The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	426873	489225	5675007	integrase,tRNA,transposase	Orpheovirus(18.18%)	41	470705:470720	494972:494987
WP_000377332.1|426873_428172_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	38.5	1.8e-76
WP_001167912.1|428713_429193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|429335_430680_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000482274.1|430737_432249_-	peptidase M36	NA	NA	NA	NA	NA
WP_000045222.1|432579_433164_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001093123.1|433165_434251_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_000754899.1|434301_437403_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	31.9	5.7e-153
WP_000275558.1|442329_442821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498601.1|442932_443151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621475.1|443180_443510_-	DUF2085 domain-containing protein	NA	NA	NA	NA	NA
WP_000384921.1|443622_445311_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	8.1e-77
WP_000637451.1|445611_446388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063706.1|446437_446872_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000634884.1|446955_447339_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_000692580.1|447342_448470_-	PBS lyase	NA	NA	NA	NA	NA
WP_000714949.1|448887_449448_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001082769.1|449784_450117_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	61.1	1.1e-33
WP_001259000.1|450457_451549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089284.1|452824_453334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021280.1|453647_453884_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734833.1|454042_458104_-	ATP-binding protein	NA	A0A2H4PQT3	Staphylococcus_phage	34.7	2.9e-96
WP_000239530.1|458326_459280_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000829601.1|459571_460669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000451337.1|461492_462230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520934.1|466609_467338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289510.1|467339_469049_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000249670.1|469041_471786_-	hypothetical protein	NA	NA	NA	NA	NA
470705:470720	attL	ATAAATTTAAACCACA	NA	NA	NA	NA
WP_000266759.1|471766_472390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|472531_473827_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|473816_474569_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001053969.1|475567_477004_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|477323_477734_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|477882_479313_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000975140.1|479669_479924_-	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_001260655.1|480029_480761_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000783186.1|480836_482732_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.5	2.2e-46
WP_000165969.1|482728_483376_-	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	9.5e-10
WP_000499723.1|483485_484250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709202.1|484546_484672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000109863.1|484668_485742_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.7	1.8e-74
WP_001028065.1|487215_489225_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
494972:494987	attR	TGTGGTTTAAATTTAT	NA	NA	NA	NA
>prophage 2
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	583963	645233	5675007	portal,bacteriocin,integrase,protease,terminase,capsid,head,transposase,tail	Bacillus_phage(90.91%)	73	583602:583620	630512:630530
583602:583620	attL	TAAGAAACACTGTGACCAT	NA	NA	NA	NA
WP_000730123.1|583963_584788_+	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	2.1e-99
WP_000551102.1|584797_585418_-	hypothetical protein	NA	H0USY2	Bacillus_phage	96.1	8.3e-112
WP_000891545.1|585359_586541_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_000170790.1|586656_586839_-	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	90.0	1.1e-21
WP_001257568.1|586835_587150_-	hypothetical protein	NA	H0USY0	Bacillus_phage	96.2	7.7e-50
WP_000941958.1|587338_587545_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	41.5	4.1e-07
WP_000669561.1|587544_588348_+	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	5.4e-23
WP_000751888.1|588416_589481_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	93.8	5.4e-196
WP_000389067.1|589477_589708_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
WP_000499524.1|590003_591197_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_000822831.1|591331_592291_-|integrase	site-specific integrase	integrase	A0A0U3B271	Bacillus_phage	94.4	1.2e-173
WP_038413468.1|592392_596418_-	phage minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	89.9	0.0e+00
WP_038413466.1|596414_597899_-|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	99.4	1.9e-295
WP_038415467.1|597910_601759_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	88.8	0.0e+00
WP_078405533.1|601773_602037_-	hypothetical protein	NA	I3WTY5	Bacillus_phage	88.7	5.3e-20
WP_000169371.1|602580_603888_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|604061_604241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015382186.1|605615_605933_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	98.1	1.3e-52
WP_000896775.1|605980_606586_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	88.6	1.1e-95
WP_015382185.1|606586_606946_-	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	95.8	2.7e-59
WP_015382184.1|606942_607377_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	99.3	2.3e-76
WP_015382183.1|607369_607693_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	98.1	7.4e-56
WP_000244586.1|607679_607967_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_000361137.1|607987_609154_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_001259159.1|609191_609902_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000577489.1|609888_611142_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_000621131.1|611330_613025_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000233390.1|613026_613530_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_001139454.1|613659_614037_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000870105.1|614026_614281_-	hypothetical protein	NA	W8CYT4	Bacillus_phage	97.6	1.3e-42
WP_000773601.1|614415_614628_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000002725.1|614644_614884_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000443965.1|614918_615098_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000464752.1|615143_615371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|615407_615695_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_015382276.1|616097_616343_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_001012176.1|616549_617092_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_000166155.1|617088_617574_-	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_000965619.1|617931_618213_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|619621_620029_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_155403433.1|620052_620226_-	hypothetical protein	NA	W8CYZ6	Bacillus_phage	100.0	2.0e-28
WP_001098845.1|620382_620682_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|620832_621132_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|621128_621344_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|621361_621526_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|621597_621864_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|621905_622718_-	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382274.1|622680_623697_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	97.6	2.0e-187
WP_038415676.1|623940_624588_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.3	3.9e-112
WP_000176230.1|624611_624920_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	92.6	2.2e-41
WP_015382272.1|625081_625825_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	76.4	2.9e-103
WP_003284082.1|625870_626041_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	94.1	2.8e-22
WP_000549467.1|626050_626239_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	95.2	1.4e-25
WP_000714354.1|626314_626521_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000258007.1|626696_627041_+	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.2e-14
WP_000936291.1|627439_628660_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.2e-108
WP_000237493.1|629399_630491_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.8	8.1e-163
WP_001166434.1|630822_631413_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
630512:630530	attR	TAAGAAACACTGTGACCAT	NA	NA	NA	NA
WP_002004921.1|631502_632657_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000226253.1|632727_633696_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000741975.1|633698_634127_-	NfeD family protein	NA	NA	NA	NA	NA
WP_001245226.1|634401_635619_+	MFS transporter	NA	NA	NA	NA	NA
WP_000405394.1|635668_637144_-	amidase	NA	NA	NA	NA	NA
WP_000178288.1|637326_637773_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000747647.1|637796_638537_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_000617573.1|638548_639046_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001079274.1|639301_640456_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000770738.1|640544_640841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016109792.1|640845_641151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435828.1|641123_641690_-	DUF1572 domain-containing protein	NA	NA	NA	NA	NA
WP_001263016.1|641670_642000_-	chaperone CsaA	NA	NA	NA	NA	NA
WP_000839661.1|642065_643412_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_087942842.1|643888_645233_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
>prophage 3
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	659043	719156	5675007	coat,transposase,protease	Bacillus_phage(23.53%)	60	NA	NA
WP_000937997.1|659043_660120_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000817485.1|660301_660844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000858822.1|660890_661502_-	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000943769.1|662074_662491_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
WP_000824280.1|662550_664212_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002098546.1|664296_665283_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000283913.1|665308_665761_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_001083648.1|665894_666932_+	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_001042736.1|666961_667621_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000169371.1|668452_669760_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|669933_670113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002132987.1|671300_671522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126151.1|671786_672737_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001048676.1|672875_673346_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000613420.1|673458_674409_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001040871.1|674506_675976_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.7	2.7e-68
WP_000376357.1|676237_677140_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_001068749.1|677164_677749_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001168116.1|677833_679297_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.3	1.2e-15
WP_000683357.1|679474_679666_+	DUF3896 domain-containing protein	NA	NA	NA	NA	NA
WP_000594031.1|679770_680772_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087942833.1|680884_682226_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000798320.1|682287_683232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000488206.1|683447_683903_-	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000105199.1|684005_684449_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000370203.1|684689_685730_+	membrane protein	NA	NA	NA	NA	NA
WP_000965059.1|685764_686130_-	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
WP_000539571.1|686452_686758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517294.1|686954_688937_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.5e-23
WP_001073075.1|689137_690190_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000426317.1|691095_691443_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|691527_691752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|691951_692314_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_001101741.1|692457_692664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082497.1|692712_693888_-	MFS transporter	NA	NA	NA	NA	NA
WP_000874082.1|693935_694871_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001259906.1|694977_695286_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000099756.1|695327_696275_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_000648325.1|696549_696837_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.5	1.2e-12
WP_001026002.1|696952_698833_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000174901.1|699108_699927_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_000024999.1|699976_700438_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	8.5e-05
WP_001048102.1|700469_700667_-	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000520856.1|700772_701933_-	peptidase	NA	NA	NA	NA	NA
WP_001034835.1|702083_702836_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000540423.1|703059_703200_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000686789.1|703287_704253_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	31.2	1.1e-25
WP_000816391.1|704366_704534_-	DUF3933 domain-containing protein	NA	NA	NA	NA	NA
WP_000439399.1|704546_705989_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001287305.1|706107_706722_+	amino acid transporter	NA	NA	NA	NA	NA
WP_033667350.1|706775_708005_-	MFS transporter	NA	NA	NA	NA	NA
