The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	400413	510487	4067838	tRNA,transposase,integrase,terminase	Pseudomonas_phage(12.9%)	94	481785:481800	494909:494924
WP_046848921.1|400413_401769_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_158441333.1|402720_402873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046848922.1|403227_404904_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_144412808.1|404942_405233_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_144413030.1|406709_406805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052752007.1|406789_407203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413031.1|407376_407526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412809.1|408370_408568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110310.1|411096_411288_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046848926.1|412173_412947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046848927.1|414766_415843_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.9e-80
WP_046848750.1|415896_416775_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046851416.1|417097_417469_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_052752008.1|417469_418348_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	30.4	7.3e-05
WP_046848928.1|418452_420138_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_052752009.1|420127_421387_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	38.5	1.4e-25
WP_046848929.1|421383_422214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848931.1|425904_426366_-	bacterioferritin	NA	NA	NA	NA	NA
WP_046848932.1|426561_427164_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_158441335.1|427226_427373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848933.1|427365_428868_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_046848934.1|428904_429237_+	EamA family transporter	NA	NA	NA	NA	NA
WP_046848935.1|429260_430583_-	histidine decarboxylase	NA	M1GX34	Paramecium_bursaria_Chlorella_virus	29.0	1.7e-37
WP_052752010.1|430893_431412_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_046848936.1|431906_432446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046851420.1|432542_433682_+	CapA family protein	NA	S4VS02	Pandoravirus	52.5	1.4e-112
WP_046848937.1|433885_434947_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046848938.1|435080_436403_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.6e-80
WP_046851421.1|436395_437010_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_046848939.1|437301_439710_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	49.6	1.5e-84
WP_046848940.1|439941_440907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046848941.1|441629_442961_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.2	1.3e-114
WP_046851422.1|444494_444803_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_046848943.1|445173_445467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848944.1|445715_447047_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.2	3.8e-114
WP_052752011.1|447089_447386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752012.1|447382_448036_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_082110313.1|448712_449540_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046848945.1|449993_450257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441338.1|450720_452511_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.1	5.3e-18
WP_046848946.1|452785_454459_-	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_046848947.1|454860_456015_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046848948.1|456011_456683_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.5e-29
WP_046848949.1|456679_457882_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_046848950.1|457878_459078_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_046848951.1|459164_459428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110314.1|460022_460397_+	endo alpha-1,4 polygalactosaminidase	NA	NA	NA	NA	NA
WP_046848952.1|461414_463121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752015.1|463138_464308_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_046848954.1|467469_467745_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_046848956.1|468690_469110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412810.1|469490_469799_+	translation initiation factor 2	NA	NA	NA	NA	NA
WP_052752021.1|470141_470576_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	28.9	3.0e-07
WP_046848958.1|472006_472603_+	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_046848959.1|473540_474134_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_046848960.1|474719_475847_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_046848961.1|476442_477000_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_046848962.1|477400_477760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848963.1|478294_478549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046848964.1|478802_479198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082110315.1|479779_480250_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	43.3	7.6e-25
WP_046848965.1|480487_480781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082110316.1|481091_481379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412787.1|481453_482583_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
481785:481800	attL	ATGGCTGCCTCCAGCG	NA	NA	NA	NA
WP_046848966.1|483639_484032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412811.1|485876_486530_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_144412812.1|486526_486823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046848944.1|486865_488197_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.2	3.8e-114
WP_144412813.1|488806_489340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110317.1|489522_489843_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	52.9	1.3e-20
WP_046848969.1|489861_490287_+	hypothetical protein	NA	A0A0A1IVF5	Pseudomonas_phage	38.7	6.2e-18
WP_052752025.1|490290_492462_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q38013	Pseudomonas_phage	44.5	2.2e-127
WP_046848970.1|492515_493256_+	AAA family ATPase	NA	R9U430	Rhizobium_phage	39.8	6.7e-36
WP_046848971.1|493257_493494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848972.1|493493_494093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848973.1|494074_494401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848974.1|494397_494838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848975.1|494871_495381_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	36.4	1.5e-13
494909:494924	attR	CGCTGGAGGCAGCCAT	NA	NA	NA	NA
WP_046848976.1|495455_495980_+	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	61.5	1.3e-54
WP_046851432.1|496043_496475_+	regulatory protein GemA	NA	A0A0U5KN76	unidentified_phage	44.8	6.7e-20
WP_046848977.1|496467_496857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848978.1|497234_498158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848979.1|498303_501087_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.2	1.8e-145
WP_046848980.1|501097_502966_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.0	3.2e-98
WP_046848981.1|503427_503709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046848982.1|503984_504494_+	hypothetical protein	NA	A0A2R2ZGC0	Ralstonia_phage	35.1	2.3e-19
WP_046848983.1|504483_504960_+	lysozyme	NA	A0A0B5KZG2	Acinetobacter_phage	48.5	1.8e-21
WP_046848984.1|504956_505493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848985.1|505493_505706_+	hypothetical protein	NA	A0A0U4IIN4	Pseudomonas_phage	43.3	2.7e-06
WP_046848986.1|505707_505926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848987.1|505934_506435_+	DUF1804 family protein	NA	R9U444	Rhizobium_phage	37.0	5.4e-29
WP_046848988.1|506427_508035_+|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	75.3	8.7e-238
WP_046848989.1|508028_509594_+	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	51.3	9.6e-149
WP_046848990.1|509677_510487_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	43.4	8.1e-59
>prophage 2
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	513882	531098	4067838	tail	Pseudomonas_phage(53.85%)	21	NA	NA
WP_046851433.1|513882_514890_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	46.0	8.5e-66
WP_046848993.1|514950_515325_+	hypothetical protein	NA	A0A0S4L3C3	Pseudomonas_phage	43.2	1.9e-15
WP_046851434.1|515479_516436_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	60.8	3.4e-96
WP_158441340.1|516506_516680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752028.1|516676_517177_+	DUF1320 family protein	NA	M4SPQ8	Rhodobacter_phage	33.6	1.5e-07
WP_046848994.1|517176_517677_+	phage virion morphogenesis protein	NA	A0A1B1P725	Rhodovulum_phage	43.0	8.3e-22
WP_046848995.1|517666_518107_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_046848996.1|518120_518315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848997.1|518333_519083_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	57.0	1.6e-69
WP_052752029.1|519109_519541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441342.1|519543_519681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752030.1|519683_522686_+|tail	phage tail tape measure protein	tail	H9EB42	Vibrio_phage	26.5	1.6e-30
WP_052752031.1|522682_524077_+	hypothetical protein	NA	A9J4X4	Pseudomonas_phage	28.7	3.1e-50
WP_046848998.1|524082_525045_+	hypothetical protein	NA	A0A125SA55	Pseudomonas_phage	32.9	1.6e-24
WP_046848999.1|525044_526739_+	hypothetical protein	NA	A0A1L2C8U3	Pseudomonas_phage	33.5	4.5e-67
WP_046849000.1|526735_527533_+	DUF2163 domain-containing protein	NA	A0A2D2W238	Stenotrophomonas_phage	34.4	3.2e-39
WP_046849001.1|527544_527775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849002.1|527774_527996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849003.1|527992_530173_+	hypothetical protein	NA	A0A2K8HP68	Pseudomonas_phage	39.7	2.4e-145
WP_162488639.1|530169_530400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849004.1|530330_531098_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	68.4	6.6e-103
>prophage 3
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	962795	1016707	4067838	protease,transposase	Synechococcus_phage(33.33%)	44	NA	NA
