The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011377	Moraxella bovoculi strain 23343, complete genome	2184753	256768	303068	2184753	tail,integrase,head	Moraxella_phage(66.67%)	58	249155:249174	278397:278416
249155:249174	attL	CAGCCAGTAGCGTGTCATCA	NA	NA	NA	NA
WP_046695977.1|256768_257887_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	53.5	1.4e-106
WP_046695978.1|257921_258113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695979.1|258123_258507_-	hypothetical protein	NA	R9TLR7	Paenibacillus_phage	59.7	1.0e-32
WP_046695980.1|258628_258901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695981.1|258996_259482_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A2I7S8G6	Vibrio_phage	46.7	2.7e-25
WP_046695982.1|259478_259877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945894.1|260034_260574_-	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	65.3	1.3e-36
WP_046695983.1|260576_261179_-	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	64.1	2.1e-67
WP_046695984.1|261175_261946_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	55.5	1.6e-51
WP_155400091.1|261942_262089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695985.1|262085_262325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400092.1|262297_262609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400093.1|263615_263837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695988.1|263972_265034_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	43.9	2.4e-79
WP_080947460.1|265046_265787_-	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	32.9	1.5e-27
WP_080947461.1|265911_266127_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046695989.1|266180_266423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695990.1|266419_267331_+	hypothetical protein	NA	A0A0R6PHP4	Moraxella_phage	36.2	5.8e-21
WP_046695991.1|267323_267968_+	hypothetical protein	NA	A0A0R6PKK7	Moraxella_phage	54.0	1.2e-49
WP_155400094.1|267964_268312_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1X9SFE9	Acinetobacter_phage	42.4	7.6e-14
WP_046695992.1|268301_268664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695993.1|268660_268897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155400095.1|268893_269064_+	hypothetical protein	NA	A0A0R6PHI3	Moraxella_phage	53.6	2.2e-11
WP_046695994.1|269086_269608_+	hypothetical protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	64.1	5.4e-32
WP_080947463.1|269597_270065_+	hypothetical protein	NA	A0A0R6PCZ2	Moraxella_phage	43.6	4.9e-32
WP_046695996.1|270457_271249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155400096.1|271405_271909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695998.1|272091_272517_+	hypothetical protein	NA	A0A0R6PH16	Moraxella_phage	87.2	2.1e-66
WP_046695999.1|272516_273992_+	hypothetical protein	NA	A0A0R6PHB9	Moraxella_phage	84.3	3.9e-253
WP_046696000.1|273991_275422_+	DUF4055 domain-containing protein	NA	A0A0R6PHK8	Moraxella_phage	74.4	1.2e-203
WP_046696001.1|275372_276359_+|head	head morphogenesis protein	head	A0A0R6PHM5	Moraxella_phage	78.2	4.5e-144
WP_046696002.1|276407_277073_+	hypothetical protein	NA	A0A0R6PH19	Moraxella_phage	70.4	1.3e-46
WP_046696003.1|277076_278093_+	hypothetical protein	NA	A0A0R6PCJ9	Moraxella_phage	87.6	1.1e-169
WP_046696004.1|278103_278307_+	hypothetical protein	NA	A0A0R6PCI4	Moraxella_phage	73.1	3.1e-20
WP_046696005.1|278361_278709_+	hypothetical protein	NA	A0A0R6PGY9	Moraxella_phage	53.8	3.6e-24
278397:278416	attR	TGATGACACGCTACTGGCTG	NA	NA	NA	NA
WP_046696006.1|278710_279085_+	hypothetical protein	NA	A0A0R6PHG4	Moraxella_phage	51.3	8.4e-27
WP_046696007.1|279065_279494_+	HK97 gp10 family phage protein	NA	A0A0R6PHN4	Moraxella_phage	48.6	4.6e-29
WP_046696008.1|279496_279886_+	hypothetical protein	NA	A0A0R6PK03	Moraxella_phage	55.8	6.7e-35
WP_046696009.1|279970_280483_+	hypothetical protein	NA	A0A2H4PAV0	Aphanizomenon_phage	37.9	1.3e-06