WP_000113545.1|708240_708447_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_000877670.1|708571_709414_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000200704.1|709451_710435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001250558.1|710458_710725_-	petrobactin biosynthesis protein AsbD	NA	NA	NA	NA	NA
WP_000909581.1|710721_711960_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_000275580.1|713270_714566_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|714555_715308_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_001163356.1|716033_717842_-	Petrobactin biosynthesis protein AsbA	NA	NA	NA	NA	NA
WP_000710470.1|717998_719156_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	1.8e-123
>prophage 4
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	739115	747266	5675007		Bacillus_phage(66.67%)	7	NA	NA
WP_001258538.1|739115_739988_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
WP_000818979.1|740278_740998_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001231621.1|741287_742361_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000612414.1|742357_743035_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_000453861.1|743120_744881_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_001194306.1|745121_745886_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755525.1|745985_747266_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
>prophage 5
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	1410172	1485239	5675007	portal,holin,protease,tRNA,terminase,capsid,head,transposase,tail	Bacillus_phage(46.15%)	85	NA	NA
WP_000110985.1|1410172_1411162_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000966128.1|1411442_1412189_-	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	40.5	8.0e-45
WP_000513275.1|1412332_1413121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412656.1|1413227_1414466_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_001100533.1|1414497_1415430_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_001986215.1|1415967_1416144_-	competence protein ComG	NA	NA	NA	NA	NA
WP_000487722.1|1416198_1417071_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001211116.1|1417990_1418173_+	YjzD family protein	NA	NA	NA	NA	NA
WP_000365401.1|1418211_1420812_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.1	2.4e-120
WP_000531421.1|1421021_1421201_-	YjzC family protein	NA	NA	NA	NA	NA
WP_001041232.1|1421692_1422502_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000516816.1|1422607_1422748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527407.1|1422748_1422946_+	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_000364432.1|1422971_1423829_-	YitT family protein	NA	NA	NA	NA	NA
WP_001120849.1|1423929_1424079_+	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_001214215.1|1424208_1425066_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_001153798.1|1425105_1425369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548429.1|1425588_1426074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281260.1|1426492_1427347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040149.1|1427577_1428069_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_000397871.1|1428930_1429242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103580702.1|1429542_1430784_-	alpha-amylase	NA	NA	NA	NA	NA
WP_000367127.1|1431057_1432293_+	ammonium transporter	NA	NA	NA	NA	NA
WP_000076219.1|1432413_1433055_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001238640.1|1433231_1433468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003283577.1|1433488_1434115_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_000148974.1|1434222_1434456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619724.1|1434445_1434742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190887.1|1434755_1439294_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.1	7.2e-72
WP_000486133.1|1439339_1439690_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_001069180.1|1440501_1441968_-	catalase	NA	A0A2K9L572	Tupanvirus	47.4	1.0e-123
WP_000163133.1|1442027_1442987_-	ferrochelatase	NA	NA	NA	NA	NA
WP_000730207.1|1443465_1444299_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.9	2.6e-121
WP_000100788.1|1444316_1444607_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_001016122.1|1444631_1444850_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000742862.1|1444989_1445556_+	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_000405773.1|1445721_1446654_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.2	3.3e-157
WP_000373898.1|1446653_1447079_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_001004976.1|1447116_1447491_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	98.4	2.7e-65
WP_015382232.1|1447506_1452351_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.4	0.0e+00
WP_000094123.1|1452347_1453817_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.6	2.8e-235
WP_015382231.1|1453858_1457491_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.1	2.4e-182
WP_000415929.1|1457721_1458084_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.0	6.8e-42
WP_001004921.1|1458090_1458684_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_000172080.1|1458684_1459014_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.9e-47
WP_001273706.1|1459010_1459367_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.7	3.0e-34
WP_000998123.1|1459359_1459659_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_000600950.1|1459655_1459928_-	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	53.9	3.0e-18
WP_001016250.1|1459924_1460182_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_001031425.1|1460197_1461382_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	24.4	5.1e-09
WP_000361708.1|1461398_1461983_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_000499523.1|1462279_1463473_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000522435.1|1463567_1464746_-|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_033676369.1|1464759_1466448_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.6	3.9e-249
WP_001282601.1|1466456_1466819_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_001149928.1|1466911_1467307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001051281.1|1467309_1467612_-	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	48.5	1.5e-18
WP_000196707.1|1467628_1467829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499523.1|1468100_1469294_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_071686481.1|1469590_1469773_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_000711196.1|1469824_1470244_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_033676375.1|1470626_1471028_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.8e-67
WP_038413362.1|1471065_1471392_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	97.2	2.3e-57
WP_000540088.1|1471388_1471916_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.3	5.4e-96
WP_000590880.1|1471951_1472263_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	83.5	2.9e-41
WP_000389429.1|1472496_1472901_-	hypothetical protein	NA	I6TG10	Staphylococcus_virus	37.1	7.7e-10
WP_000356654.1|1473060_1473243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093039.1|1473327_1474119_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_001268033.1|1474265_1474556_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	94.8	8.4e-51
WP_001010921.1|1474614_1475049_-	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	95.1	1.3e-76
WP_015382228.1|1475087_1475645_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	71.4	4.0e-65
WP_000139235.1|1475668_1475899_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_000933912.1|1475891_1476371_-	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	93.7	1.3e-80
WP_000510888.1|1476382_1477336_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	6.4e-148
WP_038413358.1|1477429_1477768_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	2.6e-51
WP_015382226.1|1477700_1477916_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	5.5e-31
WP_000178947.1|1477915_1478629_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.0e-126
WP_000453494.1|1478647_1479082_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.1e-73
WP_001186272.1|1479108_1479297_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_000372563.1|1479308_1480061_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	81.0	4.8e-106
WP_000385074.1|1480543_1480816_-	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_000130922.1|1480965_1481649_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.2	1.3e-22
WP_000289677.1|1481664_1481883_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000650392.1|1482026_1483430_+	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000333967.1|1483460_1485239_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	1.6e-22
>prophage 6
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	1956946	2011321	5675007	portal,integrase,protease,terminase,capsid,head,transposase,tail	Bacillus_phage(92.98%)	64	1959563:1959581	2001556:2001574
WP_000948949.1|1956946_1958263_-	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.1	5.3e-07
WP_000373746.1|1958250_1959423_-	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
1959563:1959581	attL	AATGATCAGAGTAATCATT	NA	NA	NA	NA
WP_000730127.1|1959920_1960802_+	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000842173.1|1960806_1961415_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000511371.1|1961404_1962571_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000495118.1|1962581_1962902_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000467327.1|1963364_1963586_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000423300.1|1963654_1963984_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000542506.1|1964024_1964843_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_001076454.1|1964842_1965055_-	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_000151530.1|1965057_1965339_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_000822820.1|1965352_1966312_-|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.7	3.1e-182
WP_015382189.1|1966408_1970434_-	minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	100.0	0.0e+00
WP_000232880.1|1970430_1971915_-|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	100.0	9.9e-297
WP_038413316.1|1971926_1975853_-|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	100.0	0.0e+00
WP_000344048.1|1975867_1976044_-	hypothetical protein	NA	I3WTY5	Bacillus_phage	100.0	1.1e-26
WP_000779042.1|1976073_1976391_-	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	100.0	8.9e-54
WP_000896661.1|1976437_1977043_-|tail	tail protein	tail	A0A0S2GLI0	Bacillus_phage	100.0	9.2e-100
WP_000609197.1|1977043_1977403_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	100.0	3.5e-62
WP_000763223.1|1977399_1977837_-	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	100.0	7.9e-77
WP_001068030.1|1977829_1978153_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	100.0	1.1e-56
WP_000244586.1|1978139_1978427_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382182.1|1978447_1979614_-|capsid	phage major capsid protein	capsid	A0A0S2GLG0	Bacillus_phage	100.0	3.3e-210
WP_015382181.1|1979651_1980362_-|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	100.0	5.5e-128
WP_015382180.1|1980348_1981602_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_015382179.1|1981790_1983485_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_000233388.1|1983486_1983990_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_001139459.1|1984118_1984496_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	100.0	6.8e-69
WP_001198493.1|1984485_1984740_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	100.0	3.9e-44
WP_000778983.1|1984875_1985088_-	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	100.0	2.7e-30
WP_000002720.1|1985104_1985344_-	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	98.7	5.2e-22
WP_000443964.1|1985372_1985558_-	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	100.0	8.6e-25
WP_001050326.1|1985606_1986473_-	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	100.0	2.8e-166
WP_000792998.1|1986554_1986737_-	hypothetical protein	NA	A0A0S2GLH0	Bacillus_phage	100.0	3.1e-27
WP_015382178.1|1987108_1987354_-	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	100.0	9.0e-38
WP_001012176.1|1987560_1988103_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382492.1|1988099_1988585_-	transcription regulator	NA	A0A0S2GLJ9	Bacillus_phage	100.0	7.9e-86
WP_000965619.1|1988942_1989224_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|1990631_1991039_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_155403433.1|1991062_1991236_-	hypothetical protein	NA	W8CYZ6	Bacillus_phage	100.0	2.0e-28
WP_001098845.1|1991392_1991692_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|1991842_1992142_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|1992138_1992354_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|1992371_1992536_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|1992607_1992874_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|1992915_1993728_-	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382176.1|1993690_1994707_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_000123128.1|1994930_1995578_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_000218620.1|1995852_1996167_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_015382175.1|1996328_1997108_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	100.0	1.6e-141
WP_000549466.1|1997333_1997522_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_000813892.1|1997554_1997791_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000511082.1|1997939_1998284_+	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000466636.1|1998683_1999922_-	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000262047.1|2000439_2001540_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_000676802.1|2001478_2002525_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
2001556:2001574	attR	AATGATCAGAGTAATCATT	NA	NA	NA	NA
WP_000730997.1|2002601_2003453_-	phospholipase C	NA	NA	NA	NA	NA
