The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	52407	88538	1751565	protease,transposase	Bacillus_phage(40.0%)	26	NA	NA
WP_047034909.1|52407_53256_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	44.2	1.8e-08
WP_047034911.1|54256_54466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047034913.1|54519_55908_-	MFS transporter	NA	NA	NA	NA	NA
WP_047034914.1|56113_56632_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.0	5.1e-14
WP_143453937.1|56664_57285_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.5	3.7e-19
WP_143453938.1|57316_57496_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.2	7.3e-05
WP_047034916.1|57619_58087_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	38.0	1.7e-16
WP_047034918.1|58922_60305_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	25.7	2.4e-26
WP_047034920.1|60613_61936_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_047034921.1|61984_63466_-	ABC-F type ribosomal protection protein	NA	A0A2I4R674	Erysipelothrix_phage	27.4	9.7e-34
WP_003705092.1|63831_64416_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	44.1	7.7e-27
WP_047034923.1|64566_65286_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_047034925.1|65341_66700_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003703180.1|66902_67133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047034926.1|67258_69367_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	2.3e-121
WP_047034928.1|69578_70058_+	universal stress protein	NA	NA	NA	NA	NA
WP_047034929.1|70118_70295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047034931.1|70397_71855_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003701500.1|72094_73129_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003700709.1|78948_79941_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	1.2e-19
WP_047034933.1|79959_81450_-	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_003700711.1|81852_83787_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_047034935.1|83901_85647_+	alpha amylase N-terminal ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_003700713.1|85761_87150_+	potassium transporter KtrB	NA	NA	NA	NA	NA
WP_003700714.1|87169_87808_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_047034938.1|87884_88538_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	278721	365702	1751565	integrase,portal,plate,capsid,terminase,tail,holin,transposase,protease,tRNA,head	Lactobacillus_phage(34.21%)	98	288511:288532	331716:331737
WP_047035099.1|278721_280749_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.4	1.4e-99
WP_011475600.1|280882_281653_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_080951842.1|281663_282221_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_047035101.1|282232_283123_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003702215.1|283210_283444_+	Veg family protein	NA	NA	NA	NA	NA
WP_047036064.1|284400_285519_+	aminotransferase	NA	NA	NA	NA	NA
WP_003702207.1|285562_286033_+	arginine repressor	NA	NA	NA	NA	NA
WP_047035103.1|286071_286941_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003704861.1|287156_288464_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	33.3	5.2e-39
288511:288532	attL	AAAGATTATAAATTAAGTTGTT	NA	NA	NA	NA
WP_047035104.1|288675_289821_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	30.0	1.5e-45
WP_080951800.1|290129_291098_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.5	5.8e-88
WP_047035107.1|291350_291677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165832.1|292331_292796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035113.1|293050_293992_-	3'-5' exoribonuclease	NA	A0A1S5SFA9	Streptococcus_phage	37.8	5.7e-48
WP_047035114.1|293994_294324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052757118.1|294346_294772_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	31.8	1.6e-10
WP_047035115.1|294783_295179_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	41.5	6.2e-20
WP_047035116.1|295419_295608_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.0	2.0e-05
WP_052757119.1|295611_296316_+	Rha family transcriptional regulator	NA	A0A2P0ZL44	Lactobacillus_phage	41.7	1.7e-33
WP_155400834.1|296339_296501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035117.1|296478_296859_-	DUF2513 domain-containing protein	NA	D2KRD9	Lactobacillus_phage	55.6	8.8e-32
WP_003703566.1|297090_297357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047035119.1|297593_297773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052757120.1|297811_298483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047035120.1|298611_298803_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	50.8	5.2e-09
WP_147655604.1|298929_299094_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_047035122.1|299110_299332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035125.1|299331_299811_+	siphovirus Gp157 family protein	NA	A0A0A1EL06	Lactobacillus_phage	49.1	3.9e-37
WP_047035127.1|299810_301178_+	DEAD/DEAH box helicase family protein	NA	A0A0A1ENT0	Lactobacillus_phage	67.5	2.8e-176
WP_047035130.1|301174_301957_+	AAA family ATPase	NA	A0A0A1ENB5	Lactobacillus_phage	67.2	5.2e-87
WP_047035131.1|301956_302460_+	DUF669 domain-containing protein	NA	A0A0A1ELK1	Lactobacillus_phage	48.5	4.7e-41
WP_047035132.1|302525_303305_+	bifunctional DNA primase/polymerase	NA	A0A0A1ERC1	Lactobacillus_phage	63.3	2.5e-89
WP_047035133.1|303307_304564_+	helicase	NA	A0A0A1EL11	Lactobacillus_phage	61.8	1.5e-144
WP_047035134.1|304847_305162_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	64.1	1.9e-32
