The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	372945	382618	2084058	integrase	uncultured_virus(50.0%)	7	366675:366703	374169:374197
366675:366703	attL	ATAAAATTAGCACTATTTGTAAAAAAGTG	NA	NA	NA	NA
WP_046813870.1|372945_374097_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.8	7.0e-56
WP_003627770.1|374333_374618_+	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
374169:374197	attR	ATAAAATTAGCACTATTTGTAAAAAAGTG	NA	NA	NA	NA
WP_003627769.1|374671_376294_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	53.8	2.9e-156
WP_153245832.1|376475_379052_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.1	2.1e-39
WP_046813872.1|379051_380962_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.5	9.8e-55
WP_003627766.1|380962_381553_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003627765.1|381601_382618_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
>prophage 2
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	449852	484012	2084058	integrase,transposase,holin	Lactobacillus_virus(20.0%)	31	478256:478315	486253:486327
WP_023061029.1|449852_449966_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_046813896.1|450762_451230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813897.1|451183_451789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814584.1|451835_452315_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_046813898.1|452646_453831_+	acetate kinase	NA	NA	NA	NA	NA
WP_003632732.1|454635_454863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814585.1|455008_455428_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153245819.1|457267_458251_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.0	2.6e-91
WP_025283334.1|458519_458891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813899.1|458908_459658_-	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_046813901.1|463172_464351_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.5	3.2e-120
WP_046813902.1|464962_466117_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_046813903.1|466382_467624_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.7	2.2e-119
WP_046813904.1|467929_468328_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_014564083.1|468426_468636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813905.1|468737_469130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003632978.1|470329_470446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813906.1|470828_471530_+	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	51.4	3.8e-12
WP_003626948.1|471667_472726_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_023190837.1|472795_473374_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	2.5e-22
WP_080948191.1|473374_474592_+	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.9	1.4e-14
WP_003626944.1|474642_475338_+	glycerophosphoryl diester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	25.8	1.4e-14
WP_079227881.1|475477_476743_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
478256:478315	attL	TGGGTTATAGCCAAGTGGTAAGGCAATGGTTTTTGGTACCATCATGCGCTGGTTCGAATC	NA	NA	NA	NA
WP_046813907.1|479023_479437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813908.1|479659_479980_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_046813910.1|480278_480689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245818.1|480681_481122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813912.1|481131_481449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813913.1|481521_481740_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052747884.1|481863_482697_+	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	63.1	6.0e-17
WP_046813914.1|482842_484012_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.3	2.1e-55
486253:486327	attR	TGGGTTATAGCCAAGTGGTAAGGCAATGGTTTTTGGTACCATCATGCGCTGGTTCGAATCCAGCTAACCCAATAG	NA	NA	NA	NA
>prophage 3
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	492297	575061	2084058	transposase,tRNA	Bacillus_phage(18.18%)	58	NA	NA
WP_046813917.1|492297_493326_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	6.9e-47
WP_046813918.1|493479_494958_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.5	4.5e-116
WP_012211508.1|494954_495785_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.4	5.7e-68
WP_046813919.1|500217_501372_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_003633045.1|501376_502807_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046813920.1|502809_503508_+	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
WP_003626912.1|503495_503966_+	SprT family protein	NA	NA	NA	NA	NA
WP_003633047.1|504203_504851_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
WP_012211515.1|504936_507183_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	6.9e-132
WP_046813921.1|507223_509230_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.9	7.1e-104
WP_020829042.1|509242_510391_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003633051.1|510404_510713_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003626902.1|510712_512152_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003626901.1|512156_513587_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003633052.1|513611_514532_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
WP_003626897.1|514598_515291_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_046813922.1|515334_516039_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003626893.1|516220_516562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813923.1|516598_517975_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_046813924.1|518339_519692_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
WP_046813925.1|521129_522092_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_046813926.1|522110_523289_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003626886.1|523309_524101_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003626883.1|526149_526353_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.9	1.6e-19
WP_046813927.1|526711_527158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813928.1|528499_529000_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003627960.1|529102_529711_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_046813929.1|529740_531057_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.2	1.0e-55
WP_046813930.1|534850_536179_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.9	1.5e-62
WP_020829065.1|536191_536722_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_046813931.1|537012_538482_+	MFS transporter	NA	NA	NA	NA	NA
WP_046813932.1|538435_540172_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_046813933.1|540317_541523_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003633113.1|541649_542732_+	M42 family peptidase	NA	NA	NA	NA	NA
WP_046813934.1|542836_544459_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.8	8.4e-55
WP_046813935.1|544735_545407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813936.1|546129_546948_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211536.1|547089_547551_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046813937.1|547529_549260_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.9e-28