WP_087970930.1|2003794_2004953_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000948209.1|2004997_2005342_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000645827.1|2005461_2006514_-	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000873276.1|2006739_2007894_+	MFS transporter	NA	NA	NA	NA	NA
WP_000964468.1|2007814_2008240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658667.1|2008261_2008603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001252962.1|2008921_2011321_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	2282229	2396835	5675007	portal,integrase,protease,tRNA,terminase,capsid,head,transposase,tail	Bacillus_phage(59.32%)	118	2331213:2331241	2379098:2379126
WP_000275580.1|2282229_2283525_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000619194.1|2283976_2284660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081906.1|2284816_2285506_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000113948.1|2285707_2286670_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000503399.1|2286707_2288123_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_000930287.1|2288222_2289221_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000682331.1|2289251_2290484_-	arginine deiminase	NA	NA	NA	NA	NA
WP_000711827.1|2290752_2291202_-	arginine repressor	NA	NA	NA	NA	NA
WP_000410233.1|2291348_2292641_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.7	9.1e-12
WP_000616925.1|2292851_2293574_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.4e-33
WP_000823769.1|2293696_2294491_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003283038.1|2294534_2295290_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000661226.1|2295343_2296429_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_001053969.1|2297774_2299211_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_001182683.1|2300346_2301648_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000147471.1|2302554_2303664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000862985.1|2304010_2304643_+	cyclase family protein	NA	NA	NA	NA	NA
WP_000424119.1|2304670_2305051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046104.1|2305279_2306506_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_000434752.1|2306643_2307909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004265.1|2308147_2308816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000443836.1|2308977_2309427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000051528.1|2309447_2309957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276022.1|2310192_2310423_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000235475.1|2310618_2310987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078266.1|2311182_2312232_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000732593.1|2312565_2313483_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002100683.1|2313531_2314572_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000983744.1|2314568_2315576_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000926553.1|2315621_2316263_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_033679657.1|2316316_2317363_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000033255.1|2317372_2318602_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_000924420.1|2319193_2319757_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000599501.1|2319771_2321298_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	1.2e-18
WP_001005631.1|2321331_2321937_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000853511.1|2322171_2323287_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000972812.1|2324989_2326261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704490.1|2326354_2327464_+	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.6	5.0e-19
WP_000217543.1|2327478_2328174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233735.1|2328374_2329082_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001251702.1|2329177_2329696_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	36.5	4.3e-21
WP_000566707.1|2330046_2331036_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
2331213:2331241	attL	CCAAGCCACACACTCCACATGAGTCGTAT	NA	NA	NA	NA
WP_000477499.1|2331695_2332793_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_001028065.1|2332789_2334799_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000247457.1|2334791_2335196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349585.1|2335264_2336056_-	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000027993.1|2336096_2336870_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000794364.1|2336958_2337747_-	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_002133890.1|2338043_2338352_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_000542507.1|2338396_2339215_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	95.6	1.6e-158
WP_000159646.1|2339214_2339421_-	hypothetical protein	NA	D2XR32	Bacillus_phage	97.1	1.3e-32
WP_000215408.1|2339423_2339705_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	81.7	2.4e-34
WP_000354142.1|2339741_2340119_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.5	8.4e-35
WP_015382161.1|2340135_2344530_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	63.6	0.0e+00
WP_015382160.1|2344526_2345996_-	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	78.3	6.5e-232
WP_044157404.1|2346035_2351033_-|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	81.6	0.0e+00
WP_015382157.1|2351197_2351572_-	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_001251821.1|2351628_2352213_-|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_001243517.1|2352228_2352591_-	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	84.2	2.4e-55
WP_000818832.1|2352587_2353025_-	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	80.7	4.5e-64
WP_001068032.1|2353012_2353357_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	71.1	7.0e-44
WP_000904085.1|2353353_2353647_-	hypothetical protein	NA	A0A0A7S0C9	Clostridium_phage	39.6	4.6e-12
WP_001123701.1|2353681_2354854_-|capsid	phage major capsid protein	capsid	A0A2H4JHG1	uncultured_Caudovirales_phage	62.5	2.4e-128
WP_002134054.1|2354891_2355590_-|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	59.0	2.7e-71
WP_000499523.1|2355880_2357074_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000264107.1|2357168_2358389_-|portal	phage portal protein	portal	A6M949	Geobacillus_virus	53.0	5.4e-123
WP_001082759.1|2358402_2360118_-|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	63.2	5.3e-217
WP_000113652.1|2360127_2360649_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	63.7	5.6e-53
WP_000924768.1|2360747_2361161_-	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	43.0	1.6e-23
WP_000869623.1|2361141_2361387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091354.1|2361389_2361554_-	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	64.4	2.0e-09
WP_002134055.1|2361558_2361786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002735.1|2361782_2362217_-	hypothetical protein	NA	A0A0A7AQA1	Bacillus_phage	55.0	4.3e-14
WP_000370222.1|2362209_2362452_-	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	87.5	1.1e-30
WP_016090301.1|2363097_2363640_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000166188.1|2363639_2364122_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.1e-71
WP_001226456.1|2364448_2364835_-	hypothetical protein	NA	I7I4E2	Bacillus_phage	100.0	5.2e-72
WP_000873130.1|2364954_2365233_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	100.0	8.1e-43
WP_000351065.1|2365229_2365427_-	hypothetical protein	NA	I7IDJ9	Bacillus_phage	100.0	5.6e-30
WP_002134061.1|2365672_2366038_-	hypothetical protein	NA	I7J6W4	Bacillus_phage	100.0	3.6e-59
WP_000350118.1|2366278_2366707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000670920.1|2367048_2367258_-	hypothetical protein	NA	A0A068EPB6	Bacillus_phage	47.1	2.4e-07
WP_001268380.1|2367297_2367570_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	58.1	2.7e-19
WP_000455138.1|2367613_2367997_-	hypothetical protein	NA	Q2LI92	Bacillus_phage	44.1	1.1e-24
WP_001030635.1|2368026_2368560_-	hypothetical protein	NA	U5PUK4	Bacillus_phage	59.4	4.4e-53
WP_000323893.1|2368552_2368750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000331942.1|2368785_2369175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001134294.1|2369219_2369693_-	hypothetical protein	NA	A0A0H3UZ60	Geobacillus_virus	57.5	2.7e-30
WP_001054607.1|2369733_2370243_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	44.9	1.4e-27
WP_000109543.1|2370262_2370514_-	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	2.2e-07
WP_000717829.1|2370539_2370707_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	64.2	9.5e-15
WP_001125972.1|2370725_2371085_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	54.2	4.9e-32
WP_000799098.1|2371077_2371356_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	1.6e-11
WP_000337984.1|2371372_2371567_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	81.2	6.5e-23
WP_001148230.1|2371569_2372433_-	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	94.9	3.1e-133
WP_000190244.1|2372380_2373121_-	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	82.5	2.4e-81
WP_000969632.1|2373331_2373499_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	79.6	6.0e-17
WP_001246222.1|2373495_2373846_-	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	87.1	7.5e-54
WP_000022043.1|2373842_2374085_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6B2	Bacillus_phage	83.3	1.1e-24
WP_000172107.1|2374306_2374660_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	85.5	9.6e-49
WP_000838797.1|2375173_2376313_-	hypothetical protein	NA	H0UST6	Bacillus_phage	58.6	1.6e-124
WP_000703672.1|2376874_2377738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000679465.1|2377896_2379021_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.1	2.0e-212
WP_000105033.1|2379079_2380459_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	3.8e-117
2379098:2379126	attR	CCAAGCCACACACTCCACATGAGTCGTAT	NA	NA	NA	NA
WP_001200489.1|2380884_2382081_+	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_000875595.1|2382127_2382835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233712.1|2383371_2384454_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000007357.1|2384569_2385799_+	aminopeptidase	NA	NA	NA	NA	NA
WP_003283018.1|2385844_2386351_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_000263262.1|2386467_2386791_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000358128.1|2386838_2388290_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000225143.1|2388282_2389650_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_155403438.1|2389765_2391208_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_000416667.1|2391283_2392027_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000977679.1|2392166_2393072_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	4.1e-27
WP_001047685.1|2393629_2395057_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000051441.1|2395071_2396529_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_000086999.1|2396544_2396835_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	2417911	2426287	5675007		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088589.1|2417911_2418499_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262439.1|2418495_2419536_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879025.1|2419641_2421057_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055562.1|2421041_2423261_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000666789.1|2423244_2423928_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|2423924_2424179_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170544.1|2424171_2424891_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|2424979_2426287_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 9
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	2438945	2537037	5675007	portal,holin,integrase,protease,tRNA,terminase,capsid,head,transposase,tail	Bacillus_phage(52.46%)	89	2515399:2515416	2528329:2528346
WP_000275580.1|2438945_2440241_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_002134075.1|2440275_2441043_+	RNA methyltransferase	NA	A0A288WG17	Bacillus_phage	51.9	7.4e-62
WP_000405117.1|2441262_2441985_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001058693.1|2442012_2442885_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000690999.1|2443108_2444185_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_000651991.1|2449461_2450175_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	3.4e-37
WP_000845334.1|2450164_2451178_+	HAMP domain-containing histidine kinase	NA	A0A2K9L4R6	Tupanvirus	21.6	3.1e-07
WP_000074580.1|2451246_2452176_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	2.3e-41
WP_000247716.1|2452168_2452906_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001279960.1|2452923_2453721_+	undecaprenyl-diphosphate phosphatase UppP	NA	NA	NA	NA	NA
WP_001072418.1|2454083_2454542_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000687949.1|2459729_2460461_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_000723976.1|2460660_2461620_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000719210.1|2466964_2468470_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
WP_000929880.1|2468453_2469155_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000833096.1|2469298_2470624_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_002134197.1|2471341_2472232_+	hypothetical protein	NA	A0A0S2MVF4	Bacillus_phage	63.0	1.9e-85
WP_000741567.1|2472395_2473472_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	86.6	1.2e-171
WP_000956437.1|2474020_2474287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000579579.1|2475290_2476541_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.9	2.7e-69
WP_000403436.1|2476992_2477931_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	94.7	3.3e-136
WP_000373855.1|2477930_2478356_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.2	4.8e-71
WP_000390477.1|2478431_2478656_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.1e-26
WP_015382147.1|2478782_2479148_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.0	3.7e-35
