The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	2303	48893	4947515	tail,tRNA,holin,protease,capsid,terminase,transposase,head,integrase	Enterobacteria_phage(52.17%)	60	9630:9645	41310:41325
WP_046880174.1|2303_2801_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	91.7	9.4e-50
WP_162487921.1|2990_3332_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	78.8	1.3e-21
WP_001161009.1|4623_4953_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_038347324.1|5405_6146_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	95.5	8.3e-127
WP_001079415.1|6156_6558_-|tail	phage tail protein U	tail	A5LH34	Enterobacteria_phage	98.5	1.2e-71
WP_000677136.1|6554_7139_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	89.2	7.6e-91
WP_000753026.1|7125_7497_-|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_000201491.1|7508_7910_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	67.2	3.9e-38
WP_000522635.1|7961_8990_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	63.3	9.8e-118
WP_000256829.1|9047_9395_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.2e-21
WP_001254017.1|9429_10935_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.9	7.2e-101
9630:9645	attL	CAGCCAGTTTTTCAGC	NA	NA	NA	NA
WP_000259004.1|12512_12716_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_001026846.1|12699_14628_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	4.8e-259
WP_000235445.1|14599_15109_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	2.7e-12
WP_000708309.1|15694_16006_-	DUF4406 domain-containing protein	NA	A0A2I6TCY5	Escherichia_phage	100.0	3.5e-55
WP_122999680.1|16088_16295_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	97.1	5.8e-30
WP_001101165.1|16511_17045_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	1.4e-99
WP_000193253.1|17366_17897_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	52.6	3.7e-36
WP_000284485.1|17901_18117_-|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
WP_038348369.1|19147_20206_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	85.0	9.6e-177
WP_000917724.1|20356_20560_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001204813.1|21529_21901_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	59.2	3.7e-35
WP_001064800.1|21900_22158_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	4.9e-34
WP_046880176.1|22154_23546_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	96.1	9.4e-257
WP_000988184.1|23542_24421_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.4	1.6e-140
WP_046880177.1|24431_25424_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	99.1	1.3e-58
WP_038347352.1|25420_25720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038347354.1|25716_25941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038347356.1|25937_26171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052234597.1|26163_27237_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	56.1	2.2e-88
WP_001141117.1|27249_27537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000368592.1|27568_27898_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001197745.1|27919_28096_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	85.7	1.5e-23
WP_001300622.1|28115_28823_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	78.6	1.1e-99
WP_000867913.1|28942_29236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000838348.1|29627_30284_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	98.2	6.9e-125
WP_046880178.1|30380_30830_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	96.2	1.6e-64
WP_000141092.1|31171_31378_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.7e-29
WP_000148628.1|31573_31933_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	76.4	4.4e-41
WP_000002324.1|31932_32148_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	64.8	4.1e-18
WP_162137203.1|32215_32338_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	80.0	7.9e-11
WP_000566773.1|32334_32727_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
WP_046880179.1|32853_33156_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|33191_34010_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_046880180.1|34239_35070_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	94.9	3.7e-123
WP_001099206.1|35113_35863_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	81.9	4.8e-114
WP_000586688.1|35859_36429_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
WP_000457719.1|36552_36795_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
WP_001030135.1|36798_36945_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	97.9	2.8e-23
WP_000528718.1|36953_37190_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362002.1|37245_38559_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	96.8	1.2e-248
WP_046880181.1|38540_39311_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|39363_39759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|39799_40543_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|40539_41511_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
41310:41325	attR	GCTGAAAAACTGGCTG	NA	NA	NA	NA
WP_000176852.1|41675_44105_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214272.1|44129_45230_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|45617_46364_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001326063.1|46377_46944_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025342.1|47159_48893_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 2
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	78291	114276	4947515	tail,lysis,holin,capsid,transposase,terminase,head,integrase,portal	Cronobacter_phage(35.48%)	46	72834:72848	93484:93498
72834:72848	attL	AAGATGTGGAAAATG	NA	NA	NA	NA
WP_005135673.1|78291_79293_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.6	3.4e-107
WP_000290340.1|79782_80430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102533.1|80448_80862_-	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	40.2	1.3e-12
WP_134889554.1|80977_81073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|81144_81348_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_046880183.1|81369_81720_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	77.6	1.5e-46
WP_001225585.1|81761_82004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609702.1|82291_82714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939941.1|82951_83482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000801171.1|83478_83718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046880184.1|83714_84674_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	45.8	5.3e-65
WP_000268547.1|84673_84985_+	DUF4406 domain-containing protein	NA	O64365	Escherichia_phage	56.2	2.6e-21
WP_046880185.1|84975_85530_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_071845686.1|85539_86157_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	51.9	4.8e-11
WP_000567055.1|86153_86543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005135390.1|86539_89032_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	77.0	0.0e+00
WP_005135391.1|89154_89460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046880186.1|89456_89759_+	hypothetical protein	NA	A0A076G621	Escherichia_phage	43.8	2.8e-12
WP_046880187.1|89799_90618_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.0e-65
WP_000088311.1|90653_90956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046880188.1|91340_92486_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001115690.1|92475_92994_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_000929361.1|93128_93404_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000044295.1|93454_94510_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.7	2.2e-125
93484:93498	attR	CATTTTCCACATCTT	NA	NA	NA	NA
WP_046880189.1|94506_96330_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	52.6	2.6e-174
WP_052760731.1|96427_97600_+	hypothetical protein	NA	A0A2I7RNH1	Vibrio_phage	47.8	5.3e-27
WP_046880190.1|97647_98697_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	46.8	1.1e-76
WP_046880191.1|98708_99410_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	44.7	1.6e-50
WP_052760734.1|99568_99985_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	50.0	8.5e-28
WP_000077226.1|99981_100461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046880193.1|100464_101193_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	42.4	5.2e-41
