The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	0	3615	2861652		Geobacillus_virus(100.0%)	3	NA	NA
WP_000160304.1|346_1057_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|1371_2034_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242308.1|2313_3615_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 2
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	11548	13159	2861652		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|11548_13159_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 3
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	20962	28715	2861652		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|20962_21562_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|21562_22639_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248730.1|22625_23462_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|23494_24592_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|24588_25008_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|25114_25639_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|25665_26904_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|26931_27561_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|27584_28715_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 4
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	39432	39828	2861652		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|39432_39828_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 5
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	45937	46585	2861652		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|45937_46585_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 6
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	54777	56298	2861652		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178940.1|54777_56298_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 7
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	61972	64000	2861652		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|61972_64000_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 8
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	69150	72534	2861652		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|69150_69513_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|69861_70863_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|70981_71308_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001801513.1|71279_71789_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|71763_72534_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 9
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	86647	91371	2861652		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094572.1|86647_88177_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
WP_072399972.1|88206_89226_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|89347_89602_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|89601_91371_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
>prophage 10
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	95131	109206	2861652	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_042904898.1|95131_96157_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	9.0e-63
WP_000106312.1|96470_98081_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_001791590.1|98175_98304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|98448_100377_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|100629_101265_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|101621_102650_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|102709_102934_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|103142_104393_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000790325.1|104576_105527_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791588.1|105675_107160_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_001253292.1|107156_108116_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|108489_109206_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 11
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	116347	224073	2861652	head,coat,integrase,capsid,holin,protease,transposase,tail,terminase,portal	Staphylococcus_phage(85.86%)	135	131009:131038	181918:181947
WP_000917289.1|116347_116632_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|116707_118324_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
WP_000179345.1|118392_119565_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_000620857.1|119578_120253_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|120425_120644_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|120648_120966_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|120962_121118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231378.1|121102_121306_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000403839.1|121307_121691_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001103930.1|121691_122009_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_047210251.1|122072_122942_+	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	99.3	7.9e-169
WP_047210252.1|122955_124665_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	99.6	0.0e+00
WP_047210253.1|124976_125357_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	99.2	9.0e-69
WP_001019766.1|125353_125995_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_001190608.1|126530_126872_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_000846285.1|126883_127462_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_000448775.1|127479_127698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|127748_128276_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358778.1|128278_128620_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_001293073.1|128616_129186_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
WP_042904872.1|129340_130045_-	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_042904873.1|130463_130691_+	pathogenicity island protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	46.1	7.1e-13
131009:131038	attL	AGGCAGGTACTTCGGTACTTGCCTATTTTT	NA	NA	NA	NA
WP_001239269.1|131545_132481_-	TDT family transporter	NA	NA	NA	NA	NA
WP_000201397.1|133599_133779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573769.1|133775_134072_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001045073.1|134979_136287_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000206618.1|136725_137949_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_000791402.1|138380_139436_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|139457_140477_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000857191.1|141616_142654_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000825947.1|142712_143177_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|143276_143459_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_042904844.1|143662_144004_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	99.1	1.7e-55
WP_000759682.1|144009_144942_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|144957_145671_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_001801500.1|145633_145807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854072.1|145803_146067_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025874.1|146082_146298_+	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000128907.1|146286_146616_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|146666_147419_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148855.1|147434_147632_+	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
WP_000939496.1|147662_147803_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|147817_148450_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|148508_148829_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066017.1|148825_148987_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_000165375.1|149081_149408_+	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000291503.1|149388_149649_+	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_001205732.1|149657_149921_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700577.1|149929_151873_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
WP_000138472.1|151874_152795_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_071621397.1|152875_153493_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934764.1|153493_153964_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_000148316.1|153993_154878_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	100.0	5.4e-141
WP_000338531.1|154884_155103_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000101274.1|155433_155802_+	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000131366.1|155805_156048_+	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_000990744.1|156062_156227_+	hypothetical protein	NA	A0EWX9	Staphylococcus_phage	100.0	1.7e-24
WP_001065091.1|156219_156471_+	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
WP_000028422.1|156460_156643_+	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_000185659.1|156635_157178_+	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000195803.1|157214_157421_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|157417_157804_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|157800_157950_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|157949_158150_+	DUF1514 family protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|158177_158594_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988336.1|158825_159125_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
WP_000402904.1|159254_159599_+	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
WP_000625088.1|159595_161257_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|161272_162460_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|162443_163181_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|163204_164350_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238237.1|164369_164630_+	hypothetical protein	NA	A0A0H3U504	Staphylococcus_phage	100.0	6.4e-42
WP_000150936.1|164642_164927_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|164910_165273_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|165269_165674_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_042904846.1|165670_166078_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	99.3	1.6e-71
WP_000268735.1|166078_166723_+|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_071621395.1|166764_166989_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|167038_167389_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_001549167.1|167439_167577_+	hypothetical protein	NA	A0A2I6PDX7	Staphylococcus_phage	100.0	3.4e-18
WP_047210254.1|167633_172163_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	99.9	0.0e+00
WP_000567413.1|172159_173644_+|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_000582190.1|173659_177445_+	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
WP_001153681.1|177434_177587_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|177633_177921_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|177976_178351_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000750406.1|178771_179545_+	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_011447039.1|179653_179830_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|179882_179990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|180041_180296_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|180307_181063_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|181253_181745_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_165596011.1|182388_182730_+	hypothetical protein	NA	R9QTN8	Staphylococcus_phage	97.3	6.4e-58
181918:181947	attR	AGGCAGGTACTTCGGTACTTGCCTATTTTT	NA	NA	NA	NA
WP_000727649.1|182824_183274_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|183959_184310_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|184362_184623_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|184933_185113_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_000669728.1|186070_188140_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000277709.1|188437_190084_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_001068528.1|190331_191618_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|191817_191916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681966.1|192157_192334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|192591_192972_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991315.1|192968_193865_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|193865_194546_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|194542_195415_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_042904920.1|195414_196155_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000182842.1|196218_196782_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000966288.1|196902_197427_+	membrane protein	NA	NA	NA	NA	NA
WP_001033968.1|197486_198044_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713064.1|198040_198883_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188074.1|198939_199980_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|200430_200604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205106.1|200660_201062_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000181322.1|201332_202361_+	lactonase family protein	NA	NA	NA	NA	NA
WP_001021224.1|202480_203860_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001790680.1|203911_204085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140871.1|204277_205207_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_000149686.1|205259_205820_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275719.1|206192_207290_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