WP_015382146.1|2479164_2484729_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	64.1	0.0e+00
WP_000093847.1|2484725_2486195_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.3	1.1e-231
WP_001173498.1|2486234_2491232_-|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	80.5	0.0e+00
WP_015382157.1|2491396_2491771_-	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_001251821.1|2491827_2492412_-|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_000793436.1|2492427_2492790_-	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	85.0	1.4e-55
WP_000818829.1|2492786_2493224_-	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	93.1	7.4e-75
WP_001182260.1|2493211_2493586_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_001243199.1|2493587_2493884_-	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	87.8	1.6e-41
WP_000234863.1|2493896_2495060_-	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	96.9	1.7e-211
WP_000216402.1|2495080_2495857_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_044157418.1|2495840_2496947_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_000615714.1|2497012_2498671_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	1.0e-257
WP_000124848.1|2498667_2499003_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
WP_000666403.1|2499152_2499488_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	1.0e-52
WP_000336221.1|2499484_2499889_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_000124642.1|2500030_2500291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001012113.1|2500966_2501509_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000166182.1|2501508_2501991_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_000525861.1|2502304_2502586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000234108.1|2503084_2503267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000365653.1|2503453_2503672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000397931.1|2504393_2504660_-	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000805074.1|2504835_2505258_-	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000387671.1|2505282_2505681_-	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_002134037.1|2505732_2505918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000665841.1|2505962_2506175_-	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	93.5	1.5e-25
WP_002134040.1|2506201_2506666_-	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	4.4e-17
WP_000811696.1|2506674_2506929_-	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_000805170.1|2506943_2507117_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000337986.1|2507142_2507337_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000235015.1|2507352_2508228_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_000073375.1|2508166_2509054_-	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.7	6.8e-43
WP_000665325.1|2509467_2509665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359729.1|2509677_2510493_-	hypothetical protein	NA	A0A0S2MV65	Bacillus_phage	81.6	6.1e-123
WP_000383685.1|2510718_2510907_-	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_001042666.1|2510920_2511175_-	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	98.8	5.5e-38
WP_000435973.1|2511360_2511840_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	99.4	6.9e-82
WP_000654304.1|2511853_2512294_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	97.9	6.5e-79
WP_001123356.1|2512320_2513388_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	99.7	3.3e-201
WP_000743906.1|2513453_2514992_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
2515399:2515416	attL	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_016090283.1|2515711_2515921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090284.1|2515933_2516263_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_044157420.1|2516279_2517872_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	52.6	2.8e-156
WP_016090286.1|2517924_2518272_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.9	3.9e-18
WP_016090287.1|2518398_2518689_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	53.2	1.6e-25
WP_016090288.1|2518681_2518969_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016090289.1|2519035_2520298_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016090290.1|2520302_2520881_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	30.2	2.6e-11
WP_016090291.1|2520877_2522074_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	35.9	5.0e-65
WP_016090293.1|2522227_2522455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090294.1|2522786_2525216_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	32.6	2.2e-83
WP_016090295.1|2525317_2525644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090297.1|2525946_2526216_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016090298.1|2526438_2527023_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090299.1|2527071_2528250_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	62.9	8.0e-140
WP_001029993.1|2528328_2529963_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
2528329:2528346	attR	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_000917311.1|2530001_2530286_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_000745326.1|2530676_2531426_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001246200.1|2531422_2531614_+	YdiK family protein	NA	NA	NA	NA	NA
WP_000372699.1|2531643_2532273_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001987845.1|2532406_2534386_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000414585.1|2534871_2535888_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
WP_000367190.1|2535887_2536331_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000865756.1|2536344_2537037_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	3140963	3217324	5675007	portal,holin,integrase,protease,terminase,capsid,head,transposase,tail	Bacillus_phage(48.28%)	94	3157229:3157249	3199768:3199788
WP_047225409.1|3140963_3141374_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001127250.1|3141499_3142429_+	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_000922850.1|3142455_3143268_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002097946.1|3143335_3143986_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_001255073.1|3144019_3144532_+	acyltransferase	NA	NA	NA	NA	NA
WP_000517720.1|3144670_3146182_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001288079.1|3146267_3147224_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	4.0e-89
WP_000455200.1|3147389_3148196_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001190080.1|3148425_3148884_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000138459.1|3148904_3149786_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_000712186.1|3149789_3150743_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.8	1.7e-63
WP_000250307.1|3151804_3152053_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001049162.1|3152380_3152962_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000018924.1|3153202_3154072_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000215909.1|3154092_3154299_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000575919.1|3154310_3154661_-	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000938972.1|3154657_3155674_-	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000095408.1|3155674_3156151_-	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_001226064.1|3156180_3156669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216166.1|3156762_3156969_-	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
3157229:3157249	attL	GTTCGAATCCCTCTGGGCGCG	NA	NA	NA	NA
WP_000135757.1|3157383_3158520_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	6.8e-96
WP_001037137.1|3158550_3159018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002133807.1|3159028_3159421_-	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	3.2e-13
WP_000216290.1|3159585_3159816_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000711864.1|3159851_3160085_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_001016247.1|3160438_3161194_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	83.4	1.9e-110
WP_001187283.1|3161205_3161394_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_000453495.1|3161420_3161864_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	90.5	9.8e-67
WP_015382506.1|3161881_3162595_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.4e-126
WP_000355713.1|3162594_3162810_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.1e-31
WP_002133909.1|3162739_3163081_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	9.9e-51
WP_000510889.1|3163174_3164128_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	8.4e-148
WP_000933908.1|3164139_3164619_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	97.5	4.3e-84
WP_000139235.1|3164611_3164842_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_001245738.1|3164865_3165423_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_000775809.1|3165461_3165896_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	89.6	2.2e-71
WP_001268031.1|3165954_3166245_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	2.5e-50
WP_000520932.1|3167267_3167522_+	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	100.0	1.2e-40
WP_000858114.1|3167557_3168253_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	3.2e-112
WP_000590881.1|3168297_3168609_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000540086.1|3168644_3169172_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_015670520.1|3169168_3169495_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	4.7e-58
WP_003308641.1|3169532_3169934_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_000711194.1|3170317_3170737_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_071686389.1|3170788_3170971_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	64.9	3.9e-14
WP_000650576.1|3171150_3171375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343502.1|3171388_3171592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002014.1|3171597_3172032_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	61.5	9.8e-19
WP_001177575.1|3172100_3172310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378699.1|3172316_3172574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001177571.1|3172564_3172939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666398.1|3172904_3173240_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_000301150.1|3173363_3173675_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	4.7e-39
WP_000595321.1|3173671_3175357_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	85.7	5.5e-275
WP_000118683.1|3175377_3176529_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	51.1	1.8e-104
WP_000791073.1|3176518_3177244_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	53.2	1.7e-44
WP_000245092.1|3177270_3178437_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	77.7	9.6e-162
WP_000361981.1|3178449_3178743_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	76.3	2.7e-36
WP_001247297.1|3178744_3179095_+|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	3.7e-53
WP_000997537.1|3179096_3179441_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	80.5	1.7e-45
WP_000219080.1|3179437_3179773_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	3.2e-54
WP_001004920.1|3179773_3180367_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.8	3.7e-101
WP_000415931.1|3180373_3180736_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_000897021.1|3180966_3182202_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	73.1	3.6e-151
WP_002133928.1|3182479_3184861_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	44.1	3.7e-43
WP_015382503.1|3184902_3186372_+	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	80.2	2.6e-236
WP_015382502.1|3186368_3190751_+	phage minor structural protein	NA	A0A0S2MVB4	Bacillus_phage	58.4	0.0e+00
WP_016090170.1|3190767_3191139_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.4	2.2e-35
WP_000499524.1|3191259_3192453_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_042991251.1|3192747_3193191_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.8	1.8e-68
WP_000499524.1|3193252_3194446_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_000405783.1|3194743_3195679_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	82.3	1.8e-155
WP_000993515.1|3195882_3196998_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.9	4.0e-109
WP_000734384.1|3196997_3197216_+	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	73.8	1.7e-16
WP_000742864.1|3197394_3197961_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	4.8e-26
WP_001016121.1|3198104_3198323_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	93.1	7.3e-31
WP_001273481.1|3198347_3198641_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	87.6	2.7e-41
WP_000412580.1|3198656_3199484_-	hypothetical protein	NA	A0A1C8EA76	Bacillus_phage	90.9	7.6e-137
WP_000647955.1|3200046_3201354_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
3199768:3199788	attR	GTTCGAATCCCTCTGGGCGCG	NA	NA	NA	NA
WP_000869730.1|3201363_3201609_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_001258185.1|3201744_3202773_+	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000161236.1|3202799_3203804_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001036350.1|3203943_3205128_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_001231038.1|3205160_3205916_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001231158.1|3205912_3207442_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000103951.1|3207472_3208768_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001125064.1|3208819_3209770_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000673222.1|3210122_3210491_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000078304.1|3210487_3211180_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000557264.1|3211274_3211508_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000976870.1|3211666_3212410_+	carboxylesterase	NA	NA	NA	NA	NA
WP_000391097.1|3212552_3214991_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_001123919.1|3215117_3215585_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000915084.1|3216391_3217324_-|holin	choline-binding protein A	holin	NA	NA	NA	NA