WP_046813938.1|549259_551029_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.3e-55
WP_003626847.1|551191_551770_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_046813939.1|552816_553557_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	3.2e-38
WP_003626841.1|553567_554386_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003626839.1|554385_555027_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046813940.1|555041_555695_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_153245812.1|556236_557466_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.9	3.8e-124
WP_025283375.1|559638_560940_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003633175.1|561052_562396_-	PFL family protein	NA	NA	NA	NA	NA
WP_014919426.1|562414_562684_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012211550.1|564242_565046_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_025283376.1|565138_566065_+	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_046813942.1|566064_566757_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_046813943.1|566817_568833_+	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.4	3.2e-64
WP_046813944.1|568950_569877_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_046813945.1|570675_570870_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003633228.1|572274_572598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025283378.1|572662_573481_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_079227881.1|573795_575061_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
>prophage 4
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	852554	913504	2084058	terminase,protease,head,integrase,transposase	Lactobacillus_phage(30.43%)	47	864567:864584	906108:906125
WP_046814023.1|852554_853829_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	2.3e-132
WP_012211726.1|853818_854409_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_046814024.1|856081_857086_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_046814025.1|857078_858452_-	aspartate kinase	NA	NA	NA	NA	NA
WP_046814026.1|858923_860240_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003626729.1|860259_860970_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_046814027.1|860972_862127_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_046814028.1|862128_863064_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_046814029.1|863056_863836_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
864567:864584	attL	AAAGTCTCATGCAATGAC	NA	NA	NA	NA
WP_153245752.1|866204_867305_+	serine hydrolase	NA	NA	NA	NA	NA
WP_080948201.1|867361_867937_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003626700.1|876729_877284_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.8	4.7e-34
WP_046814032.1|877280_878720_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.8	5.1e-96
WP_046814033.1|879015_879873_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046814034.1|880034_880739_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	25.1	2.8e-07
WP_046814035.1|881764_882487_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814036.1|884633_885572_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_046814037.1|887136_887994_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_025283496.1|889087_889576_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_046814038.1|889727_890318_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003626683.1|890381_891668_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_014563771.1|892770_893346_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_046814039.1|894666_895773_-|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	42.3	5.1e-80
WP_046814040.1|895912_896353_-	hypothetical protein	NA	Q6SEA2	Lactobacillus_prophage	39.4	1.7e-18
WP_046814599.1|896360_896732_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	46.3	8.9e-13
WP_046814041.1|896909_897119_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046814042.1|897162_897933_+	antirepressor	NA	L0P8P6	Lactobacillus_phage	77.1	1.0e-111
WP_046814043.1|897942_898260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046814044.1|898256_898502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814045.1|898491_898728_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	47.6	7.2e-08
WP_046814047.1|898953_899328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814048.1|899320_900199_+	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	27.1	4.7e-20
WP_046814049.1|900201_901059_+	replication protein	NA	Q6SE93	Lactobacillus_prophage	43.1	1.6e-49
WP_046814051.1|901342_902095_+	hypothetical protein	NA	X2CYF1	Lactobacillus_phage	49.4	5.4e-33
WP_046814052.1|902174_902615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814053.1|902811_903240_+	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	72.5	6.8e-49
WP_052747888.1|903257_903587_+	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	72.1	1.3e-18
WP_052747889.1|903780_904278_+	hypothetical protein	NA	Q6SE89	Lactobacillus_prophage	34.3	5.2e-08
WP_046814054.1|905663_906191_+	chromosome partitioning protein ParB	NA	Q938L7	Temperate_phage	54.6	5.9e-42
906108:906125	attR	AAAGTCTCATGCAATGAC	NA	NA	NA	NA
WP_046814055.1|906175_906853_+	ABC transporter ATPase	NA	B5SP23	Lactococcus_phage	55.8	1.2e-63
WP_080948203.1|906798_907269_+	GNAT family N-acetyltransferase	NA	B5SP24	Lactococcus_phage	39.4	1.0e-13
WP_052747891.1|907293_907791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080948204.1|907759_909250_+|terminase	phage terminase large subunit	terminase	A5GYP8	Lactococcus_phage	44.9	9.5e-114
WP_046814057.1|909264_910668_+	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	30.3	5.5e-47
WP_046814058.1|910654_911452_+|head	phage head morphogenesis protein	head	L7TMD0	Rhizobium_phage	37.5	8.1e-19
WP_046814059.1|912017_912386_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046814060.1|912385_913504_+	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	45.7	6.4e-38
>prophage 5
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1274821	1332961	2084058	integrase,transposase,terminase	Lactobacillus_phage(50.0%)	66	1304349:1304365	1317989:1318005
WP_046814223.1|1274821_1276078_-	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	33.9	2.5e-43
WP_046814224.1|1276077_1276641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814225.1|1276624_1277020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052747899.1|1277032_1277569_-	hypothetical protein	NA	D6PSY0	Lactobacillus_phage	33.3	4.0e-22
WP_046814226.1|1277565_1277961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120357349.1|1277960_1278944_-	DUF2184 domain-containing protein	NA	D6PSX7	Lactobacillus_phage	27.5	5.7e-14
WP_052747900.1|1278940_1279489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814228.1|1279488_1280637_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	41.7	3.6e-28
WP_080948214.1|1280639_1281029_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046814229.1|1281041_1281818_-	hypothetical protein	NA	A8ATG2	Listeria_phage	31.6	8.4e-29