WP_046696010.1|280498_281407_+	hypothetical protein	NA	A0A0R6PJY2	Moraxella_phage	86.1	2.0e-146
WP_046696011.1|281644_282100_+	hypothetical protein	NA	A0A0R6PKF1	Moraxella_phage	35.8	1.8e-15
WP_080945912.1|282906_283692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945913.1|283984_284503_+	hypothetical protein	NA	A0A0R6PDR4	Moraxella_phage	75.2	3.0e-38
WP_046696013.1|284861_285353_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_046696014.1|285339_285696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945906.1|285807_286830_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	30.4	2.8e-32
WP_080947464.1|286871_290921_+	tape measure protein	NA	A0A220VZA0	Acinetobacter_phage	31.1	7.9e-46
WP_046696017.1|290922_291177_+	hypothetical protein	NA	A0A0R6PGU4	Moraxella_phage	53.7	1.3e-18
WP_046696018.1|291230_291563_+	hypothetical protein	NA	A0A0R6PHH7	Moraxella_phage	79.1	3.6e-45
WP_046696019.1|291639_292014_+	hypothetical protein	NA	A0A0R6PK02	Moraxella_phage	64.6	6.9e-37
WP_046696020.1|292059_292728_+|tail	phage minor tail protein L	tail	A0A0R6PJ72	Moraxella_phage	75.1	2.4e-96
WP_046696021.1|292724_293516_+	C40 family peptidase	NA	A0A0R6PIU2	Moraxella_phage	62.8	7.3e-97
WP_046696022.1|293512_294106_+|tail	tail assembly protein	tail	A0A0R6PIF0	Moraxella_phage	66.7	2.8e-69
WP_080947465.1|294102_300408_+	DUF1983 domain-containing protein	NA	A0A0R6PHL4	Moraxella_phage	64.9	3.2e-25
WP_155400097.1|300416_300764_+	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	45.7	8.6e-18
WP_046696024.1|300760_301816_+	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	39.0	2.1e-59
WP_046696025.1|302027_302396_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	45.5	1.8e-18
WP_046696026.1|302435_303068_+	N-acetylmuramidase family protein	NA	M4SQ91	Psychrobacter_phage	38.0	1.9e-26
>prophage 2
NZ_CP011377	Moraxella bovoculi strain 23343, complete genome	2184753	678902	730600	2184753	integrase,terminase,protease,head,tail,capsid,tRNA	Moraxella_phage(55.81%)	74	708305:708320	712077:712092
WP_046696306.1|678902_679478_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	88.5	2.4e-73
WP_046696307.1|679562_679841_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	37.0	9.4e-07
WP_046696308.1|679856_680162_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	50.0	2.4e-16
WP_046696309.1|680133_680913_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	82.7	1.2e-128
WP_046696310.1|680968_681355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696311.1|681354_682128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696312.1|682188_682902_-|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	88.6	5.0e-121
WP_046696313.1|682953_683352_-	hypothetical protein	NA	A0A0R6PK02	Moraxella_phage	59.1	5.1e-38
WP_046696314.1|683429_683759_-|tail	phage tail protein	tail	A0A0R6PHZ9	Moraxella_phage	82.6	1.3e-52
WP_046696315.1|683803_684061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080947477.1|684164_686744_-	hypothetical protein	NA	D4FUM0	Pseudomonas_phage	41.2	5.4e-40
WP_046696316.1|686798_687119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696317.1|687506_687710_+	hypothetical protein	NA	A0A0R6PK05	Moraxella_phage	50.0	2.3e-10
WP_080947478.1|687742_688345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696319.1|688763_689111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696320.1|689120_689567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696321.1|689588_689954_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_080947480.1|689946_690408_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	55.0	1.2e-30
WP_046696322.1|690444_690765_-|head	phage head closure protein	head	G3ENA2	Psychrobacter_phage	43.9	2.2e-20
WP_046696323.1|690773_691061_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0R6PHI1	Moraxella_phage	84.2	1.7e-40
WP_046696324.1|691828_692200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696325.1|692296_693634_-|capsid	phage major capsid protein	capsid	A0A0R6PHR0	Moraxella_phage	60.0	2.6e-139