>prophage 11
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	3348881	3442795	5675007	portal,integrase,holin,protease,tRNA,terminase,capsid,head,coat,transposase,tail	Bacillus_phage(79.69%)	99	3361466:3361485	3448250:3448269
WP_000241505.1|3348881_3349994_-|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_000856300.1|3349999_3351346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106091.1|3351290_3352394_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000351148.1|3352556_3353084_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000665094.1|3353107_3353599_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000614218.1|3353719_3354721_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125494.1|3354782_3354998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|3355192_3355429_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_002101505.1|3355984_3356779_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|3356901_3357570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002101500.1|3357620_3358259_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000843107.1|3358245_3358716_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000383681.1|3358805_3359060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000607080.1|3359096_3359480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003285671.1|3359768_3360566_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000622258.1|3360635_3360917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212737.1|3361076_3361418_+	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
3361466:3361485	attL	TTTTGTCGGTAAATCGATAT	NA	NA	NA	NA
WP_000679246.1|3361638_3362436_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000470265.1|3362419_3363079_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_001054089.1|3363134_3363308_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000682077.1|3363541_3364612_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000595026.1|3364958_3365198_+	YuzB family protein	NA	NA	NA	NA	NA
WP_000077397.1|3365466_3366333_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000573825.1|3366374_3366728_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_087942842.1|3366809_3368155_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000834606.1|3368580_3369345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833145.1|3369968_3370322_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000237487.1|3370410_3371472_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000896931.1|3372434_3372665_+	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_001164934.1|3372832_3373963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005253.1|3374365_3374695_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	97.2	5.6e-51
WP_000368216.1|3374942_3375188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277643.1|3375332_3375521_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000960416.1|3375838_3376555_+	hypothetical protein	NA	Q3HL19	Bacillus_phage	78.2	6.4e-100
WP_000218620.1|3376716_3377031_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_015382495.1|3377305_3377953_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	99.5	8.9e-117
WP_015382176.1|3378176_3379193_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_002133989.1|3379155_3379968_+	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|3380009_3380276_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|3380347_3380512_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|3380529_3380745_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|3380741_3381041_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_038413787.1|3381191_3381491_+	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	99.0	1.8e-51
WP_155403433.1|3381647_3381821_+	hypothetical protein	NA	W8CYZ6	Bacillus_phage	100.0	2.0e-28
WP_000404184.1|3381844_3382252_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_000965619.1|3383660_3383942_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000166155.1|3384299_3384785_+	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_001012176.1|3384781_3385324_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382276.1|3385530_3385776_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_000017440.1|3386178_3386466_+	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_000464752.1|3386502_3386730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443965.1|3386775_3386955_+	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000002725.1|3386989_3387229_+	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000773601.1|3387245_3387458_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000870105.1|3387592_3387847_+	hypothetical protein	NA	W8CYT4	Bacillus_phage	97.6	1.3e-42
WP_001139454.1|3387836_3388214_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000233390.1|3388342_3388846_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_000621131.1|3388847_3390542_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000577489.1|3390730_3391984_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_001259159.1|3391970_3392681_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000361137.1|3392718_3393885_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_000244586.1|3393905_3394193_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382490.1|3394179_3394503_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	99.1	3.3e-56
WP_000763219.1|3394495_3394930_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_000609194.1|3394926_3395286_+	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	96.6	2.5e-60
WP_000896769.1|3395286_3395895_+|tail	tail protein	tail	W8CYT6	Bacillus_phage	94.1	1.3e-98
WP_015382489.1|3395941_3396259_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	97.1	4.9e-52
WP_000344049.1|3396288_3396465_+	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_015382488.1|3396479_3400403_+|tail	phage tail tape measure protein	tail	I3WTY6	Bacillus_phage	99.3	0.0e+00
WP_000517105.1|3400417_3401899_+|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	99.6	5.4e-295
WP_001260185.1|3401895_3405921_+	hypothetical protein	NA	H0USX5	Bacillus_phage	93.6	0.0e+00
WP_000373903.1|3406345_3406771_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.2	7.0e-70
WP_000405777.1|3406770_3407472_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.8	6.4e-121
WP_000119484.1|3409448_3409787_-	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	92.9	4.6e-48
WP_000043398.1|3409840_3410419_-	hypothetical protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_001137905.1|3410424_3410604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649833.1|3410612_3410810_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001257569.1|3410992_3411310_+	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000170777.1|3411306_3411489_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_000891535.1|3411604_3412786_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	9.0e-216
WP_000551103.1|3412727_3413348_+	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000710530.1|3413357_3414185_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000635484.1|3414507_3414969_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000535259.1|3415048_3415930_+	decarboxylase	NA	NA	NA	NA	NA
WP_000391942.1|3415947_3417195_-	MFS transporter	NA	NA	NA	NA	NA
WP_000902159.1|3417360_3417840_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000829788.1|3428393_3429383_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000856612.1|3429844_3431053_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000415321.1|3431176_3431683_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000027016.1|3431679_3431997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920098.1|3432083_3432710_+	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000487942.1|3432869_3434354_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000545253.1|3434528_3435134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104221.1|3435277_3437002_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_002097988.1|3437109_3437997_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_001252163.1|3438042_3438636_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_001140612.1|3439524_3439908_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_087942833.1|3439962_3441305_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000287147.1|3441418_3442795_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
3448250:3448269	attR	ATATCGATTTACCGACAAAA	NA	NA	NA	NA
>prophage 12
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	3792628	3800314	5675007		Bacillus_phage(33.33%)	9	NA	NA
WP_001036847.1|3792628_3793612_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
WP_000403760.1|3793601_3794372_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001086121.1|3794404_3795169_+	class B sortase	NA	NA	NA	NA	NA
WP_000587826.1|3795241_3795565_-	heme oxygenase	NA	NA	NA	NA	NA
WP_001255971.1|3795860_3797060_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_001014310.1|3797098_3797293_-	YwbE family protein	NA	NA	NA	NA	NA
WP_000018029.1|3797635_3798328_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_000609140.1|3798329_3799265_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000221066.1|3799390_3800314_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
>prophage 13
NZ_CP011349	Bacillus thuringiensis strain YC-10, complete genome	5675007	3832628	3893934	5675007	tRNA,coat,transposase,protease	Klosneuvirus(22.22%)	56	NA	NA
WP_001236345.1|3832628_3833858_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000919605.1|3834210_3834882_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000774010.1|3835157_3835967_+	glutamate racemase	NA	NA	NA	NA	NA
WP_001126749.1|3836148_3837198_+	spore germination protein GerM	NA	NA	NA	NA	NA
WP_001261771.1|3837329_3838067_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_000815943.1|3838078_3838687_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.4	2.0e-14
WP_000645506.1|3838700_3839204_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000124460.1|3839887_3840088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000473868.1|3840182_3840797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001983650.1|3841316_3841565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358278.1|3841762_3842761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105215.1|3843070_3844348_+	trigger factor	NA	NA	NA	NA	NA
WP_000472289.1|3844612_3845872_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
WP_000119180.1|3845978_3847649_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	6.7e-15
WP_000097285.1|3847830_3850161_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	1.2e-176
WP_000869116.1|3850157_3850754_+	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000359781.1|3850787_3851204_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000133923.1|3851206_3851659_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547867.1|3852075_3853410_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000008991.1|3853427_3854261_+	cytochrome c assembly protein	NA	NA	NA	NA	NA
WP_001226396.1|3854276_3855206_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000992340.1|3855208_3855961_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001087065.1|3855981_3856971_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000712943.1|3856970_3858260_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_003285397.1|3858338_3859349_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000350653.1|3859415_3860441_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_000072250.1|3860964_3863610_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.8	1.2e-164
WP_000582068.1|3863703_3865005_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000361014.1|3865170_3866121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001226291.1|3866353_3866929_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_001013391.1|3866975_3867653_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000466736.1|3867810_3868830_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001135490.1|3868871_3869723_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000975766.1|3869737_3870283_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000503309.1|3871006_3871804_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000797471.1|3871937_3872684_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000599055.1|3872676_3873537_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000855488.1|3873604_3874993_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000270907.1|3875162_3875471_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002001054.1|3875482_3875827_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000944958.1|3875830_3876121_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001003584.1|3876184_3876733_+	sporulation protein	NA	NA	NA	NA	NA
WP_000497128.1|3876732_3878019_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_001986640.1|3878159_3878867_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000865415.1|3878856_3879939_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000114529.1|3880032_3880809_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_001011422.1|3880783_3882706_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001026366.1|3882755_3884669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000621701.1|3884765_3885617_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000510665.1|3885722_3886370_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000812272.1|3886450_3886993_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000973772.1|3886992_3888135_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	29.2	5.0e-30
WP_001138529.1|3888287_3889817_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001092208.1|3889836_3890670_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000025344.1|3890700_3891807_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_038413747.1|3892032_3893934_+|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