WP_052747901.1|1281795_1283283_-	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	31.5	7.4e-50
WP_080948263.1|1283295_1284666_-|terminase	phage terminase large subunit	terminase	A5GYP8	Lactococcus_phage	49.2	1.3e-117
WP_052747902.1|1284745_1285258_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153245703.1|1285417_1285573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052747903.1|1285559_1285892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814231.1|1285878_1286097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245702.1|1286093_1286267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814232.1|1287452_1287956_-	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	38.2	3.9e-11
WP_046814233.1|1288003_1288252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814234.1|1288427_1288670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814235.1|1288669_1290346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245701.1|1290494_1290944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814237.1|1290930_1291113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814238.1|1291115_1291568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814239.1|1291564_1291747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814240.1|1292084_1292384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814629.1|1292368_1292914_-	methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	49.7	2.5e-43
WP_046814241.1|1292910_1293141_-	hypothetical protein	NA	X2CXN1	Lactobacillus_phage	42.9	4.2e-05
WP_046814242.1|1293133_1293322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814244.1|1293555_1293900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814245.1|1293996_1294290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814246.1|1294279_1294489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052747904.1|1294481_1294880_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	69.5	5.4e-16
WP_046814247.1|1294876_1295218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814248.1|1295207_1295531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814249.1|1295533_1296148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814250.1|1296971_1297769_-	replication protein	NA	Q6SE93	Lactobacillus_prophage	45.5	6.3e-56
WP_046814251.1|1297771_1298653_-	DUF1351 domain-containing protein	NA	U5U3Y3	Lactobacillus_phage	29.2	1.6e-23
WP_046814252.1|1298673_1299045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814253.1|1299275_1299455_-	hypothetical protein	NA	L0P6F4	Lactobacillus_phage	88.1	9.2e-24
WP_153245700.1|1299609_1299753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814254.1|1299808_1300024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814255.1|1300202_1300445_-	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	37.1	1.3e-07
WP_046814256.1|1300437_1300659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814257.1|1300670_1301420_-	antirepressor	NA	Q6SE99	Lactobacillus_prophage	72.3	9.0e-105
WP_046814258.1|1301422_1301665_-	helix-turn-helix transcriptional regulator	NA	E9LUL5	Lactobacillus_phage	40.6	7.6e-05
WP_046814259.1|1301829_1302210_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	36.5	3.8e-11
WP_052747905.1|1302703_1303354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245698.1|1303408_1303558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814260.1|1303658_1303877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814261.1|1303911_1304517_+	hypothetical protein	NA	NA	NA	NA	NA
1304349:1304365	attL	CTTAAAAGAAAACAATA	NA	NA	NA	NA
WP_079227881.1|1304919_1306185_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_046814262.1|1306276_1306564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052747906.1|1306930_1308145_+|integrase	site-specific integrase	integrase	F8J1D8	Lactobacillus_phage	32.4	1.0e-44
WP_046814263.1|1310048_1310654_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_014918653.1|1312124_1312661_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_046814264.1|1319182_1320940_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.3e-87
1317989:1318005	attR	CTTAAAAGAAAACAATA	NA	NA	NA	NA
WP_003627493.1|1321100_1321601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046813730.1|1322216_1323074_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080948217.1|1324324_1325119_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_046814266.1|1325134_1326064_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.2	6.4e-100
WP_003628968.1|1326208_1326736_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_046814267.1|1326841_1329115_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.7	6.4e-77
WP_003627502.1|1329235_1329925_-	class A sortase	NA	NA	NA	NA	NA
WP_046814268.1|1329927_1331766_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	2.4e-21
WP_080948218.1|1332133_1332961_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1349769	1452413	2084058	tRNA,capsid,protease,head,terminase,integrase,transposase,holin,portal,tail	Lactobacillus_phage(55.32%)	109	1404686:1404702	1450883:1450899
WP_046814273.1|1349769_1351467_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_020829285.1|1351509_1352766_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003629019.1|1352776_1353592_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003627524.1|1353593_1354328_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
WP_003627525.1|1354330_1354888_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003627526.1|1354887_1355613_-	UMP kinase	NA	NA	NA	NA	NA
WP_023190306.1|1355751_1356777_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003627530.1|1356810_1357584_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_023192354.1|1357745_1358777_-	methyltransferase	NA	NA	NA	NA	NA
WP_046814274.1|1358842_1359457_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_046814275.1|1359511_1360693_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	1.8e-46
WP_003627535.1|1360750_1362694_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.4	7.2e-61
WP_080948219.1|1367966_1369196_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	40.8	1.4e-75
WP_003627540.1|1369494_1369713_-	YneF family protein	NA	NA	NA	NA	NA
WP_003627541.1|1369775_1370039_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003627542.1|1370189_1370816_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_046814277.1|1370844_1371630_-	SGNH/GDSL hydrolase family protein	NA	Q6SEC0	Lactobacillus_prophage	24.0	1.2e-06
WP_046814278.1|1371622_1372282_-	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	30.9	2.8e-09
WP_046814146.1|1372331_1373189_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003629071.1|1373639_1373987_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_046814279.1|1374099_1374819_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003629074.1|1374808_1375324_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003627549.1|1375392_1375665_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_046814280.1|1375755_1377186_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003627552.1|1377190_1377532_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_080948220.1|1377646_1378441_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	6.4e-24
