)	4	NA	NA
WP_047236002.1|1591916_1593674_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	28.2	7.5e-33
WP_047236003.1|1593706_1594273_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	9.1e-33
WP_047236004.1|1594305_1595574_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.1	2.0e-96
WP_047236005.1|1596146_1596848_+	exotoxin	NA	A0EX09	Staphylococcus_phage	36.2	4.3e-16
>prophage 113
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1601124	1602818	1791306		Anomala_cuprea_entomopoxvirus(33.33%)	3	NA	NA
WP_023080139.1|1601124_1601928_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	6.5e-08
WP_011529053.1|1601911_1602538_+	ABC transporter ATP-binding protein	NA	A0A2H4P6Z4	Pseudomonas_phage	26.1	1.6e-06
WP_002982507.1|1602617_1602818_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	86.4	1.3e-21
>prophage 114
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1620630	1626397	1791306		Staphylococcus_phage(25.0%)	5	NA	NA
WP_047236018.1|1620630_1622259_-	CHAP domain-containing protein	NA	A0A1P8CMP9	Staphylococcus_phage	44.6	4.5e-08
WP_002982466.1|1622360_1623749_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.7	1.6e-09
WP_002991237.1|1623745_1624399_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	2.7e-28
WP_002993552.1|1624492_1625710_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002982458.1|1625722_1626397_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.4e-32
>prophage 115
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1639974	1645988	1791306		Streptococcus_phage(25.0%)	5	NA	NA
WP_010922721.1|1639974_1640790_-	streptodornase B	NA	A7J2B8	Streptococcus_phage	33.3	6.7e-29
WP_031488620.1|1641153_1641663_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.5	7.2e-37
WP_047236023.1|1641744_1642833_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_014407899.1|1642889_1643558_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	33.8	4.8e-25
WP_047236024.1|1643570_1645988_-	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
>prophage 116
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1650324	1651098	1791306		Escherichia_phage(100.0%)	1	NA	NA
WP_002992110.1|1650324_1651098_+	glycyl-radical enzyme activating protein	NA	A0A0U2DAM7	Escherichia_phage	36.2	3.8e-05
>prophage 117
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1655239	1656058	1791306		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_080343582.1|1655239_1656058_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.5	2.3e-05
>prophage 118
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1660734	1669274	1791306	protease	uncultured_virus(25.0%)	7	NA	NA
WP_002982320.1|1660734_1662366_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	1.8e-153
WP_002991292.1|1662401_1662692_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_047236029.1|1662869_1665314_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.0	4.1e-122
WP_002982312.1|1665313_1665775_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002991299.1|1665970_1666174_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	80.0	6.1e-24
WP_047236030.1|1667160_1667721_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_047236031.1|1667741_1669274_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	37.5	1.1e-43
>prophage 119
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1678424	1679966	1791306		Catovirus(100.0%)	1	NA	NA
WP_047236038.1|1678424_1679966_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.9	3.1e-99
>prophage 120
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1687981	1689877	1791306		Klosneuvirus(100.0%)	1	NA	NA
WP_011285757.1|1687981_1689877_-	endopeptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.8e-72
>prophage 121
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1696430	1701958	1791306		Enterococcus_phage(66.67%)	5	NA	NA
WP_012561068.1|1696430_1697162_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	37.4	4.3e-35
WP_002982219.1|1697335_1697950_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.7	1.5e-52
WP_047236045.1|1697949_1698459_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047236046.1|1698467_1699403_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002992831.1|1699759_1701958_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.9	2.6e-277
>prophage 122
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1705831	1740749	1791306	tRNA,bacteriocin,integrase	Streptococcus_phage(45.45%)	40	1712763:1712783	1726935:1726955
WP_002992179.1|1705831_1706968_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	1.4e-120
WP_047236047.1|1707056_1708328_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_002992183.1|1708396_1708957_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002992186.1|1708966_1709563_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_047236048.1|1709564_1710785_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.7	7.8e-05
WP_047236089.1|1710795_1712778_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	3.0e-62
1712763:1712783	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_047236049.1|1712872_1714018_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	45.6	6.5e-86
