The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	260263	314996	2363171	head,integrase,tail	Moraxella_phage(48.94%)	71	250436:250451	267773:267788
250436:250451	attL	TAGCAGGTGAAAAAAT	NA	NA	NA	NA
WP_046695977.1|260263_261382_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	53.5	1.4e-106
WP_046695978.1|261416_261608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695979.1|261618_262002_-	hypothetical protein	NA	R9TLR7	Paenibacillus_phage	59.7	1.0e-32
WP_155400230.1|262135_262405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699089.1|262388_262616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699090.1|262605_263019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699091.1|263084_263288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400226.1|263271_263598_-	hypothetical protein	NA	B5AXA3	Iodobacteriophage	73.3	1.3e-36
WP_046699093.1|264232_264631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945894.1|264788_265328_-	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	65.3	1.3e-36
WP_046695983.1|265330_265933_-	YqaJ viral recombinase family protein	NA	A0A2H4J882	uncultured_Caudovirales_phage	64.1	2.1e-67
WP_046695984.1|265929_266700_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	55.5	1.6e-51
WP_155400050.1|266696_266843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400231.1|266839_267079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699095.1|267051_267396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945895.1|268182_268713_-	hypothetical protein	NA	A0A2H4JB10	uncultured_Caudovirales_phage	58.7	3.6e-07
267773:267788	attR	TAGCAGGTGAAAAAAT	NA	NA	NA	NA
WP_046699096.1|268863_269574_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHW3	Moraxella_phage	41.8	2.7e-50
WP_046699097.1|269698_269896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699098.1|269939_270419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945896.1|270415_271330_+	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	57.3	9.9e-21
WP_155400232.1|271289_271967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699100.1|271963_272329_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	39.3	3.6e-14
WP_046699101.1|272356_272635_+	hypothetical protein	NA	M4T3Q1	Psychrobacter_phage	52.5	3.8e-16
WP_046695994.1|272644_273166_+	hypothetical protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	64.1	5.4e-32
WP_080945897.1|273155_273623_+	hypothetical protein	NA	A0A0R6PCZ2	Moraxella_phage	44.2	2.6e-33
WP_046699102.1|274015_274807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699103.1|274966_275467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699104.1|275802_276534_+	hypothetical protein	NA	B6SD57	Bacteriophage	43.3	3.9e-44
WP_080945898.1|276659_277235_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_046699105.1|277326_277569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699106.1|278468_278681_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	49.1	4.2e-07
WP_046699107.1|278724_278919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699108.1|279036_279450_+	hypothetical protein	NA	A0A0R6PH16	Moraxella_phage	59.4	5.2e-38
WP_046699109.1|279449_280928_+	hypothetical protein	NA	A0A0R6PHB9	Moraxella_phage	77.6	1.7e-232
WP_080945899.1|280936_282331_+	DUF4055 domain-containing protein	NA	A0A1B1P9C6	Acinetobacter_phage	42.1	1.6e-78
WP_080945900.1|282479_284231_+|head	head morphogenesis protein	head	A0A0R6PHM5	Moraxella_phage	61.7	2.0e-203
WP_046699110.1|284386_285115_+	hypothetical protein	NA	A0A1B1P9C7	Acinetobacter_phage	36.4	3.8e-23
WP_046699111.1|285116_286064_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	59.6	1.4e-107
WP_080945901.1|286063_286360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699112.1|286377_286746_+	hypothetical protein	NA	A0A0R6PGY9	Moraxella_phage	51.4	1.2e-22
WP_046699113.1|286745_287102_+	hypothetical protein	NA	A0A0R6PH70	Moraxella_phage	59.0	3.3e-33
WP_080945902.1|287101_287440_+	hypothetical protein	NA	A0A0R6PHN4	Moraxella_phage	53.8	4.2e-25
WP_046699114.1|287445_287667_-	hypothetical protein	NA	A0A0P0IKW9	Acinetobacter_phage	66.0	1.9e-10
WP_046699115.1|288643_289033_+	hypothetical protein	NA	A0A0R6PK03	Moraxella_phage	48.1	3.0e-27
WP_046699116.1|289117_289630_+	hypothetical protein	NA	A0A2H4PAV0	Aphanizomenon_phage	37.9	1.3e-06
WP_046699117.1|289657_290572_+	hypothetical protein	NA	A0A0R6PJY2	Moraxella_phage	68.1	2.1e-116
WP_046699118.1|290781_291255_+	hypothetical protein	NA	A0A0R6PKF1	Moraxella_phage	43.2	2.9e-24
WP_046699436.1|291341_291530_+	hypothetical protein	NA	A0A0R6PJS2	Moraxella_phage	47.4	1.8e-06
WP_046699119.1|291850_292054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945904.1|292127_293129_+	hypothetical protein	NA	A0A0R6PHV6	Moraxella_phage	54.8	1.2e-56
WP_155400233.1|293148_293538_+	hypothetical protein	NA	A0A0M3LRY6	Mannheimia_phage	56.5	4.6e-20
WP_046699120.1|293574_293850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699121.1|293937_294156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945905.1|294136_294964_+	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	50.3	1.3e-40