WP_153245836.1|1378392_1378602_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003629078.1|1378727_1380155_+	amino acid permease	NA	NA	NA	NA	NA
WP_003627557.1|1380221_1380509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814281.1|1380708_1382130_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_025283683.1|1382172_1383465_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_046814282.1|1383465_1387035_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003627561.1|1387050_1387737_-	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	30.6	8.2e-20
WP_046814283.1|1389810_1391562_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046814284.1|1391775_1392705_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012212411.1|1392719_1393679_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003629095.1|1393681_1394668_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	3.7e-13
WP_046814285.1|1394671_1395706_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	6.0e-14
WP_003627571.1|1395826_1396069_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	8.1e-07
WP_025283686.1|1396099_1397101_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_046814636.1|1397121_1399152_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003627574.1|1399153_1400815_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003547910.1|1400836_1401199_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_046814286.1|1401354_1401540_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_046814287.1|1402048_1402903_-	glycoside hydrolase family 25	NA	Q9AZ81	Lactobacillus_prophage	53.8	1.2e-84
WP_046814288.1|1402895_1403291_-|holin	phage holin	holin	Q6SEB6	Lactobacillus_prophage	54.5	4.3e-29
WP_046814289.1|1403280_1403508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814290.1|1403523_1403940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948221.1|1403911_1404061_-	XkdX family protein	NA	NA	NA	NA	NA
WP_046814291.1|1404060_1404513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814292.1|1404682_1405267_-	hypothetical protein	NA	NA	NA	NA	NA
1404686:1404702	attL	TTTTTTTAATTGATCAA	NA	NA	NA	NA
WP_046814293.1|1405425_1405890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814294.1|1405909_1407538_-	DUF2479 domain-containing protein	NA	B8R660	Lactobacillus_phage	38.1	1.7e-18
WP_046814295.1|1407503_1407689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814296.1|1407698_1411031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814297.1|1411030_1411810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814298.1|1411793_1417955_-	tape measure protein	NA	B8R657	Lactobacillus_phage	29.0	1.1e-09
WP_046814299.1|1417959_1418142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814300.1|1418173_1418518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814301.1|1418621_1419326_-|tail	tail protein	tail	Q9T1F1	Lactobacillus_phage	41.1	9.3e-27
WP_046814302.1|1419307_1419697_-	DUF806 family protein	NA	NA	NA	NA	NA
WP_046814303.1|1419693_1420134_-	hypothetical protein	NA	Q9T1F3	Lactobacillus_phage	40.4	1.4e-25
WP_080948222.1|1420126_1420483_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_046814305.1|1420442_1420802_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9T1F5	Lactobacillus_phage	44.0	2.4e-15
WP_046814306.1|1420822_1422064_-|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	63.4	6.5e-132
WP_046814307.1|1422084_1422795_-|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	67.0	2.1e-79
WP_046814308.1|1422769_1423924_-|portal	phage portal protein	portal	Q9T1F8	Lactobacillus_phage	53.7	3.4e-111
WP_046814637.1|1423940_1424123_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_046814309.1|1424112_1426011_-|terminase	terminase large subunit	terminase	Q9T1F9	Lactobacillus_phage	58.3	4.8e-211
WP_153245691.1|1426130_1426274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814310.1|1426270_1426723_-|terminase	phage terminase small subunit P27 family	terminase	Q9T1G0	Lactobacillus_phage	69.9	1.0e-55
WP_046814311.1|1426879_1427410_-	HNH endonuclease	NA	Q9T1G1	Lactobacillus_phage	54.4	6.3e-52
WP_046814312.1|1427959_1428409_-	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	40.3	8.6e-18
WP_046814313.1|1428428_1429037_-	hypothetical protein	NA	L0P6F5	Lactobacillus_phage	44.9	1.8e-39
WP_046814314.1|1429033_1429393_-	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	80.0	1.4e-50
WP_046814315.1|1429382_1429961_-	hypothetical protein	NA	A0A172JIG4	Bacillus_phage	45.3	3.3e-30
WP_046814316.1|1430288_1430630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245690.1|1430641_1430812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814317.1|1430786_1430969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948264.1|1430961_1431327_-	DUF1599 domain-containing protein	NA	F8J1G5	Lactobacillus_phage	48.8	6.1e-14
WP_046814318.1|1431496_1431682_-	hypothetical protein	NA	Q20DE7	Lactobacillus_phage	64.6	2.4e-11
WP_046814319.1|1431975_1433298_-	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	47.6	1.9e-105
WP_046814320.1|1433290_1434088_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	66.2	5.1e-90
WP_046814321.1|1434178_1434754_-	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	51.3	3.2e-49
WP_046814322.1|1434756_1435521_-	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	59.2	1.2e-72
WP_046814323.1|1435521_1436028_-	hypothetical protein	NA	J3IZ07	Acanthamoeba_polyphaga_lentillevirus	42.9	2.5e-26
WP_046814324.1|1436030_1436477_-	HNH endonuclease	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	39.6	3.2e-17
WP_046814325.1|1436454_1436718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814326.1|1436717_1437389_-	N-6 DNA methylase	NA	A0A2D1GPI7	Lactobacillus_phage	45.9	6.7e-51
WP_153245689.1|1437388_1438381_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATD6	Listeria_phage	35.4	1.6e-53
WP_046814328.1|1438384_1439662_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	58.3	2.9e-135
WP_046814329.1|1439786_1440035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814330.1|1440027_1440309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814331.1|1440295_1440631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814639.1|1440874_1441177_-	hypothetical protein	NA	Q37943	Lactococcus_phage	41.6	1.5e-13
WP_153245688.1|1441160_1441469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814333.1|1441477_1441666_-	antirepressor	NA	Q9T1I7	Lactobacillus_phage	59.7	3.1e-14
WP_046814334.1|1441924_1442290_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y3N1	Lactobacillus_phage	34.9	7.2e-07
WP_046814335.1|1442290_1442716_+	hypothetical protein	NA	F8J1D9	Lactobacillus_phage	38.0	2.0e-16
WP_046814336.1|1442746_1443274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814337.1|1443429_1444647_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	42.9	1.1e-78