WP_052752068.1|962795_963590_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046849293.1|963897_964611_-	OmpA family protein	NA	NA	NA	NA	NA
WP_046849294.1|964644_965049_-	exosortase system-associated protein, TIGR04073 family	NA	NA	NA	NA	NA
WP_046851502.1|965836_966487_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_046851503.1|966806_967964_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.6	2.2e-09
WP_046849296.1|968162_971303_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_046849297.1|971305_972898_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_082110541.1|972909_974238_-	TolC family protein	NA	NA	NA	NA	NA
WP_158441377.1|974334_974508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412839.1|974858_975293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849299.1|975351_975705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849300.1|976271_976568_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_158441379.1|978410_978635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412841.1|979633_979807_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_144412843.1|979824_980953_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_052752070.1|981189_981693_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046849304.1|982267_982741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158441381.1|982973_983126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413039.1|983155_984349_+	NnrS family protein	NA	NA	NA	NA	NA
WP_046849305.1|984488_985034_-	NADP oxidoreductase	NA	NA	NA	NA	NA
WP_046851507.1|985023_985767_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_046849306.1|985771_987520_-	NADP oxidoreductase	NA	NA	NA	NA	NA
WP_046849307.1|987526_987910_-	RidA family protein	NA	NA	NA	NA	NA
WP_046849309.1|988608_989469_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_046849310.1|989633_990881_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_046849312.1|992841_993477_+	DedA family protein	NA	NA	NA	NA	NA
WP_046849313.1|993692_996338_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_046849314.1|996787_997768_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_046849315.1|998233_998707_+	universal stress protein	NA	NA	NA	NA	NA
WP_046849316.1|998740_999547_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_046849317.1|999545_1000583_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_046849318.1|1000706_1002086_-	porin	NA	NA	NA	NA	NA
WP_052752071.1|1002888_1003365_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158441383.1|1003300_1003411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849319.1|1003495_1004008_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_082110336.1|1005609_1006152_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_046849321.1|1006600_1007185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849322.1|1008023_1008320_-	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_046849323.1|1009144_1009429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849324.1|1009680_1009848_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_144412844.1|1010120_1011239_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_046849325.1|1011307_1014022_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_046849326.1|1014031_1015198_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_046848944.1|1015375_1016707_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.2	3.8e-114
>prophage 4
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	1022726	1113110	4067838	transposase,integrase,terminase	Pseudomonas_phage(27.27%)	83	1011219:1011234	1085638:1085653
1011219:1011234	attL	GTAGATGCACCCAATG	NA	NA	NA	NA
WP_144412845.1|1022726_1024282_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082110338.1|1024998_1025568_+	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_046849330.1|1025847_1026015_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_046849331.1|1026789_1027068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849332.1|1027264_1029109_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.5	1.5e-76
WP_144412846.1|1030038_1030236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752075.1|1032286_1032574_-	HicB family protein	NA	A0A0R6PJ17	Moraxella_phage	47.2	2.1e-14
WP_046849335.1|1034634_1035099_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_046849336.1|1035316_1035544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412847.1|1035732_1035933_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_052752077.1|1040618_1041509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849338.1|1041660_1042098_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_046849339.1|1042472_1043804_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.0	3.8e-114
WP_046849340.1|1044194_1045256_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046849341.1|1047791_1048151_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412830.1|1048146_1048617_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849342.1|1048650_1049475_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158441385.1|1050193_1050337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752078.1|1051544_1052126_-	hypothetical protein	NA	A0A1B0XU26	Freshwater_phage	29.9	1.3e-10
WP_046849345.1|1053225_1054401_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_158441387.1|1055739_1055958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752081.1|1057109_1057508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412787.1|1059327_1060457_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_144412848.1|1060490_1060976_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849349.1|1060971_1061331_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849350.1|1061436_1062327_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849351.1|1062845_1064114_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_052752086.1|1067778_1068381_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_046849353.1|1068978_1069284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849354.1|1069280_1069472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849355.1|1069545_1070163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849356.1|1070152_1070452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110543.1|1070430_1070907_-	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	42.3	5.5e-23
WP_046851521.1|1071361_1071703_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	54.7	3.1e-20
WP_046849357.1|1071760_1072198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752088.1|1072194_1074462_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q38013	Pseudomonas_phage	38.7	9.1e-116
WP_046849358.1|1074520_1075261_+	ATP-binding protein	NA	R9U430	Rhizobium_phage	40.8	6.3e-34
WP_148906877.1|1075262_1075661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849360.1|1075660_1076257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849361.1|1076238_1076580_+	hypothetical protein	NA	R9U499	Rhizobium_phage	38.2	3.6e-08
WP_046849362.1|1076576_1076831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412849.1|1076962_1077301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849364.1|1077320_1077803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849365.1|1077806_1078322_+	hypothetical protein	NA	B5TA84	Burkholderia_phage	35.7	9.2e-08
WP_046849366.1|1078342_1078867_+	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	62.4	1.9e-53
WP_046849367.1|1078931_1079363_+	regulatory protein GemA	NA	A0A2P9JZH5	Alteromonadaceae_phage	41.5	1.5e-19
WP_046849368.1|1079355_1079751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849369.1|1080057_1080570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082110340.1|1080569_1081445_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_046849370.1|1081561_1082848_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_046849371.1|1082887_1083628_-	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	42.4	1.5e-56
WP_046849372.1|1086647_1087160_+	hypothetical protein	NA	I6R9Z4	Marinomonas_phage	41.5	2.2e-22
1085638:1085653	attR	GTAGATGCACCCAATG	NA	NA	NA	NA
WP_144412850.1|1087149_1087626_+	glycoside hydrolase family protein	NA	A0A0A8KXN5	Burkholderia_phage	45.6	1.0e-24
WP_046849374.1|1087622_1088156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849375.1|1088156_1088369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412851.1|1088371_1088590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849377.1|1088598_1089099_+	DUF1804 family protein	NA	R9U444	Rhizobium_phage	38.2	1.6e-28
WP_046849378.1|1089091_1090699_+|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	75.0	1.9e-237
WP_046849379.1|1090692_1092264_+	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	52.1	5.1e-150
WP_046849380.1|1092363_1093209_+	hypothetical protein	NA	A0A2I7S9F9	Vibrio_phage	43.0	1.1e-58
WP_046849381.1|1093271_1093985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412852.1|1094340_1095630_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_052752089.1|1095883_1096933_+	hypothetical protein	NA	A0A2D1GNS3	Pseudomonas_phage	46.0	6.8e-66
WP_046849383.1|1096967_1097342_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	45.0	1.9e-15
WP_046851525.1|1097496_1098453_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	60.8	1.3e-95
WP_158441389.1|1098523_1098697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752090.1|1098693_1099194_+	DUF1320 domain-containing protein	NA	M4SPQ8	Rhodobacter_phage	33.6	1.5e-07
WP_046849384.1|1099193_1099694_+	phage virion morphogenesis protein	NA	A0A1B1P725	Rhodovulum_phage	43.7	4.9e-22
WP_046849385.1|1099683_1100124_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_046849386.1|1100137_1100332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849387.1|1100350_1101100_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	56.6	6.1e-69
WP_046849388.1|1101125_1101557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441391.1|1101559_1101697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752091.1|1101699_1104699_+	tape measure protein	NA	H9EB42	Vibrio_phage	26.5	2.2e-29
WP_144412853.1|1104764_1106090_+	hypothetical protein	NA	A0A0S0N5B2	Pseudomonas_phage	34.7	6.6e-50
WP_144412854.1|1106224_1107058_+	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	31.3	5.3e-21
WP_144412855.1|1107021_1108752_+	hypothetical protein	NA	A0A1L2C8U3	Pseudomonas_phage	32.7	7.3e-65