WP_047035136.1|305224_305416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147655606.1|305532_305907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035139.1|305896_306130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035141.1|306144_306375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035144.1|306386_306545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035146.1|306557_306860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035149.1|306877_307075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035152.1|307582_307771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035155.1|307773_308016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035156.1|308080_308368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035158.1|308380_308698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052757121.1|309322_309742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035159.1|310024_310234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035162.1|310235_310562_+	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	52.2	1.1e-17
WP_047035164.1|310687_311140_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	37.0	1.7e-18
WP_080951802.1|311129_312896_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	59.3	1.7e-202
WP_047035168.1|312908_314153_+|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	47.0	2.9e-100
WP_047036069.1|314133_314838_+|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	58.1	1.2e-71
WP_047035169.1|314834_315962_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	46.4	2.0e-84
WP_052757122.1|316180_316501_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_047035172.1|316490_316835_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_047035174.1|316846_317269_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_047035176.1|317265_317637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035177.1|317648_318296_+|tail	tail protein	tail	A0A060AKE9	Staphylococcus_phage	30.2	1.8e-13
WP_047035179.1|318295_318685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035183.1|323213_324029_+|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	41.2	7.9e-46
WP_047035185.1|324028_325879_+|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	32.7	1.1e-98
WP_047035186.1|325882_326641_+|holin	holin	holin	Q5ULM6	Lactobacillus_virus	28.1	1.8e-15
WP_003702550.1|326792_327071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035188.1|327070_328147_+|plate	BppU family phage baseplate upper protein	plate	O03968	Lactobacillus_phage	44.5	1.2e-49
WP_011475666.1|328227_328650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035190.1|328663_329068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011475668.1|329069_329252_+	XkdX family protein	NA	NA	NA	NA	NA
WP_047035192.1|329306_329612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003704600.1|329608_329935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035194.1|329946_331215_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6EVN0	Oenoccocus_phage	55.9	2.0e-120
WP_047035195.1|331720_333103_-	argininosuccinate lyase	NA	NA	NA	NA	NA
331716:331737	attR	AAAGATTATAAATTAAGTTGTT	NA	NA	NA	NA
WP_003709272.1|333126_334338_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_047035197.1|334899_336075_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_047035198.1|336090_337080_+	D-2-hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	36.0	8.1e-45
WP_047035200.1|337098_338148_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003699652.1|338421_339513_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_047035202.1|339742_340150_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003709294.1|340326_341166_+	pur operon repressor	NA	NA	NA	NA	NA
WP_047035205.1|341296_342514_+	MFS transporter	NA	NA	NA	NA	NA
WP_011475681.1|342656_344066_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	30.6	1.6e-25
WP_003699646.1|344156_345134_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.0	1.5e-43
WP_047035208.1|345206_345707_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047035210.1|345880_346720_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.1	8.2e-46
WP_003699642.1|346725_346962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047035211.1|347104_347875_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	46.3	1.8e-36
WP_003702586.1|347949_349572_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	1.0e-52
WP_047035213.1|349646_350315_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_011475686.1|350364_351330_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_047035215.1|351458_352559_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_014568166.1|352555_353305_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_047035217.1|353524_354550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035219.1|354549_356157_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	33.5	5.8e-32
WP_047035221.1|356160_357456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035223.1|357448_359461_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_047035224.1|359453_362069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035226.1|362122_363214_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_047035227.1|363231_363948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035229.1|364175_365702_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.5	1.6e-39
>prophage 3
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	699603	708375	1751565		Synechococcus_phage(33.33%)	9	NA	NA
WP_003702184.1|699603_700086_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.9	1.2e-22
WP_003702195.1|700082_701117_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_014568323.1|701428_702142_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.8	6.3e-39
WP_003703354.1|702160_702409_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003700039.1|702408_703083_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_047035516.1|703084_705310_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	5.9e-144