WP_046814338.1|1444801_1445107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627578.1|1445148_1445835_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003627579.1|1445834_1446485_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_025283689.1|1446497_1447388_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_046814339.1|1447388_1449404_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8QNG7	Ectocarpus_siliculosus_virus	29.2	1.8e-19
WP_003629102.1|1449393_1450149_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_080948224.1|1450153_1451518_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
1450883:1450899	attR	TTTTTTTAATTGATCAA	NA	NA	NA	NA
WP_080948225.1|1451468_1452413_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.2e-10
>prophage 7
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1471408	1541541	2084058	protease,transposase	Streptococcus_phage(33.33%)	53	NA	NA
WP_046813730.1|1471408_1472266_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046814349.1|1472409_1474206_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_046814350.1|1474328_1475549_-	lysin	NA	X2CXX8	Lactobacillus_phage	50.4	6.5e-60
WP_025283704.1|1476920_1477277_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	38.6	5.0e-13
WP_046814351.1|1477991_1480373_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_003627616.1|1480424_1480850_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003627617.1|1480842_1481124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629199.1|1481239_1482103_-	sugar transporter	NA	NA	NA	NA	NA
WP_003627621.1|1482280_1482451_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_046814352.1|1484753_1487942_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_014565406.1|1487934_1489020_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.5	8.6e-56
WP_046814353.1|1489019_1490297_-	dihydroorotase	NA	NA	NA	NA	NA
WP_046814354.1|1490296_1491253_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	34.5	2.2e-26
WP_012212049.1|1491397_1491940_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_046814355.1|1492106_1493030_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003629217.1|1493285_1493990_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_046814356.1|1493991_1494615_+	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	7.0e-26
WP_013854557.1|1496439_1496829_-	MazF family transcriptional regulator	NA	NA	NA	NA	NA
WP_013854558.1|1496818_1497076_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014563336.1|1497438_1498335_-	MFS transporter	NA	NA	NA	NA	NA
WP_023061312.1|1498289_1498631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814357.1|1498733_1499069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155397237.1|1503630_1506258_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	2.6e-82
WP_046814359.1|1506346_1507696_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003630981.1|1507770_1508415_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_046814360.1|1509147_1510380_-	MFS transporter	NA	NA	NA	NA	NA
WP_046814361.1|1510515_1511751_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.5	7.0e-54
WP_014918530.1|1512164_1513910_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041808687.1|1514233_1514767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814362.1|1514806_1515154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133174219.1|1515172_1515442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948227.1|1515690_1516860_-	MFS transporter	NA	NA	NA	NA	NA
WP_003628068.1|1519112_1520279_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	46.9	1.5e-98
WP_003628067.1|1520266_1521367_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.4e-92
WP_003628066.1|1521768_1522398_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_046814365.1|1522506_1523556_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	5.4e-47
WP_023192717.1|1524106_1524400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283733.1|1526052_1526379_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_052747907.1|1526666_1527206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814366.1|1527217_1527580_-	hypothetical protein	NA	E8ZDN5	Streptococcus_phage	50.0	3.3e-12
WP_153245682.1|1527908_1528046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814643.1|1529397_1530018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054607281.1|1530130_1530364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025283744.1|1530998_1532450_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_046814368.1|1532631_1533138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079227881.1|1533300_1534566_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_153245681.1|1534737_1535472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814369.1|1535812_1536598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814370.1|1536661_1537366_-	oxidoreductase	NA	NA	NA	NA	NA
WP_046814371.1|1537385_1537793_-	OsmC family protein	NA	NA	NA	NA	NA
WP_025283748.1|1537811_1538984_-	MFS transporter	NA	NA	NA	NA	NA
WP_046814372.1|1540318_1540588_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080948218.1|1540713_1541541_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1562941	1573238	2084058		Prochlorococcus_phage(16.67%)	9	NA	NA
WP_080680620.1|1562941_1565077_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.3	7.3e-75
WP_003627023.1|1565073_1566123_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	43.9	9.2e-63
WP_095662284.1|1566148_1567600_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.3e-61
WP_012212086.1|1567557_1569789_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	7.8e-144
WP_003627026.1|1569785_1570457_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003627027.1|1570456_1570708_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003627029.1|1570707_1571424_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	39.1	7.5e-40
WP_103658193.1|1571620_1572739_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003627031.1|1572749_1573238_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
>prophage 9
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1677621	1728343	2084058	transposase,tRNA	Aureococcus_anophage(22.22%)	54	NA	NA
WP_012212147.1|1677621_1678269_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_014918424.1|1678289_1678610_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_046814417.1|1678679_1679333_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_046814418.1|1679344_1680532_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003627193.1|1680524_1681268_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.7e-18
WP_003629777.1|1681282_1681618_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_046814419.1|1681647_1681902_-	toxin RelE	NA	NA	NA	NA	NA
WP_003627196.1|1682113_1682551_+	HIT family protein	NA	NA	NA	NA	NA