WP_000323171.1|207494_209057_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_031788442.1|209067_209175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177832.1|209246_210041_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000897633.1|210060_211137_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000284434.1|211320_212790_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|212782_213604_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_000011542.1|213873_214476_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000669861.1|214456_214630_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000434532.1|214923_215247_-	staphostatin A	NA	NA	NA	NA	NA
WP_000827736.1|215277_216444_-|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000572878.1|217295_218591_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|218699_219002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|219184_219877_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|219873_222066_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774552.1|222069_224073_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 12
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	231302	236330	2861652		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|231302_232250_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147874.1|232330_233692_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
WP_000548777.1|233861_234392_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|234638_235709_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|235775_236330_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 13
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	239783	240197	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|239783_240197_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 14
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	245178	245808	2861652		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|245178_245808_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 15
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	261289	263026	2861652		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|261289_263026_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 16
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	279503	280232	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_001144055.1|279503_280232_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
>prophage 17
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	290887	291232	2861652		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|290887_291232_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 18
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	300820	301561	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|300820_301561_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 19
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	309424	313704	2861652		Staphylococcus_phage(80.0%)	5	NA	NA
WP_147612242.1|309424_310207_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
WP_000821649.1|310488_311208_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_000721567.1|311242_311971_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000764684.1|312124_312910_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_001235656.1|312948_313704_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
>prophage 20
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	316958	387251	2861652	tRNA,protease	Staphylococcus_phage(93.18%)	65	NA	NA
WP_000711499.1|316958_318305_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
WP_000595635.1|318551_319067_-	membrane protein	NA	NA	NA	NA	NA
WP_001039022.1|320081_320801_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_001038766.1|320924_321641_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001038734.1|322686_323403_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038742.1|323572_324292_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001794363.1|324471_326211_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
WP_000072622.1|326203_327358_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_000413389.1|327394_329212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095390.1|329473_329773_-	secretion protein	NA	NA	NA	NA	NA
WP_001053714.1|329787_331398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619920.1|331440_331890_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001819963.1|332117_332477_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000182553.1|332602_335023_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000731421.1|335989_336433_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001037039.1|336432_336876_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001791232.1|337050_337152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|337274_337370_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000747804.1|337820_338267_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|338459_339029_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_001093574.1|339028_340396_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000414222.1|340544_341117_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627550.1|341214_341559_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000669038.1|341599_342226_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000070654.1|342301_343297_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_001794016.1|343377_344028_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_016186903.1|344330_344786_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_000348372.1|344944_346423_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_000778539.1|346427_347429_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000718107.1|347425_347683_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672010.1|347748_348222_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_001801476.1|348226_348973_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000109909.1|349265_350858_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_000933819.1|351229_352423_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366165.1|352547_353456_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000453316.1|353667_354501_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000623481.1|354750_355104_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_001200542.1|355100_355466_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091444.1|355720_356023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|356281_356995_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000492901.1|357452_358073_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001168914.1|358239_358875_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001030476.1|359172_359616_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001152695.1|359602_360046_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671059.1|360158_360629_-	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_000384171.1|360827_361052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|361327_362182_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989104.1|362268_363561_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_000221181.1|363560_363875_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_001261683.1|364517_366020_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_001819953.1|366512_367544_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_000493891.1|367550_368183_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001159032.1|368193_369375_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008556.1|369387_369852_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001196351.1|369973_370975_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_014937042.1|371086_371206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266099.1|371208_372036_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|372608_373010_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764425.1|373128_373692_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000526541.1|373688_374642_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_001025064.1|374752_375934_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_001108722.1|376225_378640_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_000836472.1|378661_378973_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_042904812.1|379296_385866_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
WP_000284993.1|385982_387251_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 21
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	395388	399325	2861652		Salmonella_phage(50.0%)	4	NA	NA
WP_000733283.1|395388_396234_-	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
WP_001096374.1|396340_398098_+	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_001284656.1|398087_398468_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000690628.1|398731_399325_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
>prophage 22
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	404908	410278	2861652		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|404908_405766_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048374.1|405794_406433_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118301.1|406453_410278_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 23
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	418850	420557	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|418850_420557_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 24
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	427161	429792	2861652	tRNA,protease	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|427161_428424_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279341.1|428517_429792_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 25
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	433560	437696	2861652		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|433560_435165_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291426.1|435151_436312_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553919.1|436426_436873_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174275.1|436952_437696_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 26
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	455278	458476	2861652		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|455278_458476_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 27
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	463408	465166	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|463408_465166_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 28
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	470049	478214	2861652		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080025.1|470049_470751_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_073392727.1|470753_472415_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000849445.1|472915_474403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038301.1|474695_477326_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_001114454.1|477341_478214_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 29
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	482128	493282	2861652	tRNA,protease	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|482128_483049_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_016186894.1|483141_483237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|483461_485399_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049150.1|485825_487319_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791219.1|487547_488075_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_001125540.1|488103_488304_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|488350_488707_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032653.1|488848_489457_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001280014.1|489475_490405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|490409_490520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|490567_491869_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|492019_493282_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 30
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	502848	505479	2861652	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425358.1|502848_505479_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 31
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	515594	551192	2861652	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|515594_516599_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|516600_517626_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|517648_518788_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|518806_519067_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749802.1|519341_521621_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595001.1|521823_524097_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000364542.1|524118_524637_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058583.1|525064_527254_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|527265_527718_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|527714_528590_+	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|529050_530313_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044796.1|530328_532095_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001791215.1|532427_532556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682640.1|532555_533329_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102741.1|533489_534764_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000704122.1|534848_535271_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|535370_535553_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000008061.1|535592_535739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985898.1|535975_536989_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|537298_538441_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|538441_539560_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567025.1|540241_540910_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283316.1|540911_543389_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734077.1|543731_546362_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|546424_546685_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|546688_547117_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|547131_547440_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342267.1|547724_548363_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|548365_549289_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|549300_550569_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|550568_551192_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 32