WP_046880194.1|101196_102321_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	51.2	4.2e-98
WP_001091147.1|102324_102786_+	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	58.2	5.1e-42
WP_001192103.1|102794_103133_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	36.0	5.3e-12
WP_000703025.1|103129_103573_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	66.0	2.3e-47
WP_000817134.1|103579_104044_+|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	42.4	9.5e-20
WP_000651017.1|104074_104347_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	55.6	2.0e-17
WP_000718630.1|104534_106616_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	48.9	6.9e-102
WP_000105176.1|106619_106958_+	DUF2590 family protein	NA	Q1I0Y6	Pasteurella_virus	58.8	1.4e-28
WP_106379006.1|106992_108126_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.3	5.9e-132
WP_001113004.1|108118_108691_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	60.3	1.1e-57
WP_046880195.1|108659_110666_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	62.4	9.8e-114
WP_000972111.1|110667_111195_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.1	2.1e-87
WP_000268234.1|111394_112075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081611.1|112037_112604_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	44.6	6.8e-28
WP_005109803.1|112635_114276_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	37.9	1.2e-101
>prophage 3
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	298264	410913	4947515	tail,tRNA,lysis,holin,capsid,transposase,terminase,head,integrase,portal	Enterobacteria_phage(47.89%)	116	362116:362136	408419:408439
WP_001111632.1|298264_299455_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_001386899.1|299498_299555_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001111632.1|299896_301087_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_001386901.1|301130_301187_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000678962.1|301465_302713_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_046880207.1|302712_305835_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_046880208.1|305835_308913_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_000130849.1|308913_310329_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675148.1|310325_311729_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|311725_312448_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|312638_312971_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|313179_313476_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|313477_313774_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|313876_315238_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001352710.1|315568_315886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|316300_317200_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|317281_318061_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|318160_319201_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|319248_320604_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823272.1|320607_320892_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|320922_321375_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853879.1|321384_322647_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_046880209.1|322675_323530_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|323837_324890_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|325146_326424_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846219.1|326420_327425_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011976.1|327421_328387_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|328360_329107_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|329158_329977_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822275.1|330041_330842_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195602.1|330838_331627_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|331849_332122_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134645.1|332240_333065_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|333283_333622_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405707.1|333703_334738_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_046880220.1|334753_337234_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|337249_337924_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|338003_338546_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001307891.1|338838_339120_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|339382_340492_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|340623_342657_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001215627.1|342797_346592_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356801.1|346601_350234_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636926.1|350294_350615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|351797_352886_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001292774.1|355168_356305_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001326004.1|356301_358302_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|358426_358888_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|358928_359399_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|359445_360165_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|360161_361847_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
362116:362136	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261936.1|362361_362610_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	97.6	4.1e-38
WP_000937487.1|362725_362995_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.6e-19
WP_000239881.1|363051_363720_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000551130.1|365857_366481_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.0	1.1e-79
WP_046880233.1|366431_367844_-|tail	tail protein	tail	Q8W611	Enterobacteria_phage	43.9	3.6e-46
WP_001233104.1|367907_368507_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	3.6e-104
WP_046880234.1|368574_372054_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_000090878.1|372114_372717_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	7.3e-89
WP_052760732.1|372653_373397_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	1.5e-144
WP_001152598.1|373401_374100_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	1.5e-125
WP_000447385.1|374099_374429_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	93.5	2.9e-55
WP_046880239.1|374428_377470_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	85.7	0.0e+00
WP_001161009.1|377441_377771_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000478927.1|377779_378166_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_046880240.1|378224_378965_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	95.5	2.4e-126
WP_001079412.1|378975_379377_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.2e-71
WP_000677134.1|379373_379958_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	89.7	3.4e-91
WP_000753026.1|379944_380316_-|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_000201491.1|380327_380729_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	67.2	3.9e-38
WP_000522635.1|380780_381809_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	63.3	9.8e-118
WP_046880242.1|381866_382214_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.2e-21
WP_001254017.1|382248_383754_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.9	7.2e-101
WP_046880246.1|383743_385336_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	1.4e-184
WP_000259004.1|385332_385536_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_046880249.1|385519_387448_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.9e-258
WP_000235445.1|387419_387929_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	2.7e-12
WP_001283921.1|388577_388835_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839225.1|388831_389329_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_001288264.1|389527_389857_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001300453.1|389831_390062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092291.1|390202_390670_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	96.1	1.8e-74
WP_001274722.1|390666_391200_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