WP_080947481.1|693630_694245_-	peptidase U35	NA	A0A0R6PGX0	Moraxella_phage	80.0	6.1e-83
WP_046696326.1|694312_694531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696327.1|694527_694944_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_046696328.1|694988_696731_-|terminase	terminase large subunit	terminase	A0A0R6PH79	Moraxella_phage	87.2	2.4e-297
WP_046696329.1|696705_697065_-	DUF3310 domain-containing protein	NA	A0A0R6PC49	Moraxella_phage	69.6	3.4e-41
WP_046696330.1|697048_697228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696331.1|697224_697668_-	hypothetical protein	NA	A0A0R6PGM4	Moraxella_phage	53.0	2.4e-36
WP_046696332.1|697784_698090_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	80.8	9.8e-42
WP_155399987.1|698092_698245_-	hypothetical protein	NA	A0A0R6PKL5	Moraxella_phage	60.0	1.4e-09
WP_046696333.1|698448_698871_-	hypothetical protein	NA	A0A0R6PGQ4	Moraxella_phage	69.3	1.4e-49
WP_046696334.1|699213_701841_-	hypothetical protein	NA	A0A0R6PCH4	Moraxella_phage	76.9	0.0e+00
WP_046696335.1|701837_702527_-	hypothetical protein	NA	A0A0R6PGY3	Moraxella_phage	71.4	2.1e-31
WP_046696336.1|702605_702842_-	hypothetical protein	NA	A0A0R6PHP1	Moraxella_phage	48.0	2.6e-10
WP_046696337.1|702989_703763_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PKV4	Moraxella_phage	40.8	7.0e-52
WP_046696338.1|703801_704392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696339.1|704429_705329_+	DUF4393 domain-containing protein	NA	A0A0R6PGX6	Moraxella_phage	71.9	6.3e-121
WP_046696340.1|705314_705512_-	hypothetical protein	NA	A0A0R6PCH1	Moraxella_phage	55.6	9.9e-11
WP_046697452.1|705865_706204_+	hypothetical protein	NA	A0A0R6PH37	Moraxella_phage	86.4	2.1e-24
WP_046696341.1|706194_706485_+	hypothetical protein	NA	A0A0R6PGT5	Moraxella_phage	57.1	4.8e-22
WP_046696342.1|706484_706709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696343.1|706732_707071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080947482.1|707082_707913_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_155399988.1|707968_708142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696344.1|708164_708476_+	hypothetical protein	NA	NA	NA	NA	NA
708305:708320	attL	CCAAAAATCACACCCA	NA	NA	NA	NA
WP_046696345.1|708477_708699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696346.1|708710_708989_+	pyocin activator protein PrtN	NA	NA	NA	NA	NA
WP_046696347.1|708957_710070_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	40.2	1.3e-70
WP_046696348.1|710209_711196_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_046696349.1|711318_711897_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_080946050.1|711961_712672_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
712077:712092	attR	CCAAAAATCACACCCA	NA	NA	NA	NA
WP_046696350.1|712881_714243_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	23.7	5.8e-17
WP_046696351.1|714499_715000_-	phage virion morphogenesis protein	NA	A0A0A1IUZ3	Pseudomonas_phage	29.7	1.5e-10
WP_080946049.1|715117_716341_-	hypothetical protein	NA	Q6QIB9	Burkholderia_phage	47.8	7.0e-46
WP_080947483.1|716337_717600_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	40.1	2.3e-76
WP_155400102.1|717562_718321_+	hypothetical protein	NA	J9STP5	Pseudomonas_phage	34.7	4.2e-33
WP_046696352.1|718330_719470_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	55.1	1.6e-89
WP_046696353.1|719496_719724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696354.1|719733_719979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696355.1|720543_720819_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	53.3	4.4e-17
WP_046696356.1|720885_721359_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_080946046.1|721379_721721_+	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	42.5	4.4e-14
WP_046697459.1|721970_723056_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	36.4	2.5e-47