WP_003707943.1|705285_706737_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	1.5e-63
WP_003700044.1|706737_707775_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.3	2.0e-62
WP_003700046.1|707787_708375_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.9	1.1e-25
>prophage 4
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	964534	971409	1751565	transposase	Streptococcus_phage(33.33%)	7	NA	NA
WP_047035716.1|964534_965731_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.6	4.6e-26
WP_047035718.1|965727_967617_-	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	33.0	5.0e-27
WP_003704149.1|967637_968300_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	38.9	1.1e-37
WP_047035719.1|968304_969048_-	chain-length determining protein	NA	A0A1X9I5E1	Streptococcus_phage	33.6	5.4e-25
WP_047034952.1|969274_969463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047034953.1|969452_969809_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	2.8e-16
WP_080951820.1|970062_971409_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.4	1.7e-37
>prophage 5
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	1160962	1171002	1751565	transposase	Streptococcus_phage(28.57%)	10	NA	NA
WP_003700621.1|1160962_1161556_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.8	1.5e-54
WP_003700622.1|1161605_1162553_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	1.9e-51
WP_003710476.1|1162575_1163589_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	56.3	2.9e-98
WP_003700624.1|1163585_1164503_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	34.5	7.9e-10
WP_047035087.1|1164686_1166213_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.5	2.7e-39
WP_047034953.1|1166287_1166644_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	2.8e-16
WP_047034952.1|1166633_1166822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014568558.1|1166956_1167598_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003700626.1|1167621_1168092_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_047035789.1|1168167_1171002_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	7.4e-309
>prophage 6
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	1191976	1202507	1751565	protease,transposase	Leptospira_phage(33.33%)	9	NA	NA
WP_047035797.1|1191976_1194379_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.0	4.6e-41
WP_047035229.1|1194601_1196128_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.5	1.6e-39
WP_047034953.1|1196202_1196559_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	2.8e-16
WP_047034952.1|1196548_1196737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047035798.1|1196877_1198500_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.2	2.8e-159
WP_003706535.1|1198529_1198814_-	co-chaperone GroES	NA	A0A221S422	uncultured_virus	47.8	7.3e-15
WP_047035799.1|1199009_1199639_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_047035800.1|1199742_1200384_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_047035801.1|1200557_1202507_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.3	2.2e-49
>prophage 7
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	1208055	1217075	1751565		Streptococcus_phage(33.33%)	11	NA	NA
WP_047035804.1|1208055_1209048_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.9	2.6e-35
WP_003700663.1|1209082_1209709_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.0	6.9e-50
WP_011476227.1|1209828_1210068_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003700665.1|1210081_1210681_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_080550229.1|1210707_1211022_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_047035805.1|1211039_1212779_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.6	8.7e-58
WP_044005603.1|1212984_1213452_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_047035806.1|1213498_1214110_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003703366.1|1214312_1214543_+	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	40.3	6.1e-12
WP_003700671.1|1214539_1214923_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.7	5.8e-15
WP_047035807.1|1214903_1217075_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	62.8	2.9e-260
>prophage 8
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	1459658	1463711	1751565		Staphylococcus_phage(50.0%)	7	NA	NA
WP_047035902.1|1459658_1460417_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	9.1e-12
WP_041822915.1|1460416_1460644_-	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	35.6	1.9e-05
WP_003701672.1|1460657_1461155_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	36.7	1.3e-14
WP_003701682.1|1461655_1462528_-	DegV family protein	NA	NA	NA	NA	NA
WP_003701687.1|1462599_1462944_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.1	2.1e-08
WP_035150261.1|1462940_1463330_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	33.3	5.5e-05
WP_003705375.1|1463387_1463711_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.4	2.5e-19
>prophage 9
NZ_CP011403	Lactobacillus salivarius str. Ren chromosome, complete genome	1751565	1541796	1549185	1751565		Escherichia_phage(33.33%)	7	NA	NA
WP_052757128.1|1541796_1543341_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	38.9	2.3e-17
WP_080951852.1|1543368_1544907_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	60.7	7.7e-42
WP_047035942.1|1545183_1545636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035943.1|1545793_1546633_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.9	2.8e-38
WP_047035944.1|1546688_1547720_-	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	35.7	3.0e-50
WP_003701105.1|1547731_1548313_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.5	3.0e-31
WP_003702305.1|1548315_1549185_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	63.7	1.2e-105