WP_001300760.1|391265_391895_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	56.9	3.6e-30
WP_000839570.1|391898_392114_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_001204832.1|392916_393297_-	antitermination protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
WP_000111769.1|393289_393490_-	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
WP_001064799.1|393584_393842_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
WP_046880255.1|393838_395230_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.9	1.2e-256
WP_000988184.1|395226_396105_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.4	1.6e-140
WP_001247832.1|396115_397024_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	97.4	8.8e-62
WP_000621187.1|397010_397244_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	1.5e-13
WP_046881406.1|397240_398146_-	peptidase	NA	K7PLX4	Enterobacteria_phage	68.8	4.6e-103
WP_000368592.1|398477_398807_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001197745.1|398828_399005_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	85.7	1.5e-23
WP_004978635.1|399024_399732_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	83.8	4.1e-107
WP_000867908.1|399851_400145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300579.1|400222_400489_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.7	2.0e-35
WP_000800136.1|400622_401312_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	6.1e-116
WP_001300851.1|401457_401952_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.9	7.2e-42
WP_000141092.1|402293_402500_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.7e-29
WP_000148628.1|402695_403055_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	76.4	4.4e-41
WP_000002324.1|403054_403270_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	64.8	4.1e-18
WP_162137203.1|403337_403460_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	80.0	7.9e-11
WP_000566773.1|403456_403849_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
WP_000750829.1|404094_404925_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	95.3	5.7e-124
WP_001099207.1|404968_405718_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	82.3	2.1e-114
WP_046880261.1|405714_406284_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	1.2e-27
WP_000457719.1|406407_406650_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
WP_001030134.1|406653_406788_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	97.7	1.9e-21
WP_001193437.1|406806_407061_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063647.1|407094_408381_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.1	2.5e-251
WP_029208330.1|408401_409103_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.0e-102
408419:408439	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|409162_409270_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|409250_409982_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|409986_410913_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 4
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	495941	566514	4947515	tail,holin,protease,capsid,terminase,integrase	Escherichia_phage(26.32%)	73	508312:508330	575730:575748
WP_000849214.1|495941_496430_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758072.1|496578_498225_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_046880317.1|498442_500095_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.1	4.3e-14
WP_000786386.1|500819_501884_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406102.1|501957_503013_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865578.1|503124_504228_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	1.4e-117
WP_001249110.1|504966_507639_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|507655_508306_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
508312:508330	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876014.1|508505_511355_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_046880327.1|512410_514060_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_146416726.1|514060_518455_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_046880332.1|519166_520930_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_077788305.1|521109_521226_-|tail	phage tail protein	tail	Q8W610	Enterobacteria_phage	78.9	1.3e-07
WP_046880335.1|521280_521826_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	74.7	7.1e-75
WP_046880338.1|521828_523229_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	67.1	8.1e-107
WP_046880340.1|523215_523821_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.8	1.0e-29
WP_046880343.1|523822_525064_-	bacteriophage protein	NA	A0A077KGW9	Edwardsiella_phage	50.4	4.1e-102
WP_001191863.1|525060_525417_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	48.1	2.1e-19
WP_000068497.1|525429_526107_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	34.6	5.6e-29
WP_000122180.1|526087_526957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000890114.1|526953_527256_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.0	1.6e-23
WP_046880346.1|527255_527966_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.8	4.8e-23
WP_046880349.1|527962_529984_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	68.8	1.2e-47
WP_000228829.1|529967_530150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101350.1|530191_530596_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	47.9	3.1e-19
WP_000016415.1|530595_531042_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	39.7	1.1e-20
WP_001122282.1|531042_532527_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	8.9e-96
WP_001139094.1|532507_533053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009073.1|533037_533403_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	3.0e-21
WP_000537608.1|533972_534431_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	43.8	7.4e-17
WP_000829563.1|534436_534784_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.2	3.9e-10
WP_001031907.1|534787_535816_-	hypothetical protein	NA	Q8HAP7	Burkholderia_phage	49.8	6.2e-80
WP_001091400.1|535815_536298_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	42.3	2.7e-25
WP_000587356.1|536299_537649_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.3	9.7e-65
WP_000552019.1|537645_538335_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	49.6	5.8e-58
WP_046880355.1|538375_539917_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	1.9e-104
WP_001130785.1|539916_541536_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	85.7	9.6e-277
WP_046880358.1|541538_542093_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	65.6	1.2e-61
WP_046880359.1|542425_543022_-	hypothetical protein	NA	Q9B021	Phage_GMSE-1	65.0	5.1e-18
WP_001228704.1|543268_543475_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	4.0e-31
WP_000075178.1|543691_544189_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	98.2	2.9e-91
WP_000839603.1|544188_544404_-|holin	holin	holin	M1FN85	Enterobacteria_phage	93.0	1.4e-31
WP_000640118.1|545210_545753_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.8	1.3e-65
WP_000774472.1|545749_546040_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	1.9e-47
WP_000940347.1|546039_546639_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.9e-105
WP_001013644.1|546813_547026_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	60.0	4.3e-12
WP_001290002.1|547254_547770_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.3	1.0e-35
WP_001224672.1|547935_548118_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000335375.1|548213_548669_-	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	69.6	1.4e-28
WP_001266147.1|548655_548961_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	1.1e-48
WP_038348382.1|548957_549383_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.4	4.8e-63
WP_001300435.1|549398_549911_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	38.7	1.3e-30
WP_157915300.1|549945_550488_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	94.8	1.9e-83
WP_024174399.1|550399_551440_-	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	90.4	1.1e-100
WP_001300539.1|551442_552174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000702042.1|552184_552610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172788.1|552593_552866_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	5.0e-21