>prophage 1
NZ_CP011350	Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence	761374	57892	101865	761374	transposase,protease	Pseudomonas_phage(66.67%)	35	NA	NA
WP_033679421.1|57892_58771_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000899000.1|59492_59987_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016090328.1|61282_61702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090329.1|61768_62119_+	PrgI family protein	NA	NA	NA	NA	NA
WP_016090330.1|62119_63034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090331.1|63036_65136_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000108316.1|70868_72674_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_003275463.1|73729_75526_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.1	6.9e-34
WP_044157302.1|75594_75786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149935.1|76361_78185_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	33.8	2.5e-23
WP_016090655.1|79229_79805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090654.1|80082_80772_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000377268.1|81190_81655_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_000589597.1|81668_82115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090652.1|82618_83062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090651.1|83058_83493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499523.1|83702_84896_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_016090650.1|85192_85450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090649.1|85537_85795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090648.1|85885_86125_+	DUF3961 domain-containing protein	NA	NA	NA	NA	NA
WP_033679633.1|86159_86663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090646.1|86727_87084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090645.1|87714_88539_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_016090644.1|88798_89386_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090643.1|89519_90248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090642.1|90439_91375_+	DMT family transporter	NA	NA	NA	NA	NA
WP_001053969.1|91641_93078_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016090641.1|93264_93636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000364215.1|93923_94334_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|94482_95913_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_016090640.1|96248_97169_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001100112.1|98517_98697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169374.1|98870_100178_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_000647561.1|100511_100958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044157304.1|101265_101865_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	1.8e-34
>prophage 2
NZ_CP011350	Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence	761374	113049	183550	761374	transposase	Bacillus_phage(31.25%)	58	NA	NA
WP_000275580.1|113049_114345_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_016090632.1|114379_115267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090630.1|116001_116193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090629.1|117467_118229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074628990.1|118339_118762_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016090627.1|118944_120297_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_016090626.1|120335_120653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090625.1|120817_121906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090624.1|121934_123257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090623.1|123425_125510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187351.1|126464_127718_+	MFS transporter	NA	NA	NA	NA	NA
WP_016090622.1|127828_128410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090621.1|129064_129385_+	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	40.9	1.6e-10
WP_016090620.1|129852_132321_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016090619.1|132317_133031_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	3.0e-33
WP_016090618.1|133052_133853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090617.1|134554_135247_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016090616.1|135251_136484_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	2.8e-18
WP_016090615.1|137562_137823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090614.1|138467_139172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090613.1|139311_140157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|140211_141556_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_016097411.1|142398_142833_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_130055941.1|143101_143302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090611.1|143846_144182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958635.1|145963_146257_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090610.1|146649_146850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033679611.1|149626_150736_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.1	5.8e-92
WP_016090607.1|150732_150864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097410.1|151146_152259_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	47.9	1.1e-79
WP_000762752.1|152270_152669_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_071686443.1|152859_153039_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
WP_001206759.1|153581_153995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210390.1|154541_154835_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000084567.1|155463_155676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004894.1|155748_155952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090603.1|156003_156600_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_016090602.1|157388_158246_+	glucose uptake protein glcU	NA	NA	NA	NA	NA
WP_016090601.1|158262_159048_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.0e-26
WP_016090600.1|159413_159701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090599.1|159735_161445_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	30.1	6.0e-19
WP_033679607.1|161609_162998_-	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_000706800.1|164052_164436_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001103609.1|164432_165299_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.6e-20
WP_000906771.1|165288_165936_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_016090598.1|166156_167554_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	43.6	2.2e-88
WP_016090597.1|168329_169073_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016090596.1|169364_170003_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.1	2.8e-22
WP_016090595.1|170019_170403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090594.1|170699_171335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582601.1|171331_171964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090593.1|173600_174527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090592.1|175535_177152_-	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.3	4.3e-43
WP_001236345.1|178502_179732_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000219740.1|180082_180379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087971388.1|180532_180658_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_016090591.1|181445_182120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406502.1|182207_183550_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
>prophage 3
NZ_CP011350	Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence	761374	317083	375498	761374	transposase	Bacillus_phage(64.29%)	58	NA	NA
WP_040120033.1|317083_318202_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	8.9e-173
WP_000500291.1|318556_318835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000725639.1|318970_319129_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_001102657.1|319128_320220_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.9	8.6e-96
WP_016090531.1|320803_321316_+	hypothetical protein	NA	O64031	Bacillus_phage	45.6	4.8e-33
WP_001158653.1|321365_321740_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	46.6	1.9e-26
WP_000491768.1|322186_322582_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_016090530.1|322638_324165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540371.1|325137_325248_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000301804.1|325337_325637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679600.1|325877_326612_-	DUF874 family protein	NA	NA	NA	NA	NA
WP_000240396.1|326957_327176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413130.1|327464_327935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116660.1|327936_328134_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000369592.1|328673_329162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090528.1|330357_330597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090527.1|331277_332171_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016097404.1|332352_334179_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.5	2.4e-34
WP_000593069.1|334583_335153_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040120046.1|335408_336530_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	2.0e-172
WP_016090522.1|337070_338933_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016090521.1|338949_339711_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.3e-34
WP_016090519.1|341028_341715_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.2	1.4e-40
WP_016099961.1|342947_344366_-	S-layer protein/peptidoglycan endo-beta-N-acetylglucosaminidase	NA	G3MAW8	Bacillus_virus	42.3	7.1e-26
WP_016090516.1|344683_345256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000708212.1|345491_346061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090515.1|346094_347717_-	hypothetical protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	33.8	1.4e-25
WP_016090514.1|347713_348076_-	DUF3958 domain-containing protein	NA	NA	NA	NA	NA
WP_130055928.1|348481_348703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103656474.1|349030_349315_+	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	43.3	2.6e-12
WP_016090510.1|349318_349660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090508.1|351998_352346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090507.1|352678_353488_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_040120032.1|353903_355025_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	1.1e-170
WP_000914230.1|355274_355607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154214417.1|355789_355930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942837.1|356395_357764_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	65.3	2.2e-93
WP_000420168.1|358432_358633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047225421.1|358700_358940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090505.1|358954_359299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765882.1|359392_359836_-	DUF5065 family protein	NA	NA	NA	NA	NA
WP_000922179.1|360458_361034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120045.1|361380_362502_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.2	8.3e-163
WP_016090503.1|362747_363803_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	72.1	6.2e-152
WP_000570185.1|363799_364039_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_000499523.1|364336_365530_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_016090502.1|365624_365858_-	XpaF1 protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	83.8	8.1e-12
WP_000405795.1|366048_366933_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	4.2e-77
WP_001051379.1|367205_368027_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	4.9e-27
WP_016099955.1|368168_369137_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	4.5e-32
WP_000460733.1|369374_369761_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_016090275.1|369863_370790_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	63.5	3.7e-76
WP_000527101.1|370862_371099_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	9.7e-13
WP_000579788.1|371235_371664_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_000673778.1|371686_372115_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	7.3e-35
WP_016090274.1|372379_373591_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000762755.1|373975_374374_+|transposase	IS200/IS605-like element ISBth16 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	2.3e-51
WP_016097395.1|374385_375498_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.3	7.9e-81
>prophage 4
NZ_CP011350	Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence	761374	463136	515000	761374	transposase,integrase,protease	Bacillus_phage(40.0%)	46	496020:496079	515068:516722
WP_001098031.1|463136_464072_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000502626.1|464161_464431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869334.1|464544_464748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180021.1|464804_464990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001216652.1|465106_465526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233517.1|465592_465943_+	PrgI family protein	NA	NA	NA	NA	NA
WP_000892000.1|465943_466858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090237.1|466860_468969_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000890337.1|468999_473019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108316.1|474684_476490_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_003275463.1|477545_479342_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.1	6.9e-34
WP_000043048.1|479410_479602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149932.1|480177_482001_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	33.3	5.6e-23
WP_014481869.1|482160_483036_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	38.3	3.5e-15