WP_046849391.1|1108748_1109546_+	DUF2163 domain-containing protein	NA	A0A2D2W238	Stenotrophomonas_phage	34.8	1.3e-40
WP_046849001.1|1109557_1109788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849392.1|1109787_1110015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441393.1|1110169_1110442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158441395.1|1110457_1112185_+	hypothetical protein	NA	A0A0S0MXF4	Pseudomonas_phage	37.1	3.8e-98
WP_046849394.1|1112342_1113110_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	68.0	9.6e-102
>prophage 5
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	1140538	1260002	4067838	tRNA,protease,transposase,integrase	Pseudomonas_phage(14.29%)	112	1140472:1140531	1188472:1189736
1140472:1140531	attL	TGAAGTGGTACCCAAAAACTGTACAGGTTGTTAAGCTCTGGCAGAATTAAAAAGGAGCTT	NA	NA	NA	NA
WP_144412787.1|1140538_1141667_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_082110344.1|1141951_1142638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849416.1|1143056_1143461_-	hypothetical protein	NA	A0A2I7S7C3	Vibrio_phage	49.6	2.6e-18
WP_052752095.1|1143462_1143894_-	cell wall hydrolase	NA	A0A0U2UVF2	Pseudomonas_phage	31.9	7.7e-08
WP_046849417.1|1143904_1144186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412859.1|1144238_1144466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412860.1|1144618_1145377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849420.1|1145448_1146036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849421.1|1146035_1146365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849422.1|1146361_1146799_-	hypothetical protein	NA	A5H1M1	Xanthomonas_virus	39.5	7.3e-06
WP_046848937.1|1147101_1148163_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046849425.1|1152322_1153858_-	tape measure protein	NA	A0A0M5MTI3	Ralstonia_phage	44.1	3.9e-38
WP_046849426.1|1155203_1155416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752096.1|1155683_1156847_-	hypothetical protein	NA	A0A1S7FZ15	Listeria_phage	35.2	3.3e-45
WP_052752097.1|1156801_1158061_-	hypothetical protein	NA	A0A0E3M0K5	Verrucomicrobia_phage	28.7	3.1e-33
WP_082110544.1|1158060_1158744_-	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	56.5	9.6e-29
WP_046849427.1|1159153_1159438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849428.1|1159551_1159992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849429.1|1159988_1160360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752099.1|1160413_1160965_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	41.7	1.4e-25
WP_158441399.1|1161265_1161670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849431.1|1161644_1162049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849432.1|1162127_1162589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849433.1|1162667_1162859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082110545.1|1162867_1163173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752100.1|1163271_1163964_+	helix-turn-helix domain-containing protein	NA	J7I0S2	Pseudomonas_phage	37.5	2.3e-22
WP_046849434.1|1164111_1164501_+	hypothetical protein	NA	A0A2D1GN03	Marinobacter_phage	45.9	7.4e-10
WP_046849435.1|1164749_1165286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849436.1|1165417_1166401_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	23.1	2.9e-18
WP_046849437.1|1166692_1166890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158441401.1|1167193_1167370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441403.1|1167539_1167686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849438.1|1167902_1168184_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046849439.1|1168495_1169029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849441.1|1169708_1169894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849442.1|1170055_1170295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441405.1|1170410_1170551_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_046849443.1|1170556_1171591_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	55.4	4.2e-92
WP_046849444.1|1172078_1173119_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_046849445.1|1173108_1174194_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.9	7.2e-87
WP_046849446.1|1174247_1174718_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.4	5.6e-12
WP_046849447.1|1174773_1176618_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_046849448.1|1176701_1177634_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.0	1.3e-44
WP_046849449.1|1178401_1178959_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_046848826.1|1179040_1179619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851395.1|1180990_1181815_-	methane monooxygenase/ammonia monooxygenase subunit A	NA	NA	NA	NA	NA
WP_046851396.1|1182093_1182906_-	methane monooxygenase/ammonia monooxygenase subunit C	NA	NA	NA	NA	NA
WP_046849451.1|1183566_1183911_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_046849452.1|1184732_1184984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110346.1|1185504_1186254_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.4	1.7e-10
WP_046849453.1|1186866_1187577_-	RNA polymerase sigma factor FliA	NA	A0A288WG21	Bacillus_phage	25.6	9.1e-06
WP_144412787.1|1188538_1189667_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_082110546.1|1189885_1190164_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1188472:1189736	attR	TGAAGTGGTACCCAAAAACTGTACAGGTTGTTAAGCTCTGGCAGAATTAAAAAGGAGCTTAATAACAATGAGTAAAAAGCGCATACAATATTCGAGCGAATTCAAAGCAAAACTAGCGCTGGCAGCGATACGTGGTGATGAAACTGTCCCCCAATTAGCAGCGCGTTATAATGTACATCCCACGCAGATCAATAGCTGGAAACGGCAACTCATTGAGCAAGCTGCCGAGCTGTTTTGTAAAAATAATACTGCCGCCAATAAGGAGCAGCCTACAACAGATGACCTGCACCGGGTTATTGGTCAATTGGCGGTAGAACGCGATTTTTTAGCAAGAAAGCTCAATCATTAAGTCTTGTAGAACGCAAAGAGATGATTGAGCCCCATGGCAAACTTAGTCAAACTCGTCAATGTCAGCTGCTGGATCTGGCGCGCTCAACTTATTATTATCAACCGCAACCAATCAGTAATGCTGATCTGGTTCTGCTGCGCATGATGGATGAACAGTACTTAAAGACGCCACAATATGGCTCACGCAGTTATGCTACCTGGTTTCAGCGCCAGGGAATCATGTTAGGGCGCAAGAAAGCCTCTTCCTTAATGAAGACACTCGGTATTGTCAGCATAGCTCCAAAACCCAGGACCAGCATCTCAAGCAAACAGCATAAGGTCTATCCTTATCTGCTTAGAGAACTTGTCATTAATAAACCCAATCAGGTTTGGGCTGCCGACATAACCTATGTCCCCATGGAGAAAGGCTTTGGCTATCTGGTTGCCATCATCGACTGGCATTCGCGTAAGGTGTTGAGCTGGCGCTTGTCCAATACCTTGGATACTGACTTTTGTACTCAGGCGCTGGAGGCAGCCATCCAGGATTATGGCTGTCCACAGATCATGAATACCGACCAGGGCGTACAGTTTACCAGCGAAGCATTTACCTCCATACTAAAAGATCATCATATTCAGATCAGCATGGATGGCAAGGGGTGCTACTATGACAACATTTTTGTTGAACGACTTTGGCGGACAGTTAAGTATGAGCTTTTATATACCAGAGAATTCAATAATCTGAAGGAGATAAAGCAGAATTTATCCACATGGTTTGAATGGTACAATCAAGAACGATTTCATCAAAGCCTTGACCGTCTTACGCCTGATGAAATCTACTATAGTGATCCAAGAATTGATCGGGTTGCCTGAACCTGTTTAACTATACATATCAGAGCTGAACTTTCTTTCAGGTTGTCCAGTTACAGGGAACCACATCA	NA	NA	NA	NA
WP_046849455.1|1190211_1190670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849456.1|1190887_1192198_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	39.7	9.2e-36
WP_046849457.1|1192737_1193169_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.4	2.2e-18
WP_046849458.1|1193165_1193765_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_046849459.1|1193807_1194527_-	cytochrome c1	NA	NA	NA	NA	NA
WP_046849460.1|1194523_1195771_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_046849461.1|1195772_1196372_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_052752101.1|1197115_1197667_+|transposase	transposase	transposase	A4KWT9	Enterobacteria_phage	36.5	1.2e-26
WP_046849463.1|1198197_1200921_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_144412861.1|1202027_1202258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849465.1|1202772_1204083_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	34.0	2.0e-70
WP_046849466.1|1204120_1205293_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_046849467.1|1205359_1205545_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_046849468.1|1205666_1206554_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_046849469.1|1206555_1207731_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_046849470.1|1207717_1208929_-	GTPase HflX	NA	NA	NA	NA	NA
WP_046849471.1|1208921_1209167_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_046849472.1|1209415_1210927_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_046849473.1|1211479_1212478_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_046849474.1|1212625_1213186_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_046849475.1|1213428_1215138_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046849476.1|1215125_1215731_+	lytic transglycosylase domain-containing protein	NA	U5PVY0	Bacillus_phage	28.4	1.7e-05
WP_046849477.1|1215739_1216246_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_046849478.1|1216250_1217783_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.1e-08
WP_046849479.1|1218037_1218820_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_046849480.1|1218941_1219589_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	31.7	9.8e-15
WP_046849481.1|1219693_1220710_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_046849482.1|1220960_1221452_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_046849483.1|1221455_1223159_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.0	1.2e-51
WP_046849484.1|1223509_1224958_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_046849485.1|1225087_1225951_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_046849486.1|1226082_1229988_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_046849487.1|1230227_1233020_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_046849488.1|1233216_1233645_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_144412862.1|1233955_1234237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849489.1|1234233_1234764_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082110347.1|1234830_1236621_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_046849490.1|1236920_1237346_-	universal stress protein	NA	NA	NA	NA	NA
WP_046849491.1|1237387_1238110_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.3	5.2e-33
WP_046849492.1|1238122_1239286_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_046849493.1|1239762_1240725_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_046851540.1|1240821_1241508_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_046849494.1|1241625_1242507_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_046849495.1|1242496_1243255_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_046849496.1|1243271_1244444_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_082110547.1|1244456_1245464_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_082110348.1|1245531_1246284_+	ComF family protein	NA	NA	NA	NA	NA