WP_000578359.1|552992_553385_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	40.6	4.5e-15
WP_001022416.1|553431_553791_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	94.1	7.2e-60
WP_000692027.1|553793_554096_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.2	1.4e-16
WP_001091978.1|554368_554524_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000935587.1|554969_555812_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.5	2.7e-57
WP_001069000.1|555828_556110_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	55.8	2.0e-09
WP_000022246.1|556184_556481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077788306.1|556504_558445_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	57.3	8.1e-190
WP_001277359.1|558422_558719_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_000505091.1|558778_559822_+	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	84.4	1.8e-175
WP_000276806.1|559872_560061_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	72.6	1.5e-16
WP_038346813.1|560165_560384_+	excisionase	NA	Q77WA4	Escherichia_phage	94.4	5.9e-33
WP_000533674.1|560361_561435_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	95.2	5.1e-194
WP_046880384.1|561492_562053_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_046880385.1|562049_563738_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|563886_566514_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
575730:575748	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 5
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	1044319	1051459	4947515		Escherichia_phage(83.33%)	6	NA	NA
WP_001272881.1|1044319_1046881_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	3.0e-30
WP_001141330.1|1046986_1047643_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272549.1|1047693_1048491_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|1048656_1049565_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1049561_1050824_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1050820_1051459_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	3672895	3728329	4947515	tail,lysis,capsid,transposase,terminase,head,integrase,portal	Enterobacteria_phage(50.85%)	76	3664841:3664857	3722558:3722574
3664841:3664857	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_000533642.1|3672895_3673966_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|3673943_3674162_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|3674201_3674369_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|3674611_3675214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|3675424_3675646_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|3675744_3676026_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|3676036_3676228_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|3676200_3676383_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|3676379_3677060_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|3677056_3677842_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|3677847_3678144_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|3678219_3678426_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|3679023_3679779_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|3679817_3680048_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|3680117_3680657_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_032144743.1|3680743_3681673_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	2.3e-110
WP_000788813.1|3681669_3682371_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_046881126.1|3682367_3682619_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.2	2.4e-38
WP_086020950.1|3682662_3683935_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001070442.1|3684073_3684406_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001301135.1|3684454_3684604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709097.1|3684661_3686188_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.2	1.0e-30
WP_000338665.1|3686299_3686623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301145.1|3686797_3687580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|3687674_3687776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053031.1|3687772_3688228_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.2	3.7e-61
WP_000224914.1|3688227_3688398_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_046881127.1|3688390_3688681_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.1e-46
WP_001099708.1|3688677_3689040_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.0	1.8e-58
WP_001316941.1|3689036_3689177_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.9e-09
WP_001204780.1|3689262_3689646_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737263.1|3689834_3690917_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_046881128.1|3691505_3691721_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.6e-33
WP_001135277.1|3691720_3692218_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_046881129.1|3692214_3692652_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	93.8	1.8e-68
WP_001028465.1|3692856_3693378_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|3693727_3694138_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|3694194_3694428_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453576.1|3694816_3695362_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027254.1|3695336_3697262_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|3697258_3697465_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_046881130.1|3697461_3698343_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.8	1.4e-160
WP_000963723.1|3698491_3699733_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
WP_029488835.1|3699734_3699992_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001038675.1|3700048_3700627_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.0	9.2e-57
WP_000179580.1|3700960_3701266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|3701456_3701654_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920679.1|3701646_3701832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|3701831_3702023_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_001091146.1|3702023_3702245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425299.1|3702262_3702562_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761841.1|3702558_3704313_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
WP_000161636.1|3704660_3704912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126640.1|3704908_3705331_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228106.1|3705548_3706589_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_046881131.1|3706598_3706940_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179424.1|3706951_3707335_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000835282.1|3707536_3708079_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_000140265.1|3708090_3708372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123248.1|3709941_3711261_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_046881132.1|3711270_3711603_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	5.5e-54
WP_000063250.1|3711658_3712684_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_000158875.1|3712725_3713121_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_046881133.1|3713132_3713486_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	96.6	3.2e-60
WP_000975106.1|3713497_3714076_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	6.6e-79
WP_000683129.1|3714072_3714468_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001361512.1|3714475_3715216_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
WP_000479193.1|3715231_3715654_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|3715635_3716070_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000847321.1|3718619_3718949_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_001152499.1|3718948_3719647_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	94.4	7.8e-127
WP_061359389.1|3719652_3720396_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090891.1|3720332_3720965_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_046881134.1|3721025_3724523_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.6	0.0e+00