WP_003627197.1|1682560_1682896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003629779.1|1683014_1683917_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003627199.1|1684055_1684478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814420.1|1684520_1685498_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_046814421.1|1685490_1687992_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023191984.1|1687972_1689193_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_003627204.1|1689201_1689552_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_003627206.1|1689572_1691630_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003627209.1|1691718_1692576_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_046814422.1|1692615_1692762_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_003627212.1|1692876_1693638_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.9	7.7e-19
WP_025283829.1|1693817_1694570_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	30.7	6.4e-26
WP_020829354.1|1694633_1694963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814423.1|1695013_1695832_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_046814648.1|1695842_1696028_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046814649.1|1696024_1696540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061431.1|1696560_1696653_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003627219.1|1696966_1697806_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	38.0	2.1e-49
WP_023191734.1|1697949_1698435_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003629850.1|1701261_1701576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212167.1|1701640_1701904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191232.1|1702061_1702352_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003627229.1|1702460_1702682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814424.1|1703778_1705362_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.6	5.2e-17
WP_046814425.1|1705358_1706954_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	32.4	9.8e-16
WP_046814426.1|1707052_1708231_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212173.1|1708442_1709243_-	multidrug transporter	NA	NA	NA	NA	NA
WP_012212174.1|1709223_1709700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814141.1|1709724_1710582_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046814427.1|1710661_1710991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629872.1|1710990_1711974_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	4.8e-13
WP_046814428.1|1711973_1712585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814429.1|1712574_1712847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629878.1|1712994_1713264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814430.1|1713266_1713785_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003627244.1|1713856_1714768_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_046814431.1|1714878_1716564_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	4.6e-72
WP_153245673.1|1716903_1717083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814432.1|1717095_1717698_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_025283839.1|1717792_1718320_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_080948228.1|1719752_1720136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052747919.1|1720417_1721143_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_046814433.1|1722742_1723540_+	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_003617037.1|1723793_1724429_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_046814653.1|1725857_1726907_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.6	1.8e-50
WP_080948228.1|1727959_1728343_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1741576	1824368	2084058	protease,transposase,tRNA	Staphylococcus_phage(12.5%)	57	NA	NA
WP_046814441.1|1741576_1742605_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.9	3.1e-47
WP_046814442.1|1742805_1744452_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_020829371.1|1744545_1746960_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.9	0.0e+00
WP_046814443.1|1747247_1747910_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_079227881.1|1749956_1751222_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_046814444.1|1752064_1753525_-	MFS transporter	NA	S4TR35	Salmonella_phage	24.2	4.9e-06
WP_003629925.1|1753543_1754743_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.0	1.8e-139
WP_046814445.1|1755158_1756082_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014918044.1|1759441_1759627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003629932.1|1761762_1763070_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	1.1e-92
WP_025283867.1|1763293_1763845_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025283868.1|1763844_1764453_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	39.1	2.1e-35
WP_012212195.1|1764583_1765381_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046814446.1|1765536_1766238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814447.1|1766321_1767704_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046814448.1|1767750_1768785_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_046814449.1|1768941_1772310_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_046814450.1|1772314_1772887_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814451.1|1773022_1773973_-	serine hydrolase	NA	NA	NA	NA	NA
WP_012212201.1|1773985_1774903_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_046814452.1|1775041_1776343_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_025283878.1|1776394_1777690_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_046814453.1|1777673_1778498_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003627844.1|1778501_1779368_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_046814454.1|1779367_1780453_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
WP_003629948.1|1780706_1782134_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003627841.1|1782173_1783028_-	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_025283881.1|1783118_1784072_-	DNA polymerase III subunit epsilon	NA	U5PXE0	Bacillus_virus	40.2	1.1e-11
WP_003627839.1|1784080_1784902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245820.1|1784916_1785075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080948266.1|1785168_1786203_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	58.6	4.3e-105
WP_046814455.1|1787001_1787742_-	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	83.1	6.8e-121
WP_003627833.1|1789856_1790771_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_025283887.1|1790860_1791862_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_003627831.1|1791909_1792413_+	nucleoside deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	5.4e-13
WP_014564150.1|1792822_1793242_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_025283889.1|1793425_1794727_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003629975.1|1794779_1795352_-	elongation factor P	NA	NA	NA	NA	NA
WP_046814456.1|1795386_1796301_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	2.8e-31