>prophage 1
NZ_CP011404	Lactobacillus salivarius str. Ren plasmid pR1, complete sequence	176951	27860	45270	176951	integrase,transposase	Bacillus_phage(33.33%)	14	24331:24346	48584:48599
24331:24346	attL	TGTAACTAATTTTGGT	NA	NA	NA	NA
WP_147655624.1|27860_28754_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.0	1.9e-40
WP_047036129.1|28750_29269_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	7.8e-15
WP_047036130.1|29951_30905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003699254.1|30971_31247_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	62.9	4.1e-23
WP_047036131.1|31550_36140_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.5	3.0e-17
WP_014573588.1|36289_36985_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011475896.1|37142_37574_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.2	4.6e-29
WP_011475897.1|37673_38951_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	35.4	4.3e-54
WP_047036132.1|39291_39864_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	1.1e-22
WP_080951855.1|40008_40713_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_147655626.1|40916_41324_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	50.7	2.1e-31
WP_003703288.1|42292_42526_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_047036136.1|42844_44749_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.7	7.2e-98
WP_047036137.1|44988_45270_+|transposase	transposase	transposase	NA	NA	NA	NA
48584:48599	attR	TGTAACTAATTTTGGT	NA	NA	NA	NA
>prophage 2
NZ_CP011404	Lactobacillus salivarius str. Ren plasmid pR1, complete sequence	176951	85476	142959	176951	integrase,transposase	Catovirus(13.33%)	48	91697:91712	121661:121676
WP_047036162.1|85476_88602_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.6	8.2e-67
WP_147655630.1|88696_89800_-	restriction endonuclease subunit S	NA	A0A1V0S9X4	Catovirus	32.2	6.4e-14
WP_047036163.1|89796_90765_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	31.1	7.0e-33
WP_047036164.1|90895_91504_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_047036165.1|91508_92042_-	restriction endonuclease subunit S	NA	A0A1V0S9X7	Catovirus	33.1	1.1e-11
91697:91712	attL	TATTTTCATTATTTGT	NA	NA	NA	NA
WP_047036166.1|92031_93552_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.8	2.5e-53
WP_047036167.1|93732_95148_-	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	24.7	6.0e-25
WP_047036168.1|95140_95707_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_047036169.1|95900_96950_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014573620.1|97152_98148_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	38.1	1.8e-44
WP_047036170.1|98208_98889_-	fructose-6-phosphate aldolase	NA	A0A0E3EPH4	Synechococcus_phage	31.3	8.7e-22
WP_003699445.1|98955_99336_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_047036171.1|99591_100989_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080951857.1|101054_101492_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	62.0	1.1e-41
WP_047036173.1|101767_102970_+	MFS transporter	NA	NA	NA	NA	NA
WP_047036174.1|103042_103942_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_047036175.1|104046_106704_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_047036176.1|107547_113247_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_047036177.1|113353_115324_-	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_047036178.1|115674_116496_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047036180.1|116531_116798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187115525.1|116905_117748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047036236.1|118017_118665_-	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-09
WP_003710792.1|118778_119120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047036182.1|119572_120751_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_047036183.1|120768_121554_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003708605.1|121668_122160_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
121661:121676	attR	TATTTTCATTATTTGT	NA	NA	NA	NA
WP_003703477.1|122186_122501_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003708609.1|122517_123399_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_047036184.1|123411_124074_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_047036185.1|124331_124799_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	38.8	6.8e-18
WP_047036186.1|125013_126519_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_047036187.1|126536_127718_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_047036189.1|127727_128459_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003699392.1|128754_129192_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	40.7	3.9e-23
WP_047036190.1|129276_130140_-	ROK family protein	NA	NA	NA	NA	NA
WP_172399972.1|130370_131246_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_014573640.1|131266_131956_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_047036192.1|132001_132826_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047036193.1|132877_133495_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_047036194.1|133667_135155_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_003699379.1|135208_135316_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_011476677.1|135335_135605_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_052757141.1|135791_137726_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	29.3	6.2e-65
WP_147655638.1|139259_139481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047036196.1|141540_142050_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	7.7e-15
WP_191979250.1|142091_142802_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.9	1.4e-30
WP_160944225.1|142776_142959_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