3722558:3722574	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
WP_046881135.1|3724593_3725193_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	7.5e-110
WP_071845691.1|3725257_3728329_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
>prophage 7
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	4109353	4200882	4947515	tail,tRNA,holin,protease,capsid,transposase,terminase,head,integrase,portal	Enterobacteria_phage(30.91%)	101	4105183:4105197	4142693:4142707
4105183:4105197	attL	TGGTGCCGGAAGCAA	NA	NA	NA	NA
WP_000074986.1|4109353_4110472_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.2e-83
WP_000003742.1|4110440_4110710_-	excisionase	NA	NA	NA	NA	NA
WP_046881150.1|4110771_4113213_-	exonuclease	NA	A0A088CD28	Shigella_phage	46.0	1.5e-111
WP_001098752.1|4113306_4113498_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449193.1|4113494_4113683_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_046881151.1|4113693_4114542_-	rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	52.1	6.3e-46
WP_001438288.1|4114959_4115397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046881152.1|4115365_4115695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046881153.1|4115717_4115936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379557.1|4116095_4116251_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000938157.1|4116516_4116804_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001300743.1|4116804_4116996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538414.1|4116964_4117426_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.6	8.8e-10
WP_000448217.1|4117456_4117828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042188692.1|4117930_4118212_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_046881154.1|4118215_4118641_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073801390.1|4118847_4119306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046881155.1|4119385_4120495_+	DNA-binding protein	NA	V5URT9	Shigella_phage	69.1	8.1e-134
WP_046881156.1|4120501_4121248_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	88.4	5.8e-120
WP_046881157.1|4121262_4121685_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	75.5	3.5e-53
WP_052476150.1|4121708_4122155_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.0	1.6e-64
WP_046881536.1|4122494_4122689_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	63.8	1.3e-10
WP_052760733.1|4123043_4123601_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_046881158.1|4123615_4123972_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046881159.1|4124330_4124543_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	74.3	1.9e-20
WP_046881160.1|4124710_4124989_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	1.0e-05
WP_046881161.1|4124990_4126049_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.1	2.2e-88
WP_046881162.1|4126049_4126412_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.6	6.9e-34
WP_001345623.1|4126420_4126804_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.8	5.9e-60
WP_046881163.1|4127072_4127633_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	57.9	1.1e-41
WP_046881164.1|4127857_4128055_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	1.0e-28
WP_046881165.1|4128205_4129264_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	88.4	8.1e-184
WP_000284485.1|4130294_4130510_+|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
WP_000193253.1|4130514_4131045_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	52.6	3.7e-36
WP_001101165.1|4131366_4131900_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	1.4e-99
WP_122999680.1|4132116_4132323_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	97.1	5.8e-30
WP_000708309.1|4132405_4132717_+	DUF4406 domain-containing protein	NA	A0A2I6TCY5	Escherichia_phage	100.0	3.5e-55
WP_046881166.1|4132998_4133859_+	hypothetical protein	NA	A0A2I6TCU3	Escherichia_phage	94.4	1.0e-96
WP_046881167.1|4133982_4134438_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	69.4	3.7e-53
WP_086020935.1|4134434_4135279_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	50.0	4.4e-23
WP_000235445.1|4136004_4136514_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	2.7e-12
WP_001026846.1|4136485_4138414_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	4.8e-259
WP_000259004.1|4138397_4138601_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_046880246.1|4138597_4140190_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	1.4e-184
WP_001254017.1|4140179_4141685_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.9	7.2e-101
WP_000256829.1|4141719_4142067_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.2e-21
WP_000522635.1|4142124_4143153_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	63.3	9.8e-118
4142693:4142707	attR	TTGCTTCCGGCACCA	NA	NA	NA	NA
WP_000201491.1|4143204_4143606_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	67.2	3.9e-38
WP_000753026.1|4143617_4143989_+|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_000677136.1|4143975_4144560_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	89.2	7.6e-91
WP_001079415.1|4144556_4144958_+|tail	phage tail protein U	tail	A5LH34	Enterobacteria_phage	98.5	1.2e-71
WP_038347324.1|4144968_4145709_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	95.5	8.3e-127
WP_000478927.1|4145767_4146154_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161009.1|4146162_4146492_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_046881168.1|4146463_4149505_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.1	0.0e+00
WP_000447266.1|4149504_4149834_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	98.1	1.6e-58
WP_001152598.1|4149833_4150532_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	1.5e-125
WP_064756675.1|4150536_4151280_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_000090878.1|4151216_4151819_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	7.3e-89
WP_046881169.1|4157420_4158044_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.5	8.4e-80
WP_001217553.1|4160574_4160823_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|4161177_4161744_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|4162053_4163826_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|4163943_4164396_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|4164424_4165165_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4165199_4165721_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024910.1|4165722_4166325_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|4166395_4166461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580328.1|4166599_4167211_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|4167219_4168230_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|4168376_4169162_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|4169158_4169914_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|4169992_4170925_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|4170940_4172263_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|4172382_4173354_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091148.1|4173485_4174928_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|4175055_4175925_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_046881171.1|4176262_4177738_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001069467.1|4177972_4179784_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|4179820_4180462_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173494.1|4180517_4181696_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|4181829_4182120_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|4182186_4182543_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|4182869_4183529_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936956.1|4183737_4185798_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|4185794_4186457_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|4186480_4187137_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|4187238_4187469_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|4187607_4187982_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|4187985_4188858_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|4188870_4189212_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|4189607_4190264_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000929532.1|4190264_4190540_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|4190560_4190797_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_024199875.1|4190914_4192354_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|4192433_4195067_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|4195035_4196319_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|4196448_4196946_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431378.1|4197042_4197741_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|4197760_4199809_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|4200000_4200882_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 8