WP_012212220.1|1796359_1796920_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_046814457.1|1798465_1800772_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046814458.1|1800921_1801608_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003627817.1|1801668_1802319_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_046814459.1|1802535_1804335_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012212224.1|1804347_1805097_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.7e-34
WP_046814460.1|1805243_1806515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814461.1|1806603_1807275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814462.1|1808652_1809657_-	asparaginase	NA	NA	NA	NA	NA
WP_153245821.1|1809996_1810362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245845.1|1810427_1810703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814463.1|1811125_1811920_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012212228.1|1812142_1812649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814464.1|1812872_1813748_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.7	5.5e-77
WP_046814465.1|1813912_1816018_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003630048.1|1816242_1817694_+	APC family permease	NA	NA	NA	NA	NA
WP_052747912.1|1820810_1821605_-	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_080948232.1|1823138_1824368_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.3e-63
>prophage 11
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1832784	1882435	2084058	bacteriocin,transposase	Clostridioides_phage(15.38%)	47	NA	NA
WP_046814472.1|1832784_1833642_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_046814473.1|1833763_1834870_-	hypothetical protein	NA	Q6EVM4	Oenoccocus_phage	43.7	1.4e-64
WP_046814474.1|1835815_1836538_-	glycosyl transferase	NA	A0A1V0SL98	Klosneuvirus	25.7	2.9e-07
WP_046814475.1|1836534_1837032_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_046814476.1|1837044_1837494_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_153245822.1|1837508_1838165_-	sugar transferase	NA	NA	NA	NA	NA
WP_046814478.1|1838281_1839052_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046814479.1|1839051_1839822_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_046814480.1|1839832_1840717_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046814481.1|1840729_1841791_-	transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	30.6	6.5e-16
WP_046814482.1|1842264_1843530_+	GTPase HflX	NA	NA	NA	NA	NA
WP_046814483.1|1844455_1845259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630115.1|1845396_1846329_-	hydrolase	NA	M9MUG9	Rhodococcus_phage	38.5	9.1e-14
WP_046814484.1|1846483_1847209_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	5.6e-19
WP_046814661.1|1847381_1847765_-	ATPase	NA	NA	NA	NA	NA
WP_023192037.1|1847806_1848079_-	ATPase	NA	NA	NA	NA	NA
WP_025283921.1|1848171_1848723_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	35.9	3.6e-18
WP_046814485.1|1848912_1849458_-	AAA family ATPase	NA	A0A218KC48	Bacillus_phage	32.2	2.5e-11
WP_003630136.1|1849552_1849852_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_023192036.1|1849944_1851450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630140.1|1851464_1852106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283925.1|1852902_1853247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283926.1|1853510_1854047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814486.1|1854222_1855407_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.6	3.9e-126
WP_020828971.1|1855753_1856239_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_046814487.1|1856241_1857012_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_046814488.1|1857022_1858564_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	3.7e-44
WP_014919445.1|1858572_1858950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038525510.1|1859114_1859639_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025283934.1|1860393_1861635_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814489.1|1861796_1863593_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_046814490.1|1864514_1864763_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003627327.1|1866902_1868285_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_046814492.1|1868719_1869514_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_025283938.1|1869513_1870161_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	1.7e-14
WP_046814493.1|1870192_1871170_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046814662.1|1871432_1871705_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046814494.1|1873632_1874748_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.2	6.0e-113
WP_023190799.1|1874889_1875804_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_046814664.1|1875803_1876559_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	8.5e-18
WP_003630190.1|1876913_1877081_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_003630193.1|1877061_1877370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919460.1|1877640_1877832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630196.1|1878130_1878352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814495.1|1878341_1878569_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046814496.1|1878715_1879039_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_046814499.1|1880728_1882435_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
>prophage 12
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1921858	1984690	2084058	bacteriocin,transposase,holin	Lactococcus_phage(18.18%)	50	NA	NA
WP_012212302.1|1921858_1923568_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	3.9e-87
WP_046814512.1|1923564_1925733_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.6	3.8e-172
WP_046814668.1|1925725_1926148_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_023190550.1|1926131_1927139_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
WP_003586333.1|1928064_1928622_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_046814513.1|1928587_1929772_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_046814514.1|1929793_1930705_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.8	1.7e-60
WP_046814515.1|1932000_1932219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814516.1|1932229_1932787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052747914.1|1932964_1933837_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046814518.1|1933948_1935223_-	MFS transporter	NA	NA	NA	NA	NA
WP_080948242.1|1935353_1936169_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080948267.1|1936937_1937240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625268.1|1937724_1938198_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_046814520.1|1938351_1940637_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_080948243.1|1940614_1941520_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_046814523.1|1942756_1943833_+	guanine permease	NA	NA	NA	NA	NA