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	567656	573820	2861652		Bacillus_phage(33.33%)	5	NA	NA
WP_000439692.1|567656_568118_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953291.1|568176_570324_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282570.1|570380_571355_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|571399_571651_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|571996_573820_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 33
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	577255	580363	2861652		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|577255_579088_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119020.1|579223_580363_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
>prophage 34
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	586832	587780	2861652		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|586832_587780_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 35
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	590834	604562	2861652	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|590834_592226_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|592560_593184_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|593194_594013_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217253.1|594073_595873_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|596096_597203_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624581.1|597333_598011_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683921.1|598013_599114_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_001062173.1|599227_600574_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000924211.1|600583_601474_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|601599_602385_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|602426_603290_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|603276_603687_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|603962_604562_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 36
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	610734	611358	2861652		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|610734_611358_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 37
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	616902	619714	2861652		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019697.1|616902_618249_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
WP_000202178.1|618241_619714_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 38
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	627234	633804	2861652		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|627234_628572_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159866.1|628564_628795_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183386.1|628772_629654_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	5.8e-10
WP_001124985.1|630084_630537_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942216.1|630552_632232_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_042904915.1|632382_633804_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.1	2.5e-39
>prophage 39
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	640632	642039	2861652		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|640632_642039_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 40
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	649386	650871	2861652		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|649386_650871_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 41
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	656535	666033	2861652		Brevibacillus_phage(25.0%)	9	NA	NA
WP_000447733.1|656535_657423_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183424.1|657500_658007_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273367.1|658098_658830_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_000368652.1|658822_659365_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_042904914.1|659357_660095_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|660227_660953_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987777.1|660933_662685_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001574168.1|662936_663869_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000723488.1|663855_666033_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	40.5	1.7e-31
>prophage 42
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	669292	671971	2861652		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|669292_669541_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163814.1|669648_670602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902107.1|670591_671971_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
>prophage 43
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	681378	686519	2861652		Bacillus_phage(25.0%)	6	NA	NA
WP_001043863.1|681378_681651_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|682081_682654_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774679.1|682656_683382_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001819897.1|683398_684343_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|684434_684884_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001269937.1|685352_686519_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
>prophage 44
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	690181	690757	2861652		Bacillus_virus(100.0%)	1	NA	NA
WP_000005208.1|690181_690757_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
>prophage 45
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	694129	701636	2861652	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361536.1|694129_695332_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000049917.1|695318_696290_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525060.1|696313_699007_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858795.1|699328_700621_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000362222.1|700949_701636_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 46
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	705327	706005	2861652		Bacillus_phage(100.0%)	1	NA	NA
WP_001794297.1|705327_706005_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.9e-24
>prophage 47
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	715417	716296	2861652		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|715417_716296_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 48
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	754888	765345	2861652	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000282169.1|754888_755593_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
WP_001814377.1|755837_756032_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|756043_756295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404628.1|756332_757457_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995290.1|757472_757910_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|758333_759290_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|759489_759969_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166055.1|759983_760823_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000159899.1|760908_761442_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|761434_761863_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|761874_762375_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|762374_762596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|762668_763616_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000342154.1|763854_765345_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
>prophage 49
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	768753	770765	2861652		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|768753_769413_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166793.1|769409_770765_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 50
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	777133	777925	2861652		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|777133_777925_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 51
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	781460	786486	2861652	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|781460_782597_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001794103.1|782628_783258_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|783276_783546_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|783707_784016_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|784186_784387_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876206.1|784583_784985_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_042904924.1|785220_786486_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 52
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	794328	795930	2861652		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|794328_795930_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 53
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	800355	803809	2861652		Indivirus(50.0%)	3	NA	NA
WP_042904922.1|800355_801207_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_042904921.1|801213_801855_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077549.1|801994_803809_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 54
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	807223	807925	2861652		Tupanvirus(100.0%)	1	NA	NA
WP_000571253.1|807223_807925_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 55
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	815406	817759	2861652		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000153717.1|815406_816189_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
WP_000604802.1|817192_817759_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 56
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	822077	825643	2861652	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000283027.1|822077_823340_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	1.7e-95
WP_001123276.1|823487_823673_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000277741.1|823996_825643_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 57
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	834912	839306	2861652		Bacillus_phage(50.0%)	2	NA	NA
WP_001289586.1|834912_837315_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001574370.1|837314_839306_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 58
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	844923	846570	2861652		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|844923_846570_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 59
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	850239	851361	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|850239_851361_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 60
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	855510	861166	2861652		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|855510_856134_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380738.1|856513_857377_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001791425.1|857450_857555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688127.1|857551_858529_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085657.1|858685_858955_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|859408_859558_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_042904892.1|859648_861166_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 61
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	871302	875578	2861652		Bacillus_phage(50.0%)	6	NA	NA
WP_000841344.1|871302_871836_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|871974_872163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624452.1|872275_872878_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670311.1|872874_873966_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603961.1|873969_874701_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794121.1|874669_875578_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 62
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	879532	879868	2861652	capsid	Staphylococcus_phage(100.0%)	1	NA	NA
WP_077670291.1|879532_879868_-|capsid	minor capsid protein	capsid	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 63
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	883805	890411	2861652	capsid,transposase	Staphylococcus_phage(66.67%)	9	NA	NA
WP_001574392.1|883805_884327_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	51.1	3.1e-43
WP_000585095.1|884531_884783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168174519.1|885666_885873_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	56.5	1.7e-13