WP_046849498.1|1246294_1246765_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_144413040.1|1246909_1249033_-	type IV pilus secretin PilQ	NA	NA	NA	NA	NA
WP_046849499.1|1249041_1249569_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_046849500.1|1249565_1250192_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_046849501.1|1250314_1250902_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_046849502.1|1250898_1252002_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_046849503.1|1252238_1254554_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_046849504.1|1254572_1255580_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_046849505.1|1255654_1256377_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_052752104.1|1256388_1257147_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_052752371.1|1257148_1258138_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_046849508.1|1258610_1260002_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	1446724	1554556	4067838	transposase	Acidithiobacillus_phage(28.57%)	99	NA	NA
WP_046851564.1|1446724_1448197_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_046849632.1|1450037_1450580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412867.1|1450569_1451319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849634.1|1451864_1452083_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046849635.1|1452079_1452586_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	53.3	3.4e-39
WP_046849636.1|1452585_1453392_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.6	1.1e-105
WP_046849637.1|1453415_1454048_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	65.7	1.2e-73
WP_046849638.1|1454061_1454520_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	70.2	4.6e-59
WP_046849639.1|1454516_1455260_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	75.5	5.6e-107
WP_046849640.1|1455256_1455679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849641.1|1455694_1458025_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	66.3	3.6e-309
WP_046849642.1|1458171_1458639_+	phage related protein	NA	K4ICN3	Acidithiobacillus_phage	70.6	3.8e-61
WP_046849643.1|1458635_1458845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849644.1|1458837_1459233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849645.1|1459574_1460990_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	59.1	1.3e-152
WP_082110553.1|1460992_1462279_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	76.3	2.0e-184
WP_046849646.1|1462259_1462538_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_046849647.1|1462537_1462747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849648.1|1462886_1463183_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	44.9	6.7e-11
WP_046849649.1|1463348_1463663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849650.1|1463727_1464216_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.5	1.4e-21
WP_046849651.1|1464229_1464412_-	hypothetical protein	NA	D0R0C0	Streptococcus_phage	58.0	3.6e-07
WP_046851566.1|1464725_1465238_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	72.0	6.7e-59
WP_158441413.1|1465237_1465399_+	hypothetical protein	NA	A0A2H4JIC6	uncultured_Caudovirales_phage	88.2	4.7e-11
WP_144412868.1|1470361_1470622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849653.1|1470867_1472934_+	catalase	NA	A0A2K9L572	Tupanvirus	49.4	2.2e-137
WP_158441415.1|1473019_1473136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851567.1|1475783_1476017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752121.1|1476273_1476729_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_046849655.1|1477935_1478298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849656.1|1478434_1479409_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046849657.1|1479585_1481061_+	ribulose-bisphosphate carboxylase large subunit	NA	NA	NA	NA	NA
WP_046849658.1|1481082_1481517_+	ribulose bisphosphate carboxylase small subunit	NA	NA	NA	NA	NA
WP_046849659.1|1481787_1482717_+	CbbX protein	NA	S5MNT2	Brevibacillus_phage	31.0	6.1e-34
WP_046849660.1|1482753_1483095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849661.1|1483135_1484320_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_046849662.1|1484439_1484883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849663.1|1485168_1486398_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_046849664.1|1486635_1487079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158441417.1|1487075_1487240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412869.1|1487282_1488837_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144413044.1|1489526_1489658_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849665.1|1489733_1490120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849666.1|1490282_1490480_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082110355.1|1490701_1491451_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.1	1.8e-12
WP_046849667.1|1492935_1493259_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_046849668.1|1493966_1494170_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	72.7	3.1e-20
WP_158441419.1|1494365_1494515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849669.1|1494570_1495773_+	RtcB family protein	NA	A0A1W6DX78	Sphingobium_phage	56.1	5.0e-129
WP_046849670.1|1496007_1496217_+	CsbD family protein	NA	NA	NA	NA	NA
WP_046849671.1|1496685_1497747_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046849672.1|1498076_1498709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412787.1|1498838_1499968_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_046849673.1|1500032_1500215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849674.1|1500632_1501829_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_052752122.1|1502916_1503312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110554.1|1504261_1504402_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046849676.1|1504456_1505308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849678.1|1506683_1507604_+	lactate/malate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_046849679.1|1510992_1511283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849680.1|1511308_1512310_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849681.1|1512438_1512624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752123.1|1513474_1514503_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	29.9	3.6e-27
WP_082110555.1|1515382_1516864_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_046849682.1|1517154_1517373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849683.1|1517911_1519243_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.2	6.5e-114
WP_046849684.1|1519622_1520507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849685.1|1520750_1523099_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.7	2.7e-94
WP_158441421.1|1522987_1523224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110356.1|1523299_1523473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849686.1|1523428_1523707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849687.1|1523750_1524083_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_052752125.1|1524617_1525151_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_046849688.1|1525717_1527052_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_046851577.1|1527366_1528839_+|transposase	ISNCY-like element ISNco1 family transposase	transposase	NA	NA	NA	NA
WP_046849689.1|1529120_1530101_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_158441423.1|1530491_1530644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158441425.1|1530740_1530878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752126.1|1531347_1531578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849691.1|1531822_1532893_-	endonuclease	NA	NA	NA	NA	NA
WP_082110357.1|1534222_1535320_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_046849693.1|1535587_1535923_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.6	4.0e-28
WP_046849694.1|1535909_1536248_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046849695.1|1536258_1537464_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_046849696.1|1538297_1538654_-	DsrE family protein	NA	NA	NA	NA	NA
WP_082110358.1|1540187_1540409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162488640.1|1540506_1540683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849697.1|1541482_1543633_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	52.5	1.6e-154
WP_082110359.1|1543700_1544450_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.2	5.3e-12
WP_052752128.1|1544673_1545687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849698.1|1546101_1546356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110360.1|1548124_1548853_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_046849699.1|1549158_1549440_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082110361.1|1549460_1550234_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.3	1.6e-16
WP_046849671.1|1550287_1551349_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082110362.1|1551476_1551632_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052752131.1|1551927_1552176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849700.1|1552368_1553196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110364.1|1553806_1554556_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.2	2.4e-12
>prophage 7
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	1651173	1714420	4067838	tRNA,transposase,integrase	Planktothrix_phage(16.67%)	46	1693031:1693048	1715700:1715717
WP_046848682.1|1651173_1652052_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046849773.1|1652232_1653489_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046849774.1|1653478_1654219_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	5.9e-24
WP_082110373.1|1654286_1654946_+	DUF3299 domain-containing protein	NA	NA	NA	NA	NA
WP_052752139.1|1654958_1655513_-	DUF2796 domain-containing protein	NA	NA	NA	NA	NA
WP_082110375.1|1655837_1657178_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	26.8	1.4e-36