WP_012212314.1|1943835_1944393_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_153245823.1|1946195_1946585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630367.1|1946530_1947073_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_025283970.1|1947146_1948136_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_046814524.1|1948183_1948942_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_012212318.1|1949001_1949772_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_003630373.1|1949764_1950607_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_046814525.1|1950587_1951967_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_046814526.1|1951980_1952397_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_012212320.1|1952401_1952872_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_046814527.1|1952875_1954105_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_025283971.1|1954126_1954858_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	1.6e-13
WP_003625242.1|1954857_1955775_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003625239.1|1955784_1956027_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_003625237.1|1956085_1957069_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_025283973.1|1957065_1957533_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625233.1|1957562_1958009_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002831196.1|1959711_1959960_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_080948244.1|1960499_1960901_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.1	6.3e-20
WP_046814528.1|1962555_1963443_+	EamA family transporter	NA	NA	NA	NA	NA
WP_046814530.1|1963895_1965134_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.0	5.8e-40
WP_046814531.1|1966793_1968143_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	1.9e-124
WP_107504371.1|1968552_1968642_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_046814532.1|1970339_1971179_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_046814533.1|1971202_1972366_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	4.4e-05
WP_046814534.1|1973992_1974883_-	ribokinase	NA	NA	NA	NA	NA
WP_046814535.1|1974883_1976242_-	allantoin permease	NA	NA	NA	NA	NA
WP_046814536.1|1976247_1977258_-	ADP-ribosylglycohydrolase family protein	NA	A0A2K9L0L0	Tupanvirus	23.4	2.4e-07
WP_046814537.1|1978480_1978891_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023191696.1|1978993_1979092_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_101812836.1|1979471_1979615_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_046814538.1|1979732_1980974_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_080948246.1|1983499_1984690_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP011386	Lactobacillus helveticus strain MB2-1, complete genome	2084058	1989069	2051235	2084058	protease,transposase,holin	Lactobacillus_virus(11.76%)	53	NA	NA
WP_080948268.1|1989069_1990335_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	6.7e-52
WP_046814543.1|1990549_1991032_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.7	2.7e-17
WP_020828933.1|1992081_1992726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630572.1|1992743_1993244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245824.1|1993629_1994559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046814545.1|1994846_1995434_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	34.1	1.2e-16
WP_080948248.1|1995336_1996140_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.5	7.1e-07
WP_003625080.1|1996181_1996661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625077.1|1996758_1997121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025284006.1|1997189_1998488_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.7e-18
WP_046814547.1|1998491_1999781_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.5	1.8e-68
WP_046814548.1|1999991_2000984_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.0	6.3e-130
WP_046814549.1|2001421_2002477_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_046814550.1|2002924_2003938_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.7	9.5e-65
WP_046814551.1|2005938_2007312_-	amino acid permease	NA	NA	NA	NA	NA
WP_003630598.1|2007347_2008709_-	amino acid permease	NA	NA	NA	NA	NA
WP_025284011.1|2008799_2009564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625047.1|2009657_2010299_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003630601.1|2010406_2012530_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.2	1.1e-115
WP_003625045.1|2012814_2013738_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046814552.1|2013706_2015032_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_046814673.1|2015120_2015822_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-32
WP_003625040.1|2018377_2018614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080948250.1|2018652_2020269_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035513724.1|2022937_2023345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625029.1|2023349_2023739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046814554.1|2023735_2024461_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023062095.1|2024445_2024709_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003625023.1|2024920_2025865_-	serine hydrolase	NA	NA	NA	NA	NA
WP_046814555.1|2025864_2027151_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003625019.1|2027143_2027383_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_023190737.1|2027441_2028680_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	2.0e-24
WP_046814556.1|2028679_2030194_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.4	4.4e-34
WP_003630630.1|2030209_2030362_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003630632.1|2030515_2030812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625010.1|2030831_2031968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153245826.1|2032794_2034006_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	54.4	2.1e-111
WP_046814558.1|2034422_2036279_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.6	4.4e-68
WP_046814559.1|2036431_2037601_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003625002.1|2037729_2038038_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004561119.1|2038024_2038294_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_046814560.1|2038331_2039900_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	2.5e-11
WP_003624995.1|2039904_2040534_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_046814561.1|2040625_2041483_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023190505.1|2041479_2041761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153245827.1|2041914_2042010_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_035513461.1|2042437_2042647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624988.1|2042853_2043510_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046814562.1|2043598_2044702_+	membrane protein	NA	NA	NA	NA	NA
WP_023190510.1|2047076_2047685_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_004561127.1|2047791_2048619_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.8	9.6e-23
WP_004561128.1|2048736_2049456_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_046814486.1|2050050_2051235_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.6	3.9e-126