WP_000477487.1|886303_886720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|887146_888094_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000006110.1|888305_888491_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_031788482.1|888883_888994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002343.1|889695_889902_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_001071312.1|890198_890411_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
>prophage 64
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	897793	904667	2861652	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
WP_001251205.1|897793_899152_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
WP_000681139.1|899156_901004_+	membrane protein	NA	NA	NA	NA	NA
WP_000247474.1|900993_902040_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000810443.1|902046_902637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255381.1|902692_903049_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000746372.1|903157_903661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078367270.1|903641_904178_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_001659797.1|904469_904667_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 65
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	909738	910215	2861652		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|909738_910215_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 66
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	916158	922640	2861652		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|916158_916977_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|917451_917994_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_042904956.1|917999_920009_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	6.9e-59
WP_000073334.1|920021_922640_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
>prophage 67
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	932054	933098	2861652		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|932054_933098_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 68
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	937297	942841	2861652		Bacillus_virus(33.33%)	4	NA	NA
WP_000664777.1|937297_938584_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089941.1|938583_939849_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|939879_940593_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078098607.1|940597_942841_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 69
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	947981	959796	2861652	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864182.1|947981_948953_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282296.1|948967_949885_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|950054_950405_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043642.1|950791_952909_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020856.1|952913_953231_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|953227_953512_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|953532_954708_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|954728_955196_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_078098608.1|955485_959796_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 70
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	964069	964840	2861652		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|964069_964840_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 71
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	969614	983286	2861652	tRNA,protease	Erwinia_phage(16.67%)	10	NA	NA
WP_000379051.1|969614_971018_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
WP_000072681.1|971083_971629_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|971625_972522_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195263.1|972939_974247_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|974402_976478_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000672864.1|977696_978941_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041658.1|978968_980087_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110252.1|980313_981222_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001020801.1|981243_982410_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176401.1|982518_983286_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 72
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	996670	998791	2861652		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|996670_997402_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|997517_997751_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|998056_998791_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 73
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1009161	1011156	2861652		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|1009161_1011156_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 74
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1014303	1015239	2861652	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|1014303_1015239_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 75
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1020248	1022505	2861652		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|1020248_1021448_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|1021663_1021882_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|1021881_1022505_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 76
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1025819	1026431	2861652		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|1025819_1026431_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 77
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1030398	1035009	2861652		Halovirus(33.33%)	4	NA	NA
WP_001190910.1|1030398_1031499_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
WP_000767018.1|1031500_1032775_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|1032792_1033674_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178615.1|1033701_1035009_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 78
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1039940	1042694	2861652	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|1039940_1042694_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 79
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1062050	1062248	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|1062050_1062248_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 80
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1071159	1073335	2861652	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
WP_000277741.1|1071159_1072806_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001801391.1|1073107_1073335_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
>prophage 81
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1076795	1077146	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000669541.1|1076795_1077146_-	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 82
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1088580	1093138	2861652		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|1088580_1088895_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249264.1|1089067_1091416_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161937.1|1091425_1093138_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 83
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1098016	1101178	2861652	tRNA,transposase	Orpheovirus(50.0%)	3	NA	NA
WP_000003566.1|1098016_1099075_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
WP_000435380.1|1099455_1100196_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_000121211.1|1100230_1101178_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
>prophage 84
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1112128	1115039	2861652		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|1112128_1112611_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263793.1|1112612_1113155_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|1113224_1113614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|1113616_1113871_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757584.1|1114109_1115039_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 85
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1136680	1140323	2861652		Mycoplasma_phage(50.0%)	4	NA	NA
WP_000433551.1|1136680_1137775_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020627.1|1137787_1138327_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000455584.1|1138470_1138746_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_042904863.1|1138916_1140323_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	6.1e-46
>prophage 86
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1144964	1145516	2861652		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|1144964_1145516_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 87
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1151630	1156010	2861652		Bacillus_virus(50.0%)	5	NA	NA
WP_001289622.1|1151630_1151864_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
WP_000040041.1|1152100_1153819_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1153821_1154088_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505964.1|1154241_1154784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685075.1|1154837_1156010_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
>prophage 88
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1159189	1173952	2861652		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921981.1|1159189_1160590_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
WP_000273254.1|1160582_1161389_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101912.1|1161656_1162904_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709288.1|1162925_1164404_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238673.1|1164418_1164985_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030814.1|1164987_1166016_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000483716.1|1166008_1167493_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_000032734.1|1167471_1169661_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000666808.1|1169653_1170325_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000848351.1|1170326_1170590_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174050.1|1170589_1171294_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_001010391.1|1171297_1172422_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861576.1|1172408_1172891_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225845.1|1173091_1173952_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 89
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1184189	1187963	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074519.1|1184189_1187963_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 90
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1191629	1221976	2861652	bacteriocin,holin,protease	Staphylococcus_phage(20.0%)	32	NA	NA
WP_000676568.1|1191629_1192703_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
WP_001088791.1|1192784_1193966_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284455.1|1194003_1194333_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1194568_1195390_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150205.1|1195382_1196186_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526678.1|1196172_1197846_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001814117.1|1197832_1199044_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1199147_1199225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070967.1|1199375_1200314_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620943.1|1200365_1200917_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001794164.1|1201006_1201297_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
WP_001794249.1|1201360_1201492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081338.1|1201538_1202498_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1202988_1203345_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000719183.1|1203433_1204915_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000410718.1|1204920_1205208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791476.1|1205548_1205839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873929.1|1206564_1206885_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870819.1|1206887_1208852_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001794574.1|1208895_1209168_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1209177_1209279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119695.1|1209817_1209895_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001033867.1|1210195_1210798_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1210812_1210989_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668820.1|1211187_1212174_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876825.1|1212254_1212473_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1212682_1213252_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414169.1|1213740_1215252_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021872.1|1215390_1216749_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001794169.1|1216765_1219090_-|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000928413.1|1219308_1220112_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1220413_1221976_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 91
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1243196	1245005	2861652		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082722.1|1243196_1245005_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