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	4673343	4725737	4947515	tail,tRNA,holin,capsid,terminase,transposase,integrase	Escherichia_phage(26.79%)	69	4667845:4667860	4724898:4724913
4667845:4667860	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000983722.1|4673343_4674171_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|4674167_4675025_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968134.1|4675021_4675879_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_046881248.1|4676079_4676703_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	79.1	1.8e-82
WP_046881251.1|4676653_4677922_-|tail	tail protein	tail	Q8W611	Enterobacteria_phage	42.9	5.1e-76
WP_032359688.1|4677945_4678491_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.6	4.3e-72
WP_046881256.1|4678493_4679726_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	48.9	2.2e-68
WP_046881259.1|4679712_4680318_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.8	1.0e-29
WP_046881262.1|4680319_4681561_-	bacteriophage protein	NA	A0A077KGW9	Edwardsiella_phage	50.1	7.0e-102
WP_001191863.1|4681557_4681914_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	48.1	2.1e-19
WP_000068497.1|4681926_4682604_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	34.6	5.6e-29
WP_000122177.1|4682584_4683454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000890114.1|4683450_4683753_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.0	1.6e-23
WP_046880346.1|4683752_4684463_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.8	4.8e-23
WP_073860500.1|4684459_4685458_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	68.8	6.1e-48
WP_077788320.1|4686180_4686480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228829.1|4686463_4686646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101350.1|4686687_4687092_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	47.9	3.1e-19
WP_046881264.1|4687091_4687535_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	39.7	1.1e-20
WP_001122282.1|4687535_4689020_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	8.9e-96
WP_001139094.1|4689000_4689546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009073.1|4689530_4689896_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	3.0e-21
WP_000247611.1|4689892_4690477_-	hypothetical protein	NA	A0A2I7QJD5	Vibrio_phage	32.0	2.3e-15
WP_000537608.1|4690466_4690925_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	43.8	7.4e-17
WP_000829563.1|4690930_4691278_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.2	3.9e-10
WP_001031907.1|4691281_4692310_-	hypothetical protein	NA	Q8HAP7	Burkholderia_phage	49.8	6.2e-80
WP_001091400.1|4692309_4692792_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	42.3	2.7e-25
WP_000587356.1|4692793_4694143_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.3	9.7e-65
WP_000552019.1|4694139_4694829_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	49.6	5.8e-58
WP_000267592.1|4694869_4696411_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	3.8e-105
WP_046881267.1|4696410_4698030_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	85.7	3.6e-276
WP_001096650.1|4698032_4698587_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	67.8	3.7e-63
WP_004996416.1|4698919_4699516_-	hypothetical protein	NA	Q9B021	Phage_GMSE-1	65.0	5.1e-18
WP_001228704.1|4699759_4699966_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	4.0e-31
WP_000075178.1|4700182_4700680_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	98.2	2.9e-91
WP_046881268.1|4700679_4700895_-|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	5.9e-33
WP_000640137.1|4701683_4702238_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.7	1.3e-68
WP_000228038.1|4702234_4702525_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000233476.1|4702524_4703124_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	90.5	2.1e-104
WP_001094287.1|4703524_4704343_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	53.8	3.8e-72
WP_000050565.1|4704345_4704552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887493.1|4704800_4705013_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	94.3	4.7e-27
WP_000955175.1|4705057_4705240_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	8.2e-12
WP_072132653.1|4705214_4705433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001343836.1|4705951_4706101_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	95.2	5.3e-17
WP_001224671.1|4706093_4706276_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	3.4e-26
WP_000761447.1|4706369_4706783_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.6e-58
WP_086020950.1|4706950_4708224_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_046881273.1|4708527_4709289_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
WP_000131761.1|4709455_4710859_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	61.9	2.0e-161
WP_000062044.1|4710848_4711604_-	DNA-binding protein	NA	H9C164	Pectobacterium_phage	55.7	6.6e-71
WP_046881274.1|4711694_4712117_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.7e-68
WP_024259867.1|4712100_4712376_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.2	3.2e-15
WP_000367558.1|4712480_4712870_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000379560.1|4713037_4713193_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_046881278.1|4713650_4714499_+	rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.1	1.1e-55
WP_077782631.1|4714509_4714797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000022244.1|4714871_4715168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077788322.1|4715191_4717132_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	56.7	1.2e-188
WP_001277359.1|4717109_4717406_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.5	6.2e-41
WP_000505091.1|4717465_4718509_+	AAA family ATPase	NA	I6PCV5	Cronobacter_phage	84.4	1.8e-175
WP_000276806.1|4718559_4718748_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	72.6	1.5e-16
WP_000079604.1|4718847_4719063_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_071845683.1|4719064_4720300_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	2.1e-239
WP_001157407.1|4720351_4721287_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123738.1|4721415_4722789_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|4722818_4722992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046881283.1|4723266_4724250_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|4724504_4725737_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
4724898:4724913	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 9
NZ_CP011416	Escherichia coli strain CFSAN029787 chromosome, complete genome	4947515	4938335	4947430	4947515	tail	Enterobacteria_phage(42.86%)	7	NA	NA
WP_000531601.1|4938335_4939472_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799404.1|4939455_4940319_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_046881375.1|4940544_4941171_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.2	2.4e-79
WP_046881377.1|4941121_4942537_-|tail	tail protein	tail	Q8W611	Enterobacteria_phage	44.9	1.5e-47
WP_046881378.1|4942600_4943200_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	1.8e-108
WP_046881379.1|4943269_4946767_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.9	0.0e+00
WP_000090878.1|4946827_4947430_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	7.3e-89
>prophage 1
NZ_CP011417	Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence	293826	11128	66828	293826	protease,transposase	Stx2-converting_phage(28.57%)	43	NA	NA
WP_113772075.1|11128_12192_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.6	2.1e-59