WP_046849775.1|1657408_1658515_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_082110376.1|1658617_1660180_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	29.7	1.2e-31
WP_046849776.1|1660816_1661017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082110377.1|1661001_1661976_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_046849777.1|1661978_1665179_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	25.6	2.7e-17
WP_046849778.1|1665294_1666923_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_052752376.1|1667044_1667368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849779.1|1667591_1668620_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_046849780.1|1668861_1669677_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046849781.1|1669705_1670062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752141.1|1671916_1673005_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_046849783.1|1674900_1675200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849784.1|1675467_1677525_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_046849785.1|1677667_1678927_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_046851606.1|1679038_1679698_-	adenylate kinase	NA	NA	NA	NA	NA
WP_046849786.1|1679907_1680942_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.7	8.9e-111
WP_046849787.1|1680941_1681391_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_046849788.1|1681433_1684025_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.7	1.2e-82
WP_046849789.1|1684099_1684762_+	protocatechuate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_046849790.1|1684787_1685738_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.1	3.3e-59
WP_046851607.1|1685809_1686304_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_046849791.1|1686300_1687536_-	MFS transporter	NA	NA	NA	NA	NA
WP_046849792.1|1688234_1690238_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	32.3	5.4e-80
1693031:1693048	attL	TGTAAGGCCTGACCCTAA	NA	NA	NA	NA
WP_046849793.1|1694169_1696128_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	34.1	9.4e-85
WP_052752142.1|1696133_1698539_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.1	3.5e-81
WP_046849794.1|1698721_1700065_+	GTPase HflX	NA	NA	NA	NA	NA
WP_144413048.1|1700178_1700247_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_052752143.1|1700636_1702706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848937.1|1703237_1704299_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_144412879.1|1704572_1705043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849796.1|1705656_1707225_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_158441435.1|1707221_1707929_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.6	1.7e-20
WP_046849797.1|1707972_1708527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849798.1|1709388_1710291_-	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	28.0	1.6e-18
WP_158441437.1|1710570_1710723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849799.1|1710751_1711057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412881.1|1711138_1711321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412882.1|1711441_1711702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849800.1|1712019_1712544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848937.1|1713358_1714420_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1715700:1715717	attR	TTAGGGTCAGGCCTTACA	NA	NA	NA	NA
>prophage 8
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	1802863	1854198	4067838	tRNA,protease,transposase	Staphylococcus_phage(20.0%)	50	NA	NA
WP_046851621.1|1802863_1803787_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.5	1.5e-109
WP_046849866.1|1803958_1804426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849867.1|1804422_1804890_+	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_046849868.1|1804967_1805444_+	cytochrome c	NA	NA	NA	NA	NA
WP_046849869.1|1805716_1807000_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_046849870.1|1807126_1807336_-	DUF3460 family protein	NA	NA	NA	NA	NA
WP_046849871.1|1807464_1808883_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	43.0	5.0e-112
WP_046849872.1|1809110_1811000_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_046849873.1|1811003_1811657_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_046849874.1|1811669_1812434_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.1	2.6e-22
WP_046849875.1|1812485_1813325_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	32.5	1.5e-07
WP_046849876.1|1813383_1814352_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_046849877.1|1815549_1816500_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_046849878.1|1816546_1817728_+	malate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_046849879.1|1817739_1818627_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	35.8	4.2e-16
WP_046851622.1|1818768_1819383_+	YqhA family protein	NA	K4K6D8	Caulobacter_phage	29.5	2.6e-17
WP_046851623.1|1819371_1819881_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.2	4.6e-28
WP_046849880.1|1820028_1820574_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_046849881.1|1820554_1821526_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_046849882.1|1821586_1822084_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_046849883.1|1822094_1822574_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.6	4.0e-21
WP_046849884.1|1822625_1823741_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	35.1	1.1e-50
WP_046849885.1|1823751_1824351_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.2	8.4e-29
WP_046849886.1|1824823_1825498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849887.1|1825524_1826835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752154.1|1826891_1828736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849888.1|1828771_1830127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441451.1|1830685_1833634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441453.1|1833720_1833867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849891.1|1834262_1834502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849892.1|1834690_1835404_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_046849893.1|1835417_1835777_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412830.1|1835772_1836243_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412889.1|1836449_1837817_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_046849894.1|1838497_1840312_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_046849895.1|1840341_1840980_+	DsbA family protein	NA	NA	NA	NA	NA
WP_046849896.1|1841198_1841978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752155.1|1842380_1843004_+	hypothetical protein	NA	A0A1J0F9F1	Only_Syngen_Nebraska_virus	39.8	5.9e-33
WP_144412826.1|1843024_1843495_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849897.1|1843490_1843850_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412890.1|1843893_1844391_+	hypothetical protein	NA	A0A060D2X4	Bovine_gammaherpesvirus	34.7	1.2e-20
WP_144412891.1|1844499_1844652_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_082110383.1|1844998_1845367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752157.1|1846547_1847039_+	hypothetical protein	NA	A0A060D2X4	Bovine_gammaherpesvirus	34.3	3.4e-20
WP_046849898.1|1847712_1848252_-	3'-5' exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	28.1	3.5e-10
WP_046849899.1|1848248_1849415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849900.1|1849414_1850314_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046849901.1|1850313_1850805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849902.1|1852316_1852838_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_046849903.1|1852869_1854198_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	31.2	1.1e-44
>prophage 9
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	2237917	2286491	4067838	transposase	Enterobacteria_phage(28.57%)	49	NA	NA
WP_046848682.1|2237917_2238796_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_158441471.1|2238988_2239162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082110408.1|2240987_2241329_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_046850155.1|2242102_2242837_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046850156.1|2244471_2245803_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.2	2.9e-114
WP_046850157.1|2245873_2246068_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_052752178.1|2246157_2246442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441473.1|2246611_2246773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752179.1|2247372_2247942_+	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_052752180.1|2247938_2248406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412911.1|2248394_2248715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850158.1|2248814_2250158_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_046850159.1|2250554_2250749_+	DUF2795 domain-containing protein	NA	NA	NA	NA	NA
WP_144412912.1|2250850_2251234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850160.1|2252465_2253695_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.7	2.1e-10
WP_158441475.1|2253748_2253898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082110409.1|2253935_2254247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752182.1|2254141_2254360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441477.1|2254396_2254693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850161.1|2254826_2255486_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_158441479.1|2255519_2255657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850163.1|2257121_2257538_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_046850164.1|2257838_2258207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850165.1|2258388_2258706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850166.1|2258946_2259930_+	endonuclease	NA	NA	NA	NA	NA