>prophage 92
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1248955	1262798	2861652	transposase	Bacillus_virus(28.57%)	12	NA	NA
WP_047210259.1|1248955_1250602_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.3	7.4e-293
WP_094409958.1|1250897_1252464_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001180271.1|1252553_1253435_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001574526.1|1253446_1254097_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427776.1|1254089_1255070_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067041.1|1255072_1256059_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_073392975.1|1256109_1257579_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000121211.1|1257693_1258641_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000517177.1|1258632_1258899_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000197096.1|1259110_1260766_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000786746.1|1260784_1261726_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140043.1|1261715_1262798_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 93
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1271392	1278203	2861652		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1271392_1272538_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047061.1|1272648_1273518_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353950.1|1273576_1276186_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044234.1|1276388_1278203_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 94
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1281468	1288928	2861652	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_047210260.1|1281468_1283115_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	1.8e-294
WP_000902813.1|1283491_1283881_-	YisL family protein	NA	NA	NA	NA	NA
WP_000670753.1|1284206_1285109_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000154949.1|1285274_1288928_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 95
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1299083	1306019	2861652		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185311.1|1299083_1300013_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
WP_000138487.1|1300293_1301538_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000167321.1|1301646_1302837_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000838047.1|1303144_1304272_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1304633_1305011_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1305425_1306019_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 96
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1315953	1319581	2861652		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009683.1|1315953_1317429_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
WP_000046076.1|1317559_1318768_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001143497.1|1319221_1319581_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 97
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1323624	1326293	2861652		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1323624_1324839_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_042904878.1|1324835_1326293_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	5.8e-39
>prophage 98
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1339504	1343027	2861652		environmental_halophage(50.0%)	3	NA	NA
WP_001006454.1|1339504_1340755_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.4e-110
WP_000205572.1|1340860_1342168_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1342265_1343027_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 99
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1346859	1347885	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1346859_1347885_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 100
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1350994	1356173	2861652		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1350994_1351351_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1351494_1351815_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1351964_1352504_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150036.1|1352586_1353303_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_042904984.1|1353450_1353873_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1354271_1354766_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042904985.1|1354922_1355540_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1355612_1356173_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 101
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1359578	1360822	2861652		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1359578_1359779_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001574556.1|1360135_1360822_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 102
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1370295	1379053	2861652		Staphylococcus_phage(50.0%)	8	NA	NA
WP_001574560.1|1370295_1371024_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
WP_000999096.1|1371311_1371926_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|1372891_1373356_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050041.1|1373377_1375750_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165967.1|1375783_1376524_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1376652_1376886_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1376952_1377411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1377748_1379053_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 103
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1389741	1395557	2861652		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1389741_1390329_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1390897_1391842_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1391950_1392946_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1392942_1393854_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134960.1|1394621_1395557_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 104
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1399954	1402801	2861652		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|1399954_1402801_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 105
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1406119	1406959	2861652		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|1406119_1406959_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 106
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1413397	1419102	2861652		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370984.1|1413397_1414480_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
WP_000686342.1|1414843_1415710_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1415853_1416495_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1416658_1417714_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1418031_1419102_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 107
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1428379	1451350	2861652		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000616865.1|1428379_1429141_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
WP_001245566.1|1429137_1430094_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000876311.1|1430080_1431052_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_000562498.1|1431428_1432400_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1432519_1434625_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1434587_1434986_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1435787_1436654_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1436673_1437174_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1437513_1439019_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1439096_1439198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1439288_1440206_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1440757_1441300_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1441458_1442517_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1442756_1444271_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1444263_1445241_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1445461_1447243_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1447254_1449138_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1449409_1451350_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 108
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1454489	1464335	2861652		Pandoravirus(12.5%)	12	NA	NA
WP_001217804.1|1454489_1455641_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1455624_1456218_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1456568_1457237_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1457238_1457658_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062968.1|1457661_1458375_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637686.1|1458473_1459058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1459337_1459778_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1460119_1460593_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1460567_1461254_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1461253_1462309_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702776.1|1462380_1463364_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1463495_1464335_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 109
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1471497	1522007	2861652	bacteriocin,tRNA,transposase	Staphylococcus_phage(31.25%)	55	NA	NA
WP_001107240.1|1471497_1471980_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000216727.1|1472153_1472606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041284.1|1472902_1474069_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
WP_000776010.1|1474278_1474701_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001191871.1|1474887_1475505_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_000154465.1|1475501_1475786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952030.1|1475940_1477314_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
WP_000005632.1|1477399_1478953_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000180420.1|1479235_1479523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435104.1|1479557_1480466_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000794424.1|1480568_1481495_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001283444.1|1481721_1482165_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000857616.1|1482291_1483965_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_000737163.1|1483961_1485593_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000469883.1|1485811_1486687_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1486858_1487542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1487544_1488003_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1488004_1488571_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000638614.1|1488665_1489208_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000545116.1|1489287_1489587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733427.1|1489724_1490114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259673.1|1490180_1490624_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000842865.1|1490750_1491440_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_001105942.1|1492102_1492777_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_042904970.1|1492871_1493249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159128.1|1493486_1493852_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_000378396.1|1493844_1496025_+	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_047210262.1|1496387_1498034_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.5	6.9e-291
WP_000277154.1|1498100_1499534_-	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000069452.1|1499548_1501594_-	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000690626.1|1501860_1502436_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000838599.1|1502770_1503766_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000377738.1|1503890_1504712_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791613.1|1505013_1505106_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000397995.1|1505334_1505658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000713115.1|1505839_1506013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998976.1|1506874_1507300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843733.1|1508089_1508833_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_001002795.1|1509382_1509478_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000761344.1|1509692_1510034_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145511.1|1510120_1510981_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000273007.1|1511345_1511846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582045.1|1511912_1512239_-	recombinase	NA	NA	NA	NA	NA
WP_001643491.1|1512178_1512556_-	recombinase	NA	NA	NA	NA	NA
WP_000277741.1|1512710_1514357_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000593106.1|1514718_1515345_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.1e-22
WP_000831610.1|1515356_1515668_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000713732.1|1515671_1517606_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000726502.1|1517680_1517974_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358995.1|1518353_1518749_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_073392969.1|1518766_1520059_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.2	2.5e-187