WP_155399989.1|723907_724291_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_046696358.1|724301_724601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696359.1|724604_725072_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	30.0	7.1e-07
WP_046696360.1|725071_725578_+	hypothetical protein	NA	A4JWK3	Burkholderia_virus	36.6	6.9e-24
WP_046696361.1|725590_726979_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.5	1.3e-96
WP_046696362.1|727001_727514_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	50.9	7.9e-44
WP_046696363.1|727629_727932_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080946178.1|727969_728113_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_155399990.1|728109_728250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080946043.1|728293_730600_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	44.5	2.1e-107
>prophage 3
NZ_CP011377	Moraxella bovoculi strain 23343, complete genome	2184753	768541	775296	2184753		Lake_Baikal_phage(33.33%)	8	NA	NA
WP_046696390.1|768541_769585_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	2.9e-77
WP_155399994.1|769654_770302_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-24
WP_046696392.1|770346_770685_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_046696393.1|770722_772591_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.0	5.4e-98
WP_046696394.1|772704_773226_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_046696395.1|773235_773556_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.0	2.8e-23
WP_036366269.1|773581_773965_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	80.6	1.3e-51
WP_046696396.1|774072_775296_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	29.1	2.2e-31
>prophage 4
NZ_CP011377	Moraxella bovoculi strain 23343, complete genome	2184753	826049	834547	2184753	transposase	Moraxella_phage(62.5%)	11	NA	NA
WP_046696435.1|826049_827222_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.5	3.8e-57
WP_080946037.1|827522_828062_-	peptidase M15	NA	A0A0R6PID9	Moraxella_phage	59.9	1.0e-57
WP_046696436.1|828101_828470_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	45.5	1.4e-18
WP_046696437.1|828681_829779_-	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	34.7	4.3e-47
WP_046696438.1|829775_830138_-	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	45.8	9.9e-25
WP_046696305.1|830134_832609_-	DUF1983 domain-containing protein	NA	A0A0R6PD22	Moraxella_phage	78.3	2.2e-62
WP_046696439.1|832710_833169_-	hypothetical protein	NA	A0A0R6PHL4	Moraxella_phage	63.9	1.8e-15
WP_003659281.1|833234_833390_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_036362158.1|833432_833669_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_046696440.1|833941_834283_-	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_046696441.1|834298_834547_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	7.8e-13
>prophage 5
NZ_CP011377	Moraxella bovoculi strain 23343, complete genome	2184753	1207725	1216911	2184753		Acinetobacter_phage(42.86%)	10	NA	NA
WP_046696695.1|1207725_1208217_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.2	3.1e-13
WP_080945990.1|1208648_1210163_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_046696696.1|1210338_1210962_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	69.5	2.4e-79
WP_046696697.1|1210994_1212077_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	53.2	5.7e-92
WP_046696698.1|1212106_1212943_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	49.6	5.1e-56
WP_046696699.1|1213011_1213641_-	MarC family protein	NA	NA	NA	NA	NA
WP_046696700.1|1213791_1214487_+	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	35.8	8.9e-30
WP_046696701.1|1214596_1214938_+	quaternary ammonium transporter	NA	NA	NA	NA	NA
WP_046696702.1|1214955_1215561_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	52.5	9.1e-39
WP_046696703.1|1215597_1216911_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	85.1	1.7e-191