WP_144412913.1|2260333_2260567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850167.1|2260857_2261043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850168.1|2261453_2262344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850169.1|2262540_2264136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752184.1|2264149_2265241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850170.1|2265588_2265861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412915.1|2266023_2266329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110412.1|2266879_2269069_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_144412916.1|2269363_2269672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850173.1|2269881_2270373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412917.1|2270995_2271244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412787.1|2271454_2272584_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_158441481.1|2272827_2273844_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	35.2	3.5e-19
WP_144413052.1|2274583_2276254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441483.1|2276838_2276994_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	56.2	2.0e-06
WP_082110413.1|2277271_2277505_-|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	66.7	2.1e-15
WP_052752187.1|2277967_2280325_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_144412920.1|2280688_2280994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850177.1|2281105_2281597_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_046850178.1|2281621_2281948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158441485.1|2281991_2282171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412921.1|2282906_2283899_+	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_046850180.1|2284087_2285290_-	RtcB family protein	NA	A0A1W6DX78	Sphingobium_phage	55.7	2.2e-129
WP_046849671.1|2285429_2286491_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	2296775	2343953	4067838	tRNA,transposase	Paenibacillus_phage(33.33%)	39	NA	NA
WP_082110416.1|2296775_2297531_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.1	1.4e-12
WP_046851691.1|2297808_2298303_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_046850189.1|2298561_2299452_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046850191.1|2300923_2301214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850192.1|2303262_2304153_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082110417.1|2304655_2304787_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052752191.1|2306063_2307011_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046850193.1|2307397_2307697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412922.1|2308167_2308347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752192.1|2308755_2309151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850194.1|2310892_2311105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850195.1|2311819_2312881_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162488641.1|2313896_2314127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110418.1|2314502_2314853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046848830.1|2317418_2317610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849032.1|2319196_2319490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850196.1|2319738_2321070_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	48.7	6.5e-114
WP_052752196.1|2321114_2321411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752197.1|2321407_2322061_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_158441487.1|2323957_2324179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850201.1|2325021_2325837_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	33.2	1.1e-18
WP_046850202.1|2325918_2326764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110420.1|2326760_2327327_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158441489.1|2327316_2327544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752198.1|2328375_2329389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441491.1|2329737_2329905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850204.1|2330010_2330244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850205.1|2330478_2330931_+	cytochrome c	NA	NA	NA	NA	NA
WP_046850206.1|2330963_2332310_+	nitric oxide reductase	NA	NA	NA	NA	NA
WP_046850207.1|2332322_2333147_+	CbbQ/NirQ/NorQ/GpvN family protein	NA	NA	NA	NA	NA
WP_046851697.1|2335774_2335975_-	CsbD family protein	NA	NA	NA	NA	NA
WP_158441493.1|2338075_2338270_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046850209.1|2338208_2338574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046850210.1|2338560_2339067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412924.1|2339663_2340596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752200.1|2341106_2342432_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_052752201.1|2342945_2343377_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046850212.1|2343370_2343574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850213.1|2343533_2343953_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	2539455	2614143	4067838	tRNA,transposase	Erysipelothrix_phage(11.76%)	78	NA	NA
WP_144412939.1|2539455_2540412_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046851731.1|2540356_2541667_-	DUF3422 domain-containing protein	NA	NA	NA	NA	NA
WP_046850333.1|2541999_2542854_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_082110430.1|2543736_2544792_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_046850334.1|2544940_2545261_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_046850335.1|2545838_2547317_+	tyrosinase family protein	NA	NA	NA	NA	NA
WP_144412940.1|2547415_2547895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850337.1|2547982_2549044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850338.1|2549321_2550569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850339.1|2550586_2551729_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_046850340.1|2551734_2553576_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_046850341.1|2553626_2554703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850342.1|2555073_2556984_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_046850343.1|2557274_2557478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412942.1|2557831_2558182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850344.1|2558703_2559063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412826.1|2559058_2559529_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046850345.1|2561064_2561397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752218.1|2561397_2561754_-	hypothetical protein	NA	A0A218MMC8	uncultured_virus	47.6	2.3e-13
WP_046850346.1|2561916_2562105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850347.1|2562088_2562868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850348.1|2563162_2563423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441501.1|2563412_2563586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110432.1|2563942_2564221_+	DUF4372 domain-containing protein	NA	NA	NA	NA	NA
WP_052752219.1|2564290_2564728_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052752220.1|2564724_2565207_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046850350.1|2565693_2565927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752221.1|2566075_2567422_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	23.3	1.6e-27
WP_082110434.1|2567512_2567758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046850351.1|2567754_2568240_-	VOC family protein	NA	NA	NA	NA	NA
WP_082110567.1|2568819_2568957_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_144412943.1|2570227_2570548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082110568.1|2570801_2571869_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_046850353.1|2574965_2575343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046849174.1|2575943_2576348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850354.1|2576622_2578800_-	amylo-alpha-1,6-glucosidase	NA	NA	NA	NA	NA
WP_158441503.1|2578990_2580208_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	25.9	3.8e-20
WP_046850356.1|2580342_2581119_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_046850357.1|2581117_2581402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850358.1|2581398_2582670_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	24.2	3.6e-21
WP_046850359.1|2582666_2583752_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_052752223.1|2583934_2584225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850360.1|2584422_2584653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412945.1|2584721_2585183_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046850361.1|2585106_2585472_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052752224.1|2585491_2585830_-	hypothetical protein	NA	B7SYF8	Stenotrophomonas_phage	38.6	1.3e-13
WP_158441505.1|2585783_2585879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412787.1|2586268_2587397_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_144412946.1|2587440_2588184_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046850362.1|2588695_2589544_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	36.4	1.5e-39
WP_046850363.1|2589928_2590837_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046850364.1|2590833_2591487_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.5	1.2e-25
WP_046850365.1|2591528_2592527_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_046850366.1|2592920_2594012_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.4	5.3e-29
WP_046850367.1|2594047_2594845_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_046850368.1|2595010_2595313_-	YciI family protein	NA	NA	NA	NA	NA
WP_046850369.1|2595677_2596625_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	28.2	2.1e-21
WP_046850370.1|2596625_2596949_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046850371.1|2597034_2597979_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_046850372.1|2597983_2599510_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_046850373.1|2599506_2600103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850374.1|2600333_2600537_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_046850375.1|2600620_2601412_+	thiazole synthase	NA	NA	NA	NA	NA
WP_046850376.1|2601451_2602129_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_046850377.1|2602225_2603095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850378.1|2603279_2603750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752226.1|2604083_2604551_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	44.0	1.1e-23