WP_000120605.1|1520055_1520370_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_000633163.1|1520430_1520766_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001035802.1|1521085_1521298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|1521332_1522007_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 110
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1527310	1527784	2861652		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1527310_1527784_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 111
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1533033	1533831	2861652		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1533033_1533831_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 112
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1538552	1539314	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1538552_1539314_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 113
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1543679	1544723	2861652		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1543679_1544723_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 114
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1551245	1552043	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1551245_1552043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 115
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1555270	1559229	2861652		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1555270_1556998_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793055.1|1557418_1558714_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1558830_1559229_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 116
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1566162	1566906	2861652		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|1566162_1566906_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 117
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1579771	1580332	2861652	integrase	Streptococcus_phage(100.0%)	1	1573925:1573939	1583914:1583928
1573925:1573939	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044966.1|1579771_1580332_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|1579771_1580332_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
1583914:1583928	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 118
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1593357	1596711	2861652		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1593357_1594368_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1594866_1595388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1595415_1596711_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 119
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1604242	1605565	2861652		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1604242_1605565_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 120
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1616869	1617526	2861652		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1616869_1617526_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 121
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1621193	1624515	2861652		Staphylococcus_phage(50.0%)	2	NA	NA
WP_042904850.1|1621193_1622570_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	1.5e-20
WP_000347064.1|1623114_1624515_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
>prophage 122
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1647911	1651851	2861652	transposase	Enterococcus_phage(50.0%)	4	NA	NA
WP_001067261.1|1647911_1648574_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
WP_000454783.1|1648689_1649373_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000076025.1|1649623_1650700_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_000121211.1|1650903_1651851_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
>prophage 123
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1656236	1657424	2861652		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|1656236_1657424_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 124
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1660451	1671405	2861652		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1660451_1662533_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1662655_1663126_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1663191_1663605_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1663702_1663957_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1664093_1667690_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_042904940.1|1667853_1671405_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 125
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1675088	1679871	2861652	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1675088_1675637_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1675649_1675832_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1675887_1676031_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1676145_1676715_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1676795_1677320_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1677319_1678066_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1678073_1678478_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1678470_1679871_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 126
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1685882	1688339	2861652	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1685882_1688339_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 127
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1707423	1717881	2861652	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1707423_1708911_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_016186812.1|1708963_1709056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1709449_1709926_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1709922_1710288_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1710265_1711069_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1711284_1712217_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1712395_1713277_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1713690_1715784_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1716041_1716581_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176721.1|1716585_1717881_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 128
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1727137	1729602	2861652		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1727137_1728103_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252515.1|1728249_1729602_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	1.1e-23
>prophage 129
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1735486	1738584	2861652	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1735486_1737460_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279925.1|1737744_1738584_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 130
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1742490	1743108	2861652		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1742490_1743108_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 131
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1751952	1753650	2861652		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1751952_1753650_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 132
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1770287	1776524	2861652		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1770287_1771292_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_000825534.1|1771625_1772468_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1772504_1773164_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1773167_1774193_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1774483_1775626_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000634110.1|1775618_1776524_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 133
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1800060	1802842	2861652		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1800060_1801293_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1801285_1802842_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 134
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1814329	1814656	2861652	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1814329_1814656_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 135
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1817963	1820996	2861652		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1817963_1819505_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1819529_1820996_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 136
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1830096	1831620	2861652		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1830096_1831620_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 137
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1840772	1861778	2861652	coat,terminase	Staphylococcus_phage(80.95%)	29	NA	NA
WP_000813311.1|1840772_1841285_-	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
WP_073392942.1|1841402_1841840_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000801980.1|1841981_1842950_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_001293071.1|1843226_1843796_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_078104036.1|1843792_1844005_-	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	98.6	1.9e-31
WP_000771361.1|1844136_1844664_-|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_000214170.1|1844716_1845370_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_001288442.1|1845400_1845745_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_001019762.1|1846452_1847094_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
WP_000356942.1|1847090_1847471_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_000447468.1|1847780_1849490_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	8.2e-303
WP_001002709.1|1849503_1850373_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	96.2	5.3e-165
WP_001103967.1|1850437_1850764_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
WP_000403837.1|1850764_1851148_-	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	4.8e-62
WP_001231376.1|1851149_1851353_-	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
WP_000784892.1|1851319_1851493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138305.1|1851504_1851777_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
WP_001611932.1|1851777_1851942_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000230361.1|1852090_1852714_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000400841.1|1854202_1854922_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
WP_000897044.1|1855153_1855396_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000934799.1|1855447_1855951_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1855971_1856268_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1856511_1856703_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1856788_1857886_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1857897_1858101_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1858130_1859012_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1859165_1860011_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655687.1|1860674_1861778_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 138
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1871699	1872542	2861652		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1871699_1872542_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 139
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1893952	1896687	2861652		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280814.1|1893952_1894975_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
WP_001191936.1|1894952_1895897_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449073.1|1895886_1896687_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
>prophage 140
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1901551	1941843	2861652	head,integrase,capsid,terminase,holin,protease,tail,portal	Staphylococcus_phage(84.38%)	65	1917958:1917974	1947398:1947414
WP_000861038.1|1901551_1902307_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000611512.1|1902318_1902573_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_031790389.1|1902624_1902732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072357969.1|1902784_1902961_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	6.5e-22
WP_000539688.1|1903110_1903407_-	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
WP_001040261.1|1903464_1903752_-	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
WP_001153681.1|1903798_1903951_-	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_000582190.1|1903940_1907726_-	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
WP_047210266.1|1907741_1909232_-|tail	phage tail protein	tail	R9QST9	Staphylococcus_phage	98.6	7.9e-294
WP_042904995.1|1909231_1913899_-|tail	phage tail tape measure protein	tail	A0A1V0E5H1	Staphylococcus_phage	84.6	0.0e+00
WP_000571956.1|1913954_1914077_-	hypothetical protein	NA	D2JLF6	Staphylococcus_phage	97.5	2.6e-14
WP_042904996.1|1914136_1914583_-	hypothetical protein	NA	O80053	Staphylococcus_phage	93.2	5.6e-70
WP_000570645.1|1914647_1915601_-|tail	phage tail protein	tail	A7TWD0	Staphylococcus_phage	95.0	6.9e-166
WP_000608369.1|1915601_1915982_-	hypothetical protein	NA	D2JLF3	Staphylococcus_phage	81.7	8.7e-56
WP_000501001.1|1915978_1916356_-	HK97 gp10 family phage protein	NA	D2JLF2	Staphylococcus_phage	86.4	6.2e-54
WP_000671501.1|1916355_1916688_-|head,tail	head-tail adaptor protein	head,tail	D2JLF1	Staphylococcus_phage	83.6	3.3e-51