WP_047236050.1|1714274_1715129_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.5	1.0e-56
WP_003058809.1|1715941_1716709_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|1716862_1717069_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_080343567.1|1717102_1717870_+	hypothetical protein	NA	A0A0A7S0G2	Clostridium_phage	53.7	5.0e-26
WP_047236051.1|1717879_1718497_+	antirepressor	NA	A0A2H4JB17	uncultured_Caudovirales_phage	43.5	1.7e-40
WP_001261786.1|1718496_1718766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992497.1|1719022_1719355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080032246.1|1719354_1719546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236052.1|1719557_1719920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236053.1|1719916_1720225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236054.1|1720227_1720500_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	4.7e-19
WP_047236055.1|1720500_1721367_+	phage protein	NA	A0A1X9I6L2	Streptococcus_phage	73.1	1.4e-120
WP_001069294.1|1723065_1723320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285281.1|1723316_1723490_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	8.6e-11
WP_047236057.1|1723670_1724180_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	62.5	4.2e-29
WP_047236058.1|1724253_1724742_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	3.1e-45
WP_002992136.1|1725144_1725507_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.9	8.7e-05
WP_047236059.1|1725481_1725865_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	40.9	2.9e-14
WP_047236060.1|1726029_1726683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236061.1|1727078_1729634_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.9	1.0e-43
1726935:1726955	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_011055092.1|1729620_1729827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002982171.1|1729969_1730407_-	arginine repressor	NA	NA	NA	NA	NA
WP_047236062.1|1730697_1732389_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	4.2e-73
WP_047236063.1|1732476_1732785_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002982164.1|1732811_1733684_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.6	2.1e-52
WP_047236064.1|1733726_1734605_-	YitT family protein	NA	NA	NA	NA	NA
WP_002993108.1|1734624_1735566_-	YitT family protein	NA	NA	NA	NA	NA
WP_047236065.1|1735558_1737307_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.6	1.2e-11
WP_023611200.1|1737644_1738925_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.9	6.4e-26
WP_000290414.1|1739144_1739327_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002982147.1|1739342_1739492_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011285293.1|1739772_1740399_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_047236066.1|1740410_1740749_+	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	33.3	7.6e-11
>prophage 123
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1752898	1754266	1791306		Streptococcus_phage(100.0%)	1	NA	NA
WP_009880645.1|1752898_1754266_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.7	1.0e-154
>prophage 124
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1763312	1783708	1791306	tRNA	Streptococcus_phage(20.0%)	18	NA	NA
WP_023611309.1|1763312_1763927_-	transglycosylase SLT domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	74.1	4.7e-27
WP_002991426.1|1764298_1765099_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002982066.1|1765091_1765934_-	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.8e-16
WP_002982063.1|1765909_1766800_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-20
WP_002991432.1|1766750_1767293_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010922795.1|1767306_1768332_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010922796.1|1768381_1769671_-	insulinase family protein	NA	A0A0G2Y5U8	Acanthamoeba_polyphaga_mimivirus	30.8	1.7e-13
WP_011285334.1|1769672_1770917_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	38.9	4.1e-86
WP_047236069.1|1771357_1772617_+	hyaluronan synthase HasA	NA	NA	NA	NA	NA
WP_009880737.1|1772652_1773861_+	UDP-glucose 6-dehydrogenase HasB	NA	M1HM57	Paramecium_bursaria_Chlorella_virus	47.1	1.1e-96
WP_011018342.1|1774042_1774957_+	UTP--glucose-1-phosphate uridylyltransferase HasC	NA	A0A127AW70	Bacillus_phage	51.5	4.8e-76
WP_047236070.1|1775264_1775678_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	70.7	1.7e-20
WP_009880735.1|1775679_1776786_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_023611235.1|1776841_1777705_-	EamA family transporter	NA	NA	NA	NA	NA
WP_002991454.1|1777907_1779389_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	3.4e-95
WP_002991455.1|1779696_1780719_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002982011.1|1781137_1782010_+	YitT family protein	NA	NA	NA	NA	NA
WP_002981986.1|1782088_1783708_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.2e-45
>prophage 125
NZ_CP007561	Streptococcus pyogenes strain NGAS596, complete genome	1791306	1789219	1790443	1791306		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_047236072.1|1789219_1790443_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	4.4e-16