WP_046850379.1|2604728_2605556_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_144412787.1|2606128_2607258_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_082110440.1|2607423_2608740_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	45.1	2.1e-96
WP_046850381.1|2608924_2609188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850382.1|2609366_2609717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850383.1|2609723_2610938_-	RtcB family protein	NA	A0A1W6DX78	Sphingobium_phage	55.3	4.5e-130
WP_144412948.1|2611035_2611713_-	hypothetical protein	NA	A0A2P1CCK2	Klebsiella_phage	40.3	3.7e-41
WP_046850384.1|2611958_2612450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850385.1|2612450_2612846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850386.1|2613195_2613639_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	34.5	6.1e-08
WP_090693915.1|2613654_2614143_-	hypothetical protein	NA	V9QL44	Rhizobium_phage	35.5	1.1e-13
>prophage 13
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	2768968	2868751	4067838	transposase	Tupanvirus(28.57%)	58	NA	NA
WP_046850294.1|2768968_2769796_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.2	5.4e-18
WP_036503716.1|2769816_2770098_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158441516.1|2770502_2770805_+	hypothetical protein	NA	A0A1W6JTA0	Pseudomonas_phage	62.1	3.6e-12
WP_046850494.1|2771016_2771208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158441518.1|2771215_2771356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850495.1|2772455_2772686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850496.1|2773320_2773584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752243.1|2774190_2774949_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_046850498.1|2774982_2775585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850499.1|2775645_2776131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850500.1|2776274_2777564_-	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_046850501.1|2777529_2778531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850502.1|2778678_2778870_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_046850503.1|2778873_2779515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441520.1|2779651_2780002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850505.1|2780009_2783027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752244.1|2783574_2784315_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_052752245.1|2784311_2787359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850506.1|2787840_2788035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850507.1|2789142_2790681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850508.1|2790811_2791750_-	membrane protein	NA	NA	NA	NA	NA
WP_052752247.1|2792186_2794373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850509.1|2794452_2796072_-	fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.7	1.6e-13
WP_046850510.1|2796085_2799226_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_046850511.1|2799222_2800422_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046850512.1|2800470_2801838_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_046850513.1|2801905_2802883_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052752248.1|2802955_2805235_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_046850514.1|2805270_2806572_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_144412960.1|2806582_2807689_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046850515.1|2807974_2809645_+	cyclic peptide export ABC transporter	NA	A0A1V0SJ29	Klosneuvirus	27.1	3.3e-06
WP_082110452.1|2809659_2810928_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_046850516.1|2811538_2812603_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_046850517.1|2814183_2817570_-	ATP-dependent exonuclease SbcCD, C subunit-like protein	NA	NA	NA	NA	NA
WP_046850518.1|2817562_2818213_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_046850519.1|2818215_2819682_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_082110453.1|2820577_2822134_+	Fic family protein	NA	NA	NA	NA	NA
WP_046850521.1|2822574_2822934_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412830.1|2822929_2823400_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046850522.1|2823424_2823643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850523.1|2826502_2842990_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	4.2e-101
WP_046850524.1|2843031_2847630_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	38.4	5.5e-51
WP_046850525.1|2847629_2852930_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.0	7.4e-92
WP_052752250.1|2853015_2853714_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_046850526.1|2853682_2854429_-	thioesterase	NA	NA	NA	NA	NA
WP_046850527.1|2854441_2854657_-	MbtH family protein	NA	NA	NA	NA	NA
WP_082110454.1|2855206_2855506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752251.1|2855450_2855873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441522.1|2856031_2856277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850529.1|2856371_2857268_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046850530.1|2857380_2859678_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_046850531.1|2860037_2861192_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_046850532.1|2861720_2862185_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_046850533.1|2862238_2862910_-	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_082110456.1|2862911_2863724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046850534.1|2863832_2864894_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_052752252.1|2866731_2867397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046850536.1|2867860_2868751_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	3552304	3603119	4067838	tRNA,protease,transposase	Catovirus(13.33%)	50	NA	NA
WP_046850992.1|3552304_3553813_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.1	1.0e-86
WP_046850993.1|3553987_3555703_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	59.8	2.6e-187
WP_046850994.1|3555918_3556281_+	exosortase system-associated protein, TIGR04073 family	NA	NA	NA	NA	NA
WP_046850995.1|3556394_3557477_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_052752308.1|3557471_3557960_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_082110500.1|3557941_3559276_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	31.0	4.4e-17
WP_046850996.1|3559652_3559808_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_046850997.1|3559867_3560104_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_046850998.1|3560166_3560841_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_144412999.1|3560972_3562172_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.3	4.6e-42
WP_046851882.1|3562191_3562632_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.9	1.4e-44
WP_046851000.1|3562625_3563075_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_046851001.1|3563134_3564484_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_046851002.1|3564630_3565482_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_046851003.1|3565664_3567146_-	Ni/Fe hydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_046851004.1|3567633_3568179_+	septation protein A	NA	NA	NA	NA	NA
WP_046851883.1|3568403_3569033_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_046851005.1|3569442_3571257_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_082110501.1|3571378_3571681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851006.1|3572612_3572897_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_046851009.1|3574186_3575857_-	ATP-dependent DNA helicase RecQ	NA	G5CQD7	Megavirus	38.3	8.9e-60
WP_052752310.1|3576116_3576503_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144413000.1|3576471_3576747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851010.1|3576989_3577409_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	40.5	1.5e-16
WP_158441571.1|3577486_3577630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144413001.1|3578321_3578615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413002.1|3580230_3580413_+	hypothetical protein	NA	Q9JMN8	Wolbachia_phage	45.1	2.6e-05
WP_052752312.1|3580455_3580752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052752313.1|3580748_3581402_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_046851011.1|3581548_3583480_-	cadherin-like domain-containing protein	NA	A0A1V0SAF4	Catovirus	34.4	6.2e-49
WP_158441573.1|3583747_3583891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046851012.1|3583969_3584260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851013.1|3584285_3585287_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046851014.1|3585814_3586135_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_082110502.1|3586100_3586592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046851017.1|3587767_3588223_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_046851018.1|3588287_3588758_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_046851019.1|3588784_3589948_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046851020.1|3590157_3591078_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_046851021.1|3591240_3592623_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_046851022.1|3592790_3594071_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_046851023.1|3594109_3594649_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_046851886.1|3594652_3595729_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.9	4.1e-50
WP_046851024.1|3595841_3596297_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_046851025.1|3596407_3597658_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.9	4.9e-95
WP_046851026.1|3598003_3600262_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	5.2e-164
WP_046851027.1|3600263_3600572_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	40.2	2.0e-10
WP_046851028.1|3600883_3601087_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	80.3	1.5e-22
WP_046851029.1|3601254_3602505_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	57.4	1.6e-08
WP_046851030.1|3602609_3603119_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	3611480	3675352	4067838	tRNA,transposase	Paenibacillus_phage(18.18%)	51	NA	NA
WP_046851888.1|3611480_3613004_+|transposase	ISNCY-like element ISNco1 family transposase	transposase	NA	NA	NA	NA