WP_001177664.1|1916677_1917010_-|head,tail	phage head-tail adapter protein	head,tail	A7TWQ4	Staphylococcus_phage	80.9	4.6e-45
WP_001240639.1|1917018_1917177_-	hypothetical protein	NA	D2JLE9	Staphylococcus_phage	88.5	3.9e-18
WP_042904997.1|1917213_1918449_-|capsid	phage major capsid protein	capsid	Q8SDK8	Staphylococcus_phage	79.2	8.6e-169
1917958:1917974	attL	GCTAGGTGCTTTTTTAA	NA	NA	NA	NA
WP_025173991.1|1918535_1919120_-|head,protease	HK97 family phage prohead protease	head,protease	D2JLE7	Staphylococcus_phage	95.9	3.0e-103
WP_073396983.1|1919538_1920735_-|portal	phage portal protein	portal	D2JLE6	Staphylococcus_phage	87.7	3.8e-198
WP_001052526.1|1920797_1921001_-	hypothetical protein	NA	D2JLE5	Staphylococcus_phage	75.4	4.3e-17
WP_000568449.1|1921014_1922709_-|terminase	terminase	terminase	D2JLE4	Staphylococcus_phage	90.6	3.4e-301
WP_000919030.1|1922708_1923179_-|terminase	phage terminase small subunit P27 family	terminase	D2JLE3	Staphylococcus_phage	93.5	2.6e-78
WP_000026170.1|1923272_1923638_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	72.7	1.5e-49
WP_000406186.1|1923644_1924097_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	D2JLE1	Staphylococcus_phage	88.0	3.3e-70
WP_000282749.1|1924211_1924700_-	hypothetical protein	NA	D2JLE0	Staphylococcus_phage	100.0	3.8e-72
WP_001794311.1|1924722_1924923_-	DUF1514 family protein	NA	D2JLD9	Staphylococcus_phage	100.0	1.4e-28
WP_031872388.1|1925730_1925880_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	98.0	6.3e-18
WP_033840893.1|1925879_1926272_-	phage protein	NA	A7TWI1	Staphylococcus_phage	97.7	1.2e-63
WP_000608279.1|1926255_1926492_-	hypothetical protein	NA	A0A0N7E0U3	Staphylococcus_phage	100.0	1.3e-36
WP_001125014.1|1926488_1926698_-	hypothetical protein	NA	Q4ZBS5	Staphylococcus_virus	98.6	1.7e-29
WP_000195782.1|1926672_1926861_-	DUF1381 domain-containing protein	NA	A0A2I6PDV0	Staphylococcus_phage	100.0	2.1e-26
WP_001209217.1|1926877_1927051_-	hypothetical protein	NA	A0A2I6PEA8	Staphylococcus_phage	100.0	3.6e-25
WP_031770404.1|1927087_1927624_-	dUTPase	NA	A0A1P8L6E0	Staphylococcus_phage	99.4	6.1e-95
WP_042904999.1|1927616_1927865_-	DUF1024 family protein	NA	A7TWB0	Staphylococcus_phage	96.3	1.6e-37
WP_042905000.1|1927879_1928128_-	phage protein	NA	A0A2I6PDI0	Staphylococcus_phage	96.3	1.0e-41
WP_000029380.1|1928128_1928488_-	hypothetical protein	NA	Q8SDV7	Staphylococcus_phage	99.2	7.7e-62
WP_000772916.1|1928499_1928757_-	helix-turn-helix transcriptional regulator	NA	Q4ZBU1	Staphylococcus_virus	100.0	4.1e-41
WP_001187263.1|1928757_1928943_-	DUF3113 family protein	NA	Q8SDV9	Staphylococcus_phage	100.0	2.4e-27
WP_000049812.1|1928947_1929352_-	DUF1064 domain-containing protein	NA	A0A059T5A5	Staphylococcus_phage	97.0	3.5e-71
WP_042905001.1|1929362_1929584_-	DUF3269 family protein	NA	Q4ZA48	Staphylococcus_virus	98.6	4.9e-35
WP_031794786.1|1929586_1929802_-	hypothetical protein	NA	Q4ZBU5	Staphylococcus_virus	98.6	1.8e-34
WP_031794787.1|1929798_1931040_-	AAA family ATPase	NA	Q4ZCW6	Staphylococcus_virus	99.8	5.7e-229
WP_001132247.1|1931036_1931393_-	hypothetical protein	NA	B7T0A8	Staphylococcus_virus	97.5	2.2e-61
WP_042905004.1|1931392_1932211_-	DnaD domain protein	NA	Q8SDW2	Staphylococcus_phage	98.5	1.2e-105
WP_042905006.1|1932182_1932875_-	phi PV83 orf 19-like protein	NA	Q4ZAZ0	Staphylococcus_virus	98.7	6.8e-131
WP_011447037.1|1932887_1933388_-	single-strand DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	100.0	7.2e-90
WP_000137071.1|1933471_1934251_-	ATP-binding protein	NA	Q8SDW5	Staphylococcus_phage	100.0	2.5e-142
WP_000999048.1|1934251_1934788_-	hypothetical protein	NA	A0A2I6PD93	Staphylococcus_phage	100.0	1.7e-81
WP_042905007.1|1934800_1935061_-	DUF1108 family protein	NA	Q4ZAD8	Staphylococcus_virus	97.7	6.4e-42
WP_000138304.1|1935041_1935371_-	hypothetical protein	NA	D2JGJ7	Staphylococcus_phage	100.0	1.4e-33
WP_001285954.1|1935463_1935625_-	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_001124160.1|1935637_1935901_-	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
WP_001097552.1|1935925_1936141_-	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001128433.1|1936195_1936561_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001025401.1|1936529_1936775_-	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_000187184.1|1936814_1937039_-	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
WP_042905009.1|1937039_1937819_-	antirepressor	NA	M1RZB2	Staphylococcus_phage	98.0	5.8e-139
WP_001153965.1|1937975_1938284_-	hypothetical protein	NA	S4V9P0	Staphylococcus_phage	100.0	1.3e-49
WP_001198673.1|1938298_1938517_-	helix-turn-helix transcriptional regulator	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
WP_000358220.1|1938658_1939378_+	helix-turn-helix transcriptional regulator	NA	Q8SDX2	Staphylococcus_phage	100.0	9.8e-133
WP_000705240.1|1939576_1939759_+	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_015994736.1|1939904_1940528_-	hypothetical protein	NA	B7T0F3	Staphylococcus_virus	100.0	2.0e-105
WP_000264185.1|1940637_1941843_+|integrase	site-specific integrase	integrase	A7YGM7	Staphylococcus_virus	99.8	2.9e-222
1947398:1947414	attR	GCTAGGTGCTTTTTTAA	NA	NA	NA	NA
>prophage 141
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1956016	1956694	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|1956016_1956694_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 142
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1970746	1975195	2861652		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549309.1|1970746_1975195_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 143
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1985799	1987461	2861652		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1985799_1986459_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_000736790.1|1986510_1987461_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 144
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	1996268	1997705	2861652		Pandoravirus(100.0%)	1	NA	NA
WP_000163983.1|1996268_1997705_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 145
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2004213	2008757	2861652		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925396.1|2004213_2005953_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|2006218_2006893_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|2007032_2008757_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 146
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2026885	2028415	2861652		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|2026885_2028415_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 147
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2038100	2039606	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|2038100_2039606_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 148
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2050567	2055926	2861652		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|2050567_2052817_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837114.1|2053404_2054373_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127979.1|2054369_2055926_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 149
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2066237	2068296	2861652		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|2066237_2067335_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|2067717_2068296_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 150
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2076107	2077700	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|2076107_2077700_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 151
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2093792	2094977	2861652		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|2093792_2094977_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 152
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2099835	2110119	2861652		Tupanvirus(50.0%)	3	NA	NA
WP_000605273.1|2099835_2107011_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
WP_000826855.1|2107457_2108708_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|2109093_2110119_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 153
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2113655	2116654	2861652		Bacillus_virus(50.0%)	4	NA	NA
WP_000590840.1|2113655_2114396_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|2114737_2115250_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|2115429_2115633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013476.1|2115694_2116654_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 154
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2119995	2122480	2861652		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|2119995_2121141_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_042904929.1|2121217_2122480_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	24.8	4.3e-22
>prophage 155
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2129497	2136062	2861652		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|2129497_2130622_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|2130625_2131735_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|2131747_2132776_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|2132765_2134589_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565301.1|2134608_2135373_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|2135375_2136062_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 156
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2140085	2141261	2861652		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|2140085_2141261_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 157
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2146719	2147493	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|2146719_2147493_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 158
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2155379	2155979	2861652		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|2155379_2155979_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 159
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2160913	2166008	2861652		Catovirus(50.0%)	5	NA	NA
WP_001793810.1|2160913_2161894_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_000183771.1|2162228_2163005_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414632.1|2163215_2163842_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|2164037_2164802_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|2164805_2166008_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 160
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2174274	2178484	2861652		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|2174274_2175255_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045124.1|2175485_2176478_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|2176493_2177489_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|2177485_2178484_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 161
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2210555	2215890	2861652	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2210555_2212256_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2212545_2212920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2213105_2214053_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000370465.1|2214057_2214573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2214760_2215890_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 162
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2221770	2231766	2861652		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2221770_2222571_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2222958_2223747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060146.1|2223747_2225082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042904936.1|2225074_2226901_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.8e-30
WP_000101976.1|2226913_2227615_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2228804_2230088_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2230365_2231766_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 163
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2238448	2247484	2861652	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2238448_2239735_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2240112_2241627_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000449218.1|2241952_2242765_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2242852_2245513_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2245549_2247484_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 164
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2257571	2260871	2861652		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2257571_2258411_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_000491382.1|2258905_2259259_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2259326_2259722_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2259974_2260544_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2260670_2260871_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 165
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2266664	2267423	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154162.1|2266664_2267423_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 166
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2284566	2286279	2861652		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138663.1|2284566_2286279_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 167
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2291907	2292921	2861652		Faustovirus(100.0%)	1	NA	NA
WP_000639198.1|2291907_2292921_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 168