WP_000757464.1|483052_483628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242518.1|483789_484173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000104242.1|484169_484469_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_000659905.1|484597_484906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343609.1|484945_485671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342852.1|485721_485967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001065855.1|486298_486982_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001186844.1|487438_488584_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000725572.1|488624_489107_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000523962.1|489717_491064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025329.1|491063_491492_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_001102776.1|491804_492878_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	1.8e-77
WP_000802626.1|493127_494618_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_000888766.1|495597_495849_-	YolD-like family protein	NA	NA	NA	NA	NA
496020:496079	attL	CATGCCCATCAACTTAAGGATAGAAACTCTACGGTTTTCCATTAATTGAAATGAACAAAC	NA	NA	NA	NA
WP_001053969.1|496146_497583_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000351941.1|498470_499370_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000020440.1|499492_500080_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_016090335.1|500094_501024_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000650425.1|501452_502427_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_000955500.1|502430_502961_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000898260.1|503503_503743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417392.1|503795_504047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001154608.1|504265_504640_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	52.5	4.8e-30
WP_000238290.1|504688_504997_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000794364.1|505293_506082_+	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000027993.1|506170_506944_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000349585.1|506984_507776_+	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000247457.1|507844_508249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028065.1|508241_510251_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000477499.1|510247_511345_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	6.5e-11
WP_000272577.1|511525_512791_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	4.2e-102
WP_001053969.1|513563_515000_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
515068:516722	attR	GTTTGTTCATTTCAATTAATGGAAAACCGTAGAGTTTCTATCCTTAAGTTGATGGGCATGGGGTTAATTCACTATGTTAAAGAAAATGATGTTTATGTTAATGGCTCTTACTCTAGTTTTTGTACCAACTCTCGCTTCAGCTGCAACTATAGAGGATGGAAAGAAATACAACGCAACACAGGAGGAATTAGAAGCTCAAGTTAAAGAATTAGAATATATTTTTTCGGTACTTATGGTAAAGGATGATAAAACAGGTAAATATGTTCTTAATAAAGAAGAATTAGCGAAATCTTCATATAACAATGAAGAAAAAGCAGCTATTATAGCTGGTGTTTATGTAATGAATGATGAAGAAATTCCATCTAATATGTACTCTAGTAACGTTTGGGAAAGATGTTGGCAGGATGCATTAGGTATTAGTAAATCATATTTTAATCAAATAAAATCGTATCTTAAGAAAGAGGATTACTGGGGAGCATTGGGAATGCTTTCGTTGCTTGGGCTACCATATAAGCCTGCGTTGTTATTTGCTTTTGCAGTAACTTGCGGGCCAGCTCCAGCTTATATTGCACCTAACCCTCATGAATAATAAGCCTGATATCTTATAAGTAAATGAACTAAAATTAGAATCTCTTTTGTAAATCTATTGATGCAAAAGAGATTCTTTTATCTTTTTAAAGAAGTATTTCTGTTAAATATGAAAATATTAAGTATATTCTGTTGAAAAAAAGTAGATTTGAAGTAAGTTAAACTTTCATATGATATGCTTATTCTATACTAACTAATTTTCAGGTGAGGAGTTGATCGGTTATTACTAGTATAGAGAATATATATAATGTTTCTGTATTCTTAATGCTTTTATCTACTTTTTGTTTTTATCTGTATTTACGAAAAATAAAAAGAGAAAGAAAGCTCACTGGTTTCGAATTTACAATGTATATCATAACACAAGTTAGTTACATTCTTTGGGGAATCTATATTATTTATATAAACTTTGGATGATATTTTTTGTTTTATGAAAAAAAGGCTATTAAAAAAGGGTTTGAGATAAATATCAAACCCTTTTGACTATATATAATTATTTCACTGCTTCTTTTAATTCTTTTCCAGCTTTAAAAGCAGGTGCCTTTGAAGCGGCGATTTGCATTTCTTCACCTGTTTGTGGGTTACGTCCTGTACGTGCAGATCTTTCACGTACTTCAAATGTACCAAAACCAAGAATCTGTACTTTTTCTCCATTTGCTAGCGCATTTGTTATTGTATCTAAAACAGCTTGTGTTGCTGCAGCTGCATCCTTTTGTGTAAGTTCTGCTTTTTCTGCTATTACTTTTGTTAATTCTGTCTTATTCATTTTTTGCACCTCTTCATATGTAATTAGGTGACTATTATAACGTGTGTATACTTATGATGCAATTAATATTGTGCATAGAAAAAGCCCTAGCAAGAGCTAGGGGACAATTTCTGTGTGGTAGTAAGAAAGAAAAACATGTTCATCGTACAGTCTAAATTGTAACATCTATATTAAATGATGAAAAGTACTTATTCTAGATGTTCTACTTGTTTCCACATATTCTATAATGAAAAATATCCCTCTAATTCATTTCATCTTAGAAGGATATTTCCAATCTTTTTCTTTTCGAGTATTTAGAGCAGGT	NA	NA	NA	NA
>prophage 5
NZ_CP011350	Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence	761374	522415	593864	761374	transposase,integrase,holin	Bacillus_phage(28.57%)	52	515110:515131	537720:537741
515110:515131	attL	CTTAAGTTGATGGGCATGGGGT	NA	NA	NA	NA
WP_001021539.1|522415_523459_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	1.2e-09
WP_000149389.1|523690_524041_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000121085.1|524062_524575_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001053969.1|525847_527284_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000532004.1|527448_528753_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_047225423.1|528775_529021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790837.1|529066_529459_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_001236345.1|529814_531044_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000997955.1|531774_532524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065268.1|532811_533036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090373.1|533212_534046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001103226.1|534551_535646_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	1.5e-92
WP_000844156.1|535990_536239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845491.1|536375_536585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032039.1|537137_537437_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016099974.1|538003_539020_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
537720:537741	attR	ACCCCATGCCCATCAACTTAAG	NA	NA	NA	NA
WP_000520933.1|541152_542025_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000169371.1|543018_544326_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.3e-26
WP_001100112.1|544499_544679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481860.1|546264_546576_-	mono-ADP-ribosyltransferase C3 (Exoenzyme C3)	NA	NA	NA	NA	NA
WP_014481859.1|546535_547072_-	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000954716.1|548604_549447_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001255046.1|549736_550084_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	54.1	2.5e-25
WP_003319651.1|550276_550639_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.7	6.0e-14
WP_001025593.1|551435_554507_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_001224533.1|554757_555381_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_000798699.1|555632_556385_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_044157363.1|556416_557670_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	9.7e-43
WP_002133690.1|558215_558467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090366.1|559090_562624_-	pesticidal crystal protein cry1Ac	NA	NA	NA	NA	NA
WP_000215667.1|562913_563870_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.5	6.9e-49
WP_001053956.1|565661_567098_+|transposase	IS4-like element IS231B family transposase	transposase	NA	NA	NA	NA
WP_000275580.1|567305_568601_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|568590_569343_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_016090469.1|569504_569948_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.6	9.6e-46
WP_016099948.1|570346_571342_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.7	1.1e-137
WP_016097421.1|571517_572060_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.5	3.4e-13
WP_016097422.1|572240_573704_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.2	8.1e-142
WP_016090463.1|573726_574146_+	universal stress protein	NA	NA	NA	NA	NA
WP_016090464.1|574232_575900_+	ribonuclease J	NA	NA	NA	NA	NA
WP_140159901.1|576258_577188_-	collagen-like protein	NA	NA	NA	NA	NA
WP_016090232.1|578728_579325_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_016090231.1|579603_580014_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090230.1|580143_580905_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016090229.1|581032_581419_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_016090228.1|581451_582264_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016090227.1|582580_583126_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.0	1.1e-30
WP_016090226.1|583168_586117_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.6	6.1e-80
WP_016090225.1|587831_588134_+	hypothetical protein	NA	A0A0S2MVJ2	Bacillus_phage	47.3	5.0e-14
WP_001243454.1|588299_589349_-	Fic family protein	NA	NA	NA	NA	NA
WP_000495521.1|590544_590949_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000892197.1|593441_593864_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	1.3e-52
>prophage 6
NZ_CP011350	Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence	761374	655709	729494	761374	transposase,integrase	Bacillus_phage(18.18%)	60	678198:678214	728497:728513
WP_033679397.1|655709_656831_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	1.9e-170
WP_000369347.1|657508_658420_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000701098.1|658531_659605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406625.1|660961_662080_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	3.0e-173
WP_000929144.1|663196_663493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679387.1|664741_665146_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	67.6	1.4e-40
WP_087942375.1|665558_667119_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
WP_071686411.1|667402_667531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000954720.1|667711_668527_-	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001206763.1|668923_669337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679394.1|670054_670357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763085.1|671874_672390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682816.1|672473_672851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024927926.1|672847_673165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001017354.1|673472_674564_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.6	9.2e-90
WP_000207869.1|674753_675047_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000420420.1|675120_675558_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000887510.1|675548_676007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081052.1|676030_676318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001014119.1|676393_676594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000708139.1|676626_677271_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	34.0	3.7e-06
WP_000520732.1|677699_680363_-	type IA DNA topoisomerase	NA	A0A1V0SIB2	Klosneuvirus	20.9	4.5e-13
678198:678214	attL	ATCACGGTTTAAAATGT	NA	NA	NA	NA
WP_000312314.1|681334_681535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866011.1|682120_682759_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.6	3.3e-23
WP_015406623.1|682775_683159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916413.1|683284_683869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078405438.1|683888_684467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000817905.1|684517_685153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024816.1|685152_685782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494364.1|686118_686832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103653709.1|686848_689251_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000654328.1|689528_691394_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	2.4e-37
WP_000114815.1|693120_693348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219637.1|693363_694455_-	methyltransferase	NA	NA	NA	NA	NA
WP_000710696.1|694718_695144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113623483.1|696083_696239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853368.1|698343_699204_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_000118651.1|699206_701126_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_003319726.1|701126_701846_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_014481878.1|702051_704421_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_000335059.1|705514_707317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373088.1|707726_708644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610947.1|708658_709441_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000724860.1|709533_709926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459233.1|711723_712533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000372481.1|712914_714639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372779.1|714674_716144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520262.1|716830_718540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000041871.1|719766_720714_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000677976.1|720823_721219_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJ60	Clostridium_phage	44.4	4.3e-05
WP_000968739.1|721343_723116_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_001244154.1|723238_723652_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000282361.1|723638_724025_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_047225424.1|723976_724417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090214.1|724436_725273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209412.1|725285_725687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061019.1|725737_726703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859310.1|726751_727396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016090213.1|727373_727985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275580.1|728198_729494_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
728497:728513	attR	ATCACGGTTTAAAATGT	NA	NA	NA	NA
>prophage 1
NZ_CP011355	Bacillus thuringiensis strain YC-10 plasmid pYC10, complete sequence	14894	612	14745	14894		Bacillus_phage(100.0%)	18	NA	NA
WP_016090425.1|612_1206_+	hypothetical protein	NA	S5Z7C9	Bacillus_phage	77.9	4.7e-80
WP_016090424.1|1237_1576_+	helix-turn-helix domain-containing protein	NA	S5Y6I2	Bacillus_phage	78.6	7.6e-43