WP_046851036.1|3613764_3614502_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_052752394.1|3614743_3615049_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_046851039.1|3615754_3616564_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.3e-16
WP_046851040.1|3616557_3617484_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_046851041.1|3617615_3618563_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_046851042.1|3618912_3619581_-	cytochrome c	NA	NA	NA	NA	NA
WP_046848851.1|3619605_3620322_-	cytochrome c554	NA	NA	NA	NA	NA
WP_046848852.1|3620442_3621471_-	hydroxylamine oxidation protein HaoB	NA	NA	NA	NA	NA
WP_046851043.1|3621467_3623180_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_046851044.1|3623245_3623509_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_158441575.1|3623773_3623938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851045.1|3625398_3625833_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_046851046.1|3625836_3626229_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_046851047.1|3626331_3627360_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_046851048.1|3627522_3627888_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	60.6	5.5e-31
WP_082110504.1|3627906_3629016_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_046851050.1|3629051_3630380_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2P1JY73	Gordonia_phage	41.0	1.3e-18
WP_144413003.1|3630521_3631736_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046851051.1|3632080_3633448_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.4	2.6e-57
WP_158441593.1|3633590_3634358_-	alkaline phytoceramidase	NA	NA	NA	NA	NA
WP_046851890.1|3634540_3635914_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_046851053.1|3635964_3636510_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.7	4.6e-50
WP_046851054.1|3636512_3637466_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.9	1.2e-98
WP_046851055.1|3637648_3639280_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.5	1.3e-34
WP_046851056.1|3639372_3640128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851057.1|3640127_3642203_-	BREX-3 system phosphatase PglZ	NA	NA	NA	NA	NA
WP_144412787.1|3642459_3643589_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_046851058.1|3643669_3643885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851059.1|3643981_3644476_-	BREX-3 system P-loop-containing protein BrxF	NA	NA	NA	NA	NA
WP_046851060.1|3644751_3645120_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_046851061.1|3645356_3646592_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_046851062.1|3646688_3648002_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_046851063.1|3648100_3649516_+	threonine synthase	NA	NA	NA	NA	NA
WP_046851064.1|3649631_3650327_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_046851065.1|3650323_3650557_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_046851066.1|3650625_3651927_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_046851067.1|3652108_3654964_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_046851068.1|3654979_3656230_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_046851069.1|3656248_3659794_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	35.2	4.2e-176
WP_046851070.1|3659926_3661282_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	59.0	7.1e-116
WP_046851071.1|3661330_3662305_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_144413004.1|3663409_3664156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046849893.1|3664233_3664593_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412826.1|3664588_3665059_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144412787.1|3665428_3666558_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_082110585.1|3666578_3667460_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144413005.1|3672280_3672655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144412830.1|3672903_3673374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046851077.1|3673369_3673729_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046851078.1|3674473_3675352_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP011451	Nitrosomonas communis strain Nm2 chromosome, complete genome	4067838	3791196	3846424	4067838	transposase,portal,integrase	Wolbachia_phage(17.39%)	67	3800312:3800328	3844993:3845009
WP_144413010.1|3791196_3792282_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	46.3	5.4e-82
WP_046851172.1|3792297_3793119_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046851174.1|3794075_3794381_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046851175.1|3794361_3794589_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	45.0	2.9e-06
WP_158441581.1|3794734_3796177_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	46.2	5.4e-106
WP_052752332.1|3796257_3797094_+	signal peptide peptidase SppA	NA	A0A219YAK4	Aeromonas_phage	34.4	1.7e-35
WP_046851176.1|3797097_3797607_+	hypothetical protein	NA	G8DH45	Emiliania_huxleyi_virus	33.6	2.0e-07
WP_046851177.1|3797606_3798056_+	hypothetical protein	NA	G8DH46	Emiliania_huxleyi_virus	61.8	2.8e-37
WP_046851178.1|3798157_3798355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413011.1|3798375_3798846_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046851180.1|3798841_3799201_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052752333.1|3799247_3800105_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3800312:3800328	attL	TTGGAATGTCGCGCTGG	NA	NA	NA	NA
WP_144413012.1|3800378_3800780_+|transposase	transposase	transposase	Q9JMN8	Wolbachia_phage	59.8	4.6e-23
WP_144413013.1|3800781_3801252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046849897.1|3801247_3801607_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046851182.1|3801625_3801811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752335.1|3802081_3804457_-	hypothetical protein	NA	A0A1S7FZ15	Listeria_phage	39.5	4.8e-51
WP_082110589.1|3804456_3805104_-	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	57.8	7.0e-29
WP_046851183.1|3805424_3805700_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	33.7	3.5e-06
WP_046851184.1|3805677_3805968_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	41.7	1.5e-07
WP_046851185.1|3806002_3806311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851186.1|3806366_3806726_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144413014.1|3806721_3807192_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046851188.1|3807212_3807419_-	hypothetical protein	NA	B7SYG8	Stenotrophomonas_phage	50.0	6.9e-07
WP_046851189.1|3807628_3807925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046851190.1|3808026_3808383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046851191.1|3808474_3808840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413015.1|3809052_3809469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851193.1|3809481_3809928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851194.1|3811664_3811853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413067.1|3811861_3812167_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082110509.1|3812411_3812957_+	helix-turn-helix transcriptional regulator	NA	J7I0S2	Pseudomonas_phage	36.8	3.5e-21
WP_046851195.1|3813102_3813486_+	hypothetical protein	NA	A0A2D1GN03	Marinobacter_phage	44.3	4.7e-09
WP_158441583.1|3814196_3814370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144412787.1|3814478_3815608_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	24.4	5.0e-22
WP_046851197.1|3815607_3815994_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_158441585.1|3816803_3816980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158441587.1|3817150_3817297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046851198.1|3817293_3817479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046851199.1|3817514_3817796_+	helix-turn-helix transcriptional regulator	NA	I6NW14	Burkholderia_virus	45.6	8.0e-06
WP_052752338.1|3818143_3818638_+	hypothetical protein	NA	M1PKJ5	Streptococcus_phage	33.6	1.4e-05
WP_046851200.1|3818971_3819220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752339.1|3819427_3820192_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	39.6	6.7e-31
WP_046851201.1|3820460_3821792_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.2	8.5e-114
WP_046851202.1|3821970_3822198_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_046851203.1|3822194_3822647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413016.1|3822619_3823285_+	hypothetical protein	NA	C8CLF4	Xylella_phage	55.9	1.2e-60
WP_046851919.1|3823640_3825035_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_082110511.1|3825202_3825445_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	76.7	4.0e-22
WP_052752341.1|3825879_3828351_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_046851205.1|3828386_3828827_-	response regulator	NA	NA	NA	NA	NA
WP_052752342.1|3828816_3831312_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_046851207.1|3831933_3835254_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_082110512.1|3835547_3836330_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.5	1.3e-26
WP_046851208.1|3836436_3836850_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_046851209.1|3836975_3837209_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_046851210.1|3837234_3837585_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_046851211.1|3837585_3837915_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_046851212.1|3837911_3838301_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_046851923.1|3838347_3839124_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_046851213.1|3839214_3839961_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_046851214.1|3840040_3840691_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_046851215.1|3840716_3841304_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_046851216.1|3841334_3842423_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_046851924.1|3842748_3843045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046851217.1|3843640_3844972_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	49.0	6.5e-114
WP_046848937.1|3845362_3846424_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
3844993:3845009	attR	TTGGAATGTCGCGCTGG	NA	NA	NA	NA