WP_000169553.1|12842_13142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011114759.1|13204_13609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005059327.1|14160_14877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952382.1|16406_17579_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_000544828.1|17578_18376_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_000124084.1|19905_20271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005119556.1|20990_21230_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_001195009.1|22658_23861_-|protease	alpha-tubulin-specific protease	protease	NA	NA	NA	NA
WP_038341661.1|24389_27698_+	outer membrane autotransporter IcsA	NA	A0A2L1IV18	Escherichia_phage	28.8	3.9e-75
WP_000612524.1|29882_31535_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001278274.1|32041_32569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|32926_33604_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|33603_33951_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|33970_35542_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_005137363.1|35574_36702_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.6	4.5e-23
WP_086020950.1|37199_38473_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000607008.1|38899_39538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000991243.1|40787_41078_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_000433928.1|41046_41298_-	transporter	NA	NA	NA	NA	NA
WP_038341659.1|41749_42034_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421262.1|42033_42309_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_072147868.1|42361_42535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198523.1|44900_46109_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019158.1|46089_46362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813626.1|46521_46740_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159860.1|46741_47047_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_046881589.1|47439_49077_+	T3SS effector E3 ubiquitin-protein ligase IpaH9.8	NA	NA	NA	NA	NA
WP_000079956.1|49284_49554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038339729.1|49805_50291_+	protein kinase	NA	NA	NA	NA	NA
WP_071845702.1|51052_51172_+	type III effector	NA	NA	NA	NA	NA
WP_000336684.1|51503_52322_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.9e-64
WP_000087856.1|52357_52660_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	8.6e-06
WP_162487924.1|53319_56232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004996477.1|56234_56351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931198.1|56714_57557_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_005027207.1|57559_58648_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_012449328.1|58652_59603_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_046881604.1|59667_60612_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001346164.1|60765_61797_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065405717.1|61964_62609_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	54.8	2.8e-14
WP_046881606.1|64333_65524_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.1	3.2e-104
WP_001111632.1|65637_66828_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
>prophage 2
NZ_CP011417	Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence	293826	72961	213798	293826	tRNA,integrase,protease,transposase	Escherichia_phage(30.0%)	115	137428:137442	215221:215235
WP_000088311.1|72961_73264_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_000336726.1|73299_74118_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000243702.1|74271_74874_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151537.1|75195_75579_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283375.1|75769_76459_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_071779529.1|76557_76953_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000991524.1|76985_77351_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_038341173.1|77365_77611_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_046881616.1|77661_78852_+|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.4	1.4e-104
WP_077788334.1|78852_78981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399792.1|79002_79569_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_148713445.1|79579_80284_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000002793.1|81699_82284_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_071779521.1|82237_82591_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000809910.1|82833_83349_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_046881619.1|83483_83744_+	conjugal transfer protein TraR	NA	Q6K1F5	Salmonella_virus	38.6	3.7e-05
WP_046881620.1|83869_86500_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000213409.1|86496_86883_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001203720.1|86879_87512_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000830845.1|87508_88501_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_046881623.1|88530_88836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046881624.1|88844_89483_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_046881625.1|89479_91288_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000864339.1|91314_91572_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_023181031.1|92320_92662_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_038341566.1|93059_93344_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_038341567.1|93330_93876_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_071845693.1|93805_94180_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000336726.1|94451_95270_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088311.1|95305_95608_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_000944315.1|95780_97154_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_046881629.1|97150_99997_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000628112.1|99993_100503_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_000850424.1|100516_101248_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000282333.1|101451_101931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046881631.1|102212_104438_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_046881633.1|104446_104845_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450530.1|104844_105072_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000952382.1|106780_107953_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_038341448.1|108418_109606_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124126.1|109605_109971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205722.1|114404_115151_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	32.0	5.4e-09
WP_000139370.1|115205_115766_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_032359708.1|115895_116108_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233859.1|116351_116813_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.5	1.4e-20
WP_042047805.1|116858_117068_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_071596907.1|117898_118240_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083826.1|118479_118737_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|118970_119045_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130975.1|119037_119895_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_038341682.1|120597_120789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113772077.1|122002_122847_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	1.7e-22
WP_038341697.1|123271_124726_+	type 3 secretion system effector OspC2	NA	NA	NA	NA	NA
WP_046881641.1|125962_126235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038341448.1|126502_127690_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124126.1|127689_128055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010921625.1|128334_128637_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000405248.1|128627_129110_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_086020965.1|130155_131323_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	1.5e-183
WP_000625266.1|131347_132040_-	type III secretion system effector cysteine methyltransferase OspZ	NA	NA	NA	NA	NA