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2305311	2306004	2861652		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2305311_2306004_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 169
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2329879	2331739	2861652		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125631.1|2329879_2331739_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 170
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2357432	2359183	2861652		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2357432_2358320_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2358427_2359183_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 171
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2362620	2363118	2861652		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2362620_2363118_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 172
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2368168	2370552	2861652		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2368168_2370019_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2370015_2370552_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 173
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2375428	2385539	2861652	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2375428_2377138_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2377415_2377628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2377907_2378351_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172333.1|2378544_2380143_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001793854.1|2380202_2380403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2380829_2382326_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2382518_2383409_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2383531_2383948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2384201_2385539_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 174
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2413694	2416894	2861652		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2413694_2414396_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2415082_2416894_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 175
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2425333	2429719	2861652		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2425333_2426332_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2426421_2426628_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2427310_2429719_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 176
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2438960	2441950	2861652	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2438960_2441066_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_000262597.1|2441428_2441950_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 177
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2448374	2454757	2861652		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2448374_2450114_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473682.1|2450413_2452480_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2452859_2453270_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2453311_2453668_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2453788_2454757_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 178
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2463581	2464574	2861652		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2463581_2464574_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 179
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2473990	2474686	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2473990_2474686_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 180
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2493144	2502124	2861652	transposase	Bacillus_phage(50.0%)	7	NA	NA
WP_094409958.1|2493144_2494711_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000721330.1|2494948_2495815_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
WP_042904951.1|2495941_2496250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2496393_2496660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001793882.1|2496943_2498752_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000755954.1|2498868_2499261_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042904950.1|2499262_2502124_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 181
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2512940	2513759	2861652		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2512940_2513759_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 182
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2521824	2523382	2861652		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2521824_2522640_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2522632_2523382_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 183
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2529615	2534042	2861652		Bacillus_phage(50.0%)	4	NA	NA
WP_000923514.1|2529615_2530278_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072154.1|2530270_2531047_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026190.1|2531440_2532628_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700902.1|2532689_2534042_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 184
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2537435	2538662	2861652		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2537435_2538662_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 185
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2557038	2563245	2861652		Bacillus_phage(66.67%)	5	NA	NA
WP_001176855.1|2557038_2558181_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779351.1|2558448_2558835_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2558968_2559076_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064829.1|2559723_2561487_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000486505.1|2561511_2563245_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 186
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2566706	2572460	2861652		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2566706_2567822_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2567832_2568525_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200947.1|2568535_2569003_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2569054_2570032_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2570033_2570981_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2571530_2572460_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 187
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2580353	2581085	2861652		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2580353_2581085_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 188
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2597948	2599508	2861652		Escherichia_phage(100.0%)	1	NA	NA
WP_000692650.1|2597948_2599508_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 189
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2610238	2611885	2861652	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2610238_2611885_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 190
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2622826	2623861	2861652		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2622826_2623861_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 191
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2634324	2640881	2861652		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000388431.1|2634324_2635053_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
WP_000372857.1|2635186_2635750_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2635926_2636382_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2636378_2636822_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477322.1|2636984_2638358_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000249492.1|2638350_2639025_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2639160_2640216_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2640215_2640881_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 192
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2644618	2645827	2861652		Salmonella_phage(100.0%)	1	NA	NA
WP_000999130.1|2644618_2645827_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 193
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2658483	2659383	2861652		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2658483_2659383_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 194
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2666740	2667160	2861652		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2666740_2667160_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 195
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2672851	2673733	2861652		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2672851_2673733_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 196
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2681612	2682248	2861652		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2681612_2682248_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 197
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2690684	2692251	2861652	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_094409958.1|2690684_2692251_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
>prophage 198
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2696915	2701182	2861652		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2696915_2697554_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2698162_2699287_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2699378_2700332_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_000737700.1|2700690_2701182_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 199
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2705102	2705912	2861652		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2705102_2705912_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 200
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2724885	2725491	2861652		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2724885_2725491_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 201
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2737458	2740626	2861652		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2737458_2740626_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 202
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2763805	2767415	2861652	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
WP_094409958.1|2763805_2765373_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000389651.1|2765748_2766558_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2766554_2767415_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 203
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2770456	2779019	2861652		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204271.1|2770456_2771893_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
WP_000136272.1|2772141_2772321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2772970_2773153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2773622_2775287_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2775323_2776028_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2776418_2776844_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2777138_2777954_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2778164_2779019_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 204
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2782397	2785460	2861652		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2782397_2783246_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2783466_2783592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2783546_2783840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2783853_2784462_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2784719_2785460_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 205
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2791780	2793193	2861652		Pandoravirus(100.0%)	1	NA	NA
WP_042904975.1|2791780_2793193_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.7	1.9e-47
>prophage 206
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2797161	2798724	2861652		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2797161_2798724_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 207
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2808927	2809896	2861652		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2808927_2809896_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 208
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2825696	2826605	2861652		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2825696_2826605_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 209
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2843847	2851265	2861652	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000334466.1|2843847_2845653_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2845884_2846667_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_042904853.1|2846734_2847592_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001792784.1|2848250_2848409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392962.1|2849088_2849193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277709.1|2849618_2851265_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
>prophage 210
NZ_CP026071	Staphylococcus aureus strain FDAARGOS_30 chromosome, complete genome	2861652	2859771	2860215	2861652		Clostridium_phage(100.0%)	1	NA	NA
WP_000070866.1|2859771_2860215_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