WP_016090423.1|1709_1976_+	hypothetical protein	NA	S5YPF7	Bacillus_phage	66.3	1.3e-26
WP_016100035.1|1950_2322_+	hypothetical protein	NA	Q5ILC3	Bacillus_phage	96.7	3.3e-15
WP_016097524.1|2309_2894_+	hypothetical protein	NA	Q5ILC2	Bacillus_phage	99.5	4.3e-70
WP_016090421.1|3239_3878_+	hypothetical protein	NA	Q5ILB9	Bacillus_phage	99.5	1.9e-124
WP_016090418.1|4310_4580_+	hypothetical protein	NA	Q5ILB5	Bacillus_phage	98.9	8.7e-42
WP_016090417.1|4579_5650_+	hypothetical protein	NA	Q5ILB4	Bacillus_phage	99.7	3.5e-203
WP_000523934.1|5691_5922_+	hypothetical protein	NA	Q5ILB3	Bacillus_phage	100.0	9.4e-37
WP_015976770.1|6157_6589_+	hypothetical protein	NA	Q5ILB0	Bacillus_phage	100.0	1.5e-56
WP_015976771.1|6916_7192_+	hypothetical protein	NA	Q5ILA7	Bacillus_phage	100.0	2.2e-48
WP_015976772.1|7195_7810_+	hypothetical protein	NA	Q5ILA6	Bacillus_phage	100.0	4.5e-78
WP_015976773.1|7813_8566_+	lytic enzyme	NA	Q5ILA5	Bacillus_phage	100.0	4.5e-136
WP_015976774.1|8513_9026_+	hypothetical protein	NA	Q5ILA4	Bacillus_phage	100.0	1.7e-91
WP_015976775.1|9039_9933_+	hypothetical protein	NA	Q5ILA3	Bacillus_phage	100.0	2.2e-150
WP_015976776.1|9936_10818_+	hypothetical protein	NA	Q5ILA2	Bacillus_phage	100.0	2.5e-170
WP_016090416.1|10834_11626_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5ILA1	Bacillus_phage	100.0	7.3e-129
WP_016090415.1|12048_14745_-	hypothetical protein	NA	S5Z7F3	Bacillus_phage	82.4	0.0e+00
>prophage 1
NZ_CP011358	Bacillus thuringiensis strain YC-10 plasmid pYC2226, complete sequence	82300	10955	60269	82300	transposase,integrase	uncultured_Caudovirales_phage(28.57%)	47	46726:46743	65258:65275
WP_000275580.1|10955_12251_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|12240_12993_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000412868.1|13658_14078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008613.1|14483_15050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000230191.1|15110_16382_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001200537.1|16607_17027_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016097290.1|17042_17336_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016090467.1|17891_18434_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	31.5	4.5e-13
WP_080708804.1|18602_19247_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	64.1	2.0e-60
WP_142388634.1|19084_20875_-	collagen-like protein	NA	NA	NA	NA	NA
WP_016090232.1|22046_22643_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_016090231.1|22921_23332_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016090230.1|23461_24223_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016090229.1|24350_24737_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_016090228.1|24769_25582_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016090227.1|25898_26444_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.0	1.1e-30
WP_016090226.1|26486_29435_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.6	6.1e-80
WP_002133690.1|30131_30383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224533.1|31029_31653_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_001025593.1|31903_34975_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_000190466.1|35084_35501_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.9	5.9e-29
WP_016097345.1|35520_36678_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	65.8	2.9e-142
WP_012008607.1|37110_38643_-	replication protein ori43	NA	NA	NA	NA	NA
WP_012008606.1|39419_40118_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012008605.1|40228_40873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008604.1|41019_41202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272553.1|41229_41496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000217377.1|41687_42002_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000876891.1|42083_42635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008603.1|43594_43888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120061.1|43946_44270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008601.1|44430_44802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008600.1|44884_45259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008599.1|45305_45920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008598.1|45986_46256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004369.1|46299_46632_-	hypothetical protein	NA	NA	NA	NA	NA
46726:46743	attL	TATAAAAACGATAAATAA	NA	NA	NA	NA
WP_000651963.1|46865_47051_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000751784.1|47725_47860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287770.1|47856_48969_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	47.8	3.4e-92
WP_016097343.1|49186_49621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000382147.1|49782_50637_+	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_000538375.1|50655_53619_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_001053969.1|53811_55248_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_016099920.1|55225_55699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946495.1|55713_56088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012008596.1|56135_58790_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_000432938.1|59342_60269_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.2	2.2e-36
65258:65275	attR	TTATTTATCGTTTTTATA	NA	NA	NA	NA
>prophage 1
NZ_CP011351	Bacillus thuringiensis strain YC-10 plasmid pYC3, complete sequence	80704	49520	75418	80704	transposase,integrase,protease	Bacillus_phage(25.0%)	22	66345:66358	74787:74800
WP_001025593.1|49520_52592_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_001224533.1|52842_53466_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_002133690.1|54112_54364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044157348.1|54699_55536_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	27.0	3.7e-22
WP_000538375.1|55554_58518_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_016097342.1|58547_59321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097341.1|59523_61065_-	replication initiation protein RepS	NA	NA	NA	NA	NA
WP_016097340.1|61935_62862_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.4	1.1e-30
WP_016097339.1|62824_63148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097338.1|63280_63514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097337.1|63529_63859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097336.1|64016_64742_-	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	54.9	7.8e-61
WP_016097335.1|64808_66449_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
66345:66358	attL	ATCATTTGCATTTG	NA	NA	NA	NA
WP_016097333.1|67293_68409_-	transcriptional regulator	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	52.2	1.2e-92
WP_016097332.1|68551_69187_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	28.4	8.7e-08
WP_016097331.1|69646_70021_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	1.5e-28
WP_090782881.1|70172_71331_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	41.6	1.5e-37
WP_016097328.1|71427_71673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097327.1|71749_72334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097326.1|72994_73612_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.0	2.7e-14
WP_016097325.1|73583_74582_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	35.1	3.1e-36
WP_016097323.1|74971_75418_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
74787:74800	attR	CAAATGCAAATGAT	NA	NA	NA	NA
>prophage 1
NZ_CP011352	Bacillus thuringiensis strain YC-10 plasmid pYC4, complete sequence	46634	0	46634	46634	integrase,head,holin,terminase,portal,tail	Bacillus_phage(100.0%)	65	1914:1938	46379:46403
WP_016049870.1|0_46634_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	100.0	2.3e-39
46379:46403	attR	AGGAGGATGAAGGATGGATAATCAA	NA	NA	NA	NA
WP_016049871.1|397_640_+	DUF2829 domain-containing protein	NA	A0A0S2MV73	Bacillus_phage	100.0	8.6e-41
WP_016049872.1|639_903_+	DUF2829 domain-containing protein	NA	A0A0S2MVC6	Bacillus_phage	100.0	9.0e-44
WP_016049873.1|1162_1483_+	hypothetical protein	NA	A0A0S2MVH6	Bacillus_phage	100.0	4.8e-55
WP_016049874.1|1510_1894_+	hypothetical protein	NA	I7J6Y9	Bacillus_phage	100.0	2.2e-67
1914:1938	attL	AGGAGGATGAAGGATGGATAATCAA	NA	NA	NA	NA
WP_016049845.1|1926_2256_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	100.0	1.7e-52
WP_000762692.1|2242_2455_+	hypothetical protein	NA	A0A0S2MV92	Bacillus_phage	100.0	7.1e-31
WP_016049846.1|2605_3520_+|terminase	phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	100.0	2.5e-141
WP_016049847.1|3509_4784_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	100.0	2.4e-254
WP_016049848.1|4796_6230_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	100.0	8.5e-277
WP_016090413.1|6303_7071_+	hypothetical protein	NA	A0A0S2MVF0	Bacillus_phage	100.0	1.1e-142
WP_016049850.1|7070_7343_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	100.0	2.5e-49
WP_016049851.1|7422_8103_+	DUF4355 domain-containing protein	NA	A0A0S2MVA2	Bacillus_phage	100.0	9.7e-106
WP_016049852.1|8120_8963_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	100.0	2.2e-155
WP_016049853.1|9013_9322_+	phage related protein gp15	NA	A0A0S2MVF2	Bacillus_phage	100.0	3.1e-51
WP_016049854.1|9318_9663_+|head,tail	phage head-tail adaptor	head,tail	A0A0S2MVD7	Bacillus_phage	100.0	6.7e-63
WP_016049855.1|9637_10045_+	HK97 gp10 family phage protein	NA	A0A0S2MVE4	Bacillus_phage	100.0	1.4e-67
WP_016049856.1|10050_10413_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	100.0	1.1e-63
WP_016049857.1|10427_11021_+	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	100.0	1.6e-109
WP_016049858.1|11067_11496_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	100.0	1.5e-72
WP_044129691.1|11600_11807_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	100.0	5.6e-33
WP_016049860.1|11807_14747_+|tail	phage tail tape measure protein	tail	A0A0S2MVC9	Bacillus_phage	100.0	0.0e+00
WP_016049861.1|14759_16238_+|tail	phage tail fiber protein	tail	A0A0S2MVB9	Bacillus_phage	100.0	9.9e-297
WP_016090411.1|16234_20944_+	phage minor structural protein	NA	A0A0S2MVH9	Bacillus_phage	100.0	0.0e+00
WP_016090410.1|21043_22003_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A068EP13	Bacillus_phage	100.0	4.8e-183
WP_016090409.1|22018_22258_+	hypothetical protein	NA	A0A0S2MVH5	Bacillus_phage	100.0	4.8e-36
WP_016090408.1|22300_22531_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	100.0	1.1e-34
WP_016090407.1|22547_23483_+	L-alanyl-D-glutamate peptidase	NA	A0A0S2MVR5	Bacillus_phage	100.0	5.7e-189
WP_016090406.1|23777_24062_-	hypothetical protein	NA	A0A0S2MVK9	Bacillus_phage	100.0	2.7e-49
WP_000539769.1|24496_24730_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	100.0	7.3e-37
WP_016090405.1|24815_25346_-	hypothetical protein	NA	A0A0S2MVP2	Bacillus_phage	100.0	7.1e-96
WP_031303572.1|25357_25738_-	hypothetical protein	NA	A0A0S2MVE7	Bacillus_phage	100.0	2.8e-62
WP_016090403.1|25855_26188_-	hypothetical protein	NA	A0A0S2MVL6	Bacillus_phage	99.1	4.6e-53
WP_016090402.1|26147_27179_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	100.0	1.1e-196
WP_016090401.1|27461_28124_-	hypothetical protein	NA	A0A0S2MVD6	Bacillus_phage	100.0	5.3e-125
WP_016090400.1|28147_29251_-	hypothetical protein	NA	A0A0S2MVK1	Bacillus_phage	100.0	1.5e-172
WP_016090399.1|29850_30195_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	100.0	5.3e-52
WP_016090398.1|30214_30742_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	100.0	2.0e-90
WP_016090397.1|31352_31670_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	100.0	5.8e-53
WP_016090396.1|32234_33422_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	100.0	4.6e-220
WP_016090393.1|33909_34260_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVD3	Bacillus_phage	100.0	4.7e-56
WP_016090392.1|34473_34671_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVJ7	Bacillus_phage	100.0	1.4e-28
WP_016090391.1|34737_35466_+	rha family phage regulatory protein	NA	A0A0S2MVD8	Bacillus_phage	100.0	2.6e-133
WP_016090390.1|35477_35852_+	hypothetical protein	NA	A0A0S2MVH3	Bacillus_phage	100.0	5.6e-63
WP_016090389.1|35875_36583_+	hypothetical protein	NA	A0A0S2MVI5	Bacillus_phage	100.0	1.0e-129
WP_016090388.1|36582_36762_+	hypothetical protein	NA	A0A0S2MVI7	Bacillus_phage	100.0	5.4e-24
WP_016090387.1|36751_37081_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	100.0	8.1e-50
WP_016090386.1|37226_37730_+	hypothetical protein	NA	A0A0S2MVD2	Bacillus_phage	100.0	8.5e-91
WP_016090385.1|37698_38082_+	hypothetical protein	NA	A0A0S2MVI0	Bacillus_phage	100.0	1.1e-69
WP_016090384.1|38101_38458_+	hypothetical protein	NA	A0A0S2MVL2	Bacillus_phage	100.0	5.1e-66
WP_016090383.1|38481_38949_+	hypothetical protein	NA	A0A0S2MVF1	Bacillus_phage	100.0	1.3e-85
WP_016090382.1|39062_39500_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	100.0	1.0e-76
WP_016090381.1|39499_39952_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	100.0	7.9e-88
WP_016090380.1|39948_40530_+	hypothetical protein	NA	A0A0S2MVD0	Bacillus_phage	100.0	3.0e-108
WP_016090379.1|40551_41034_+	hypothetical protein	NA	A0A0S2MVE6	Bacillus_phage	100.0	2.5e-87
WP_016090378.1|41167_41467_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	100.0	1.1e-50
WP_016090376.1|41695_42103_+	hypothetical protein	NA	A0A0S2MVF6	Bacillus_phage	100.0	6.9e-75
WP_016090479.1|42704_42950_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	100.0	8.4e-36
WP_016090480.1|42999_43224_+	hypothetical protein	NA	A0A0S2MVG0	Bacillus_phage	100.0	4.5e-36
WP_016090481.1|43265_43643_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	100.0	1.1e-50
WP_016090449.1|43767_43950_+	hypothetical protein	NA	A0A0S2MVH2	Bacillus_phage	100.0	4.3e-29
WP_016049864.1|43980_44511_+	Holliday junction resolvase RecU	NA	A0A0S2MVB5	Bacillus_phage	100.0	1.2e-98
WP_016090448.1|44530_44854_+	hypothetical protein	NA	A0A0S2MV86	Bacillus_phage	100.0	3.3e-56
WP_016090447.1|44998_45499_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	100.0	1.2e-89
WP_016049869.1|46391_46634_+	hypothetical protein	NA	A0A0S2MVA9	Bacillus_phage	100.0	2.9e-36