WP_005005342.1|133628_134576_+|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
WP_001046939.1|136122_136989_+	type 3 secretion system effector OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	32.7	9.4e-29
WP_000850660.1|137317_138058_+	phosphatase PAP2 family protein	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.9	2.6e-11
137428:137442	attL	CAGTTTGTCAATACT	NA	NA	NA	NA
WP_073691583.1|138157_138340_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	86.0	5.5e-16
WP_004968539.1|141147_141450_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	5.0e-06
WP_046881657.1|142139_143849_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001121865.1|144280_145000_-	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_000868562.1|146038_146617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338649.1|147938_148124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000483770.1|148581_149928_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000622995.1|150371_150719_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	3.4e-46
WP_046881668.1|153720_154209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011114726.1|154720_155035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901798.1|155316_155883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005031026.1|157750_158773_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.4	2.6e-195
WP_073842068.1|158769_159552_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.5	3.2e-137
WP_000200287.1|160278_161478_+	ParA family protein	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
WP_000431558.1|161477_162458_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
WP_073691216.1|163487_164666_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.1	1.7e-28
WP_072147963.1|164715_165135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046881679.1|166668_168393_-	T3SS effector E3 ubiquitin-protein ligase IpaH4.5	NA	NA	NA	NA	NA
WP_046881681.1|168820_170518_-	T3SS effector E3 ubiquitin-protein ligase IpaH7.8	NA	NA	NA	NA	NA
WP_046881798.1|171925_172915_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046881682.1|174091_175300_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019158.1|175280_175553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046881684.1|175844_177572_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_011114782.1|178879_179032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000957844.1|181314_181503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086020965.1|182634_183803_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	1.5e-183
WP_094096526.1|184300_184711_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	97.2	8.3e-52
WP_005116773.1|184652_185441_-	AraC family invasion system transcriptional regulator VirF	NA	NA	NA	NA	NA
WP_046881034.1|185939_187067_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
WP_046881692.1|187929_188196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140459.1|188566_189763_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000483533.1|190226_190538_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	95.1	5.0e-49
WP_000865087.1|190537_190825_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	88.4	1.7e-40
WP_046881694.1|191362_192550_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124126.1|192549_192915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000483770.1|194013_195360_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001224621.1|195918_196794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000981089.1|196801_197578_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_038339555.1|197746_200008_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020414.1|200076_201252_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_096971096.1|201624_201960_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.5e-06
WP_046881702.1|204115_204388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000483770.1|204517_205864_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001146936.1|206011_206356_+	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	44.3	4.5e-11
WP_001111632.1|206746_207937_-|transposase	IS4-like element ISEc60 family transposase	transposase	S5FM71	Shigella_phage	50.6	4.5e-106
WP_046881703.1|208250_209459_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019152.1|209439_209712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278818.1|210090_210507_-	recombinase	NA	NA	NA	NA	NA
WP_000688506.1|210499_211480_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.1	5.0e-79
WP_000030199.1|211892_212201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|212287_212932_-	ParA family protein	NA	NA	NA	NA	NA
WP_000063140.1|213111_213798_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	3.5e-55
215221:215235	attR	AGTATTGACAAACTG	NA	NA	NA	NA
>prophage 3
NZ_CP011417	Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence	293826	226119	273543	293826	protease,transposase	Shigella_phage(30.0%)	39	NA	NA
WP_000088311.1|226119_226422_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_000336726.1|226457_227276_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_046881712.1|227287_227635_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	58.7	2.1e-32
WP_064756678.1|227665_229258_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.8	1.6e-175
WP_000088311.1|229912_230215_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_046881714.1|230250_231069_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	7.7e-65
WP_012449376.1|232213_232441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151276792.1|233276_233813_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_046881813.1|233866_236263_+	F4 (K88) fimbrial usher FaeD	NA	NA	NA	NA	NA
WP_046881715.1|236255_237038_+	F4 (K88) fimbrial chaperone FaeE	NA	NA	NA	NA	NA
WP_000753476.1|237072_237564_+	F4 (K88) fimbria minor subunit FaeF	NA	NA	NA	NA	NA
WP_046881718.1|237801_238602_+	cshE pilin	NA	NA	NA	NA	NA
WP_001346177.1|238822_239620_+	F4 (K88) fimbria minor subunit FaeH	NA	NA	NA	NA	NA
WP_046881720.1|239649_240402_+	F4 (K88) fimbria minor subunit FaeI	NA	NA	NA	NA	NA
WP_000017084.1|240726_241953_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.7	1.7e-60
WP_000502855.1|241937_242576_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	3.1e-53
WP_000743988.1|242803_243226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005038443.1|243213_243687_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_113772079.1|244126_244991_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	5.1e-19
WP_001026854.1|246332_247745_+	type 3 secretion system effector OspC1	NA	NA	NA	NA	NA
WP_000019158.1|250172_250445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046881733.1|250425_251634_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000501969.1|253429_253915_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011114751.1|253902_254187_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000544828.1|254943_255741_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
WP_000952382.1|255740_256913_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
WP_046881737.1|257174_257993_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	5.9e-65
WP_000088311.1|258028_258331_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_000631709.1|259709_260057_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	4.1e-44
WP_046881738.1|260053_260728_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	4.0e-11
WP_046881740.1|261298_262753_+	T3SS effector OspC family protein	NA	NA	NA	NA	NA
WP_004968539.1|263090_263393_+|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	5.0e-06
WP_064756679.1|263428_264247_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.0	3.4e-65
WP_112384451.1|265011_266240_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	6.3e-172
WP_000129624.1|266511_266667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046881745.1|267752_268949_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046880187.1|269734_270553_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.0e-65
WP_000088311.1|270588_270891_-|transposase	transposase	transposase	Q716C1	Shigella_phage	31.3	1.1e-05
WP_005059304.1|272763_273543_+|protease	type III secretion system effector cysteine protease IpaJ	protease	NA	NA	NA	NA