WP_046699122.1|295008_295230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696013.1|295505_295997_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_046699123.1|295983_296340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945906.1|296451_297474_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	30.4	2.8e-32
WP_046699124.1|297530_300932_+	hypothetical protein	NA	A0A0R6PDG4	Moraxella_phage	35.8	3.4e-82
WP_046699439.1|300933_301266_+	hypothetical protein	NA	A0A0R6PHH7	Moraxella_phage	79.1	4.6e-45
WP_046699125.1|301343_301715_+	hypothetical protein	NA	A0A0R6PK02	Moraxella_phage	64.3	1.8e-37
WP_046699126.1|301758_302427_+|tail	phage minor tail protein L	tail	A0A0R6PJ72	Moraxella_phage	76.0	4.7e-97
WP_046696021.1|302423_303215_+	C40 family peptidase	NA	A0A0R6PIU2	Moraxella_phage	62.8	7.3e-97
WP_046696022.1|303211_303805_+|tail	tail assembly protein	tail	A0A0R6PIF0	Moraxella_phage	66.7	2.8e-69
WP_080945907.1|303801_309822_+	DUF1983 domain-containing protein	NA	A0A0R6PHL4	Moraxella_phage	33.2	3.6e-26
WP_046699127.1|309818_310178_+	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	47.5	4.3e-20
WP_046696024.1|310174_311230_+	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	39.0	2.1e-59
WP_046696436.1|311441_311810_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	45.5	1.4e-18
WP_046699128.1|311850_312483_+	N-acetylmuramidase family protein	NA	M4SQ91	Psychrobacter_phage	38.5	1.9e-26
WP_046699129.1|312627_314214_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	33.1	5.5e-11
WP_080946156.1|314363_314996_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.7	1.6e-30
>prophage 2
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	339527	389886	2363171	head,integrase,tail	Moraxella_phage(69.77%)	65	339339:339398	388389:388472
339339:339398	attL	TTGGTAAGGGAGAGGTCTCGAGTTCAATTCTCGATAAGAGCTCCATATGAAAACCCTTGA	NA	NA	NA	NA
WP_046699133.1|339527_340532_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	57.7	4.0e-108
WP_046699134.1|340552_340834_-	hypothetical protein	NA	A0A0R6PCX9	Moraxella_phage	64.5	1.6e-25
WP_080945911.1|340847_341807_-	hypothetical protein	NA	G0YVB3	Pseudomonas_phage	55.0	6.6e-84
WP_155400234.1|342045_342312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699135.1|342286_342523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699136.1|342512_342926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699091.1|342991_343195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400226.1|343178_343505_-	hypothetical protein	NA	B5AXA3	Iodobacteriophage	73.3	1.3e-36
WP_046699093.1|344139_344538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699137.1|344695_345397_-	hypothetical protein	NA	A0A0R6PD08	Moraxella_phage	38.3	2.7e-34
WP_046699138.1|345393_346023_-	hypothetical protein	NA	A0A0R6PHJ4	Moraxella_phage	79.3	2.1e-94
WP_046699139.1|346162_346663_-	siphovirus Gp157 family protein	NA	A0A0R6PHR8	Moraxella_phage	45.2	3.6e-33
WP_155400217.1|346659_346806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400180.1|346792_346948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400231.1|346944_347184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699095.1|347156_347501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945895.1|348287_348818_-	hypothetical protein	NA	A0A2H4JB10	uncultured_Caudovirales_phage	58.7	3.6e-07
WP_046699140.1|348819_349524_-	LexA family transcriptional regulator	NA	A0A0R6PJ00	Moraxella_phage	57.6	1.7e-65
WP_046699141.1|349675_349885_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046699098.1|349930_350410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945896.1|350406_351321_+	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	57.3	9.9e-21
WP_155400232.1|351280_351958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699100.1|351954_352320_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	39.3	3.6e-14
WP_046699101.1|352347_352626_+	hypothetical protein	NA	M4T3Q1	Psychrobacter_phage	52.5	3.8e-16
WP_046695994.1|352635_353157_+	hypothetical protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	64.1	5.4e-32
WP_080945897.1|353146_353614_+	hypothetical protein	NA	A0A0R6PCZ2	Moraxella_phage	44.2	2.6e-33
WP_046699142.1|353610_353799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699442.1|354028_354316_+	hypothetical protein	NA	S5MLS6	Pseudoalteromonas_phage	67.8	6.9e-29
WP_046699143.1|354312_355104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699144.1|355263_355764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695998.1|355948_356374_+	hypothetical protein	NA	A0A0R6PH16	Moraxella_phage	87.2	2.1e-66
WP_046699145.1|356373_357849_+	hypothetical protein	NA	A0A0R6PHB9	Moraxella_phage	84.3	1.0e-253
WP_046696000.1|357848_359279_+	DUF4055 domain-containing protein	NA	A0A0R6PHK8	Moraxella_phage	74.4	1.2e-203
WP_046696001.1|359229_360216_+|head	head morphogenesis protein	head	A0A0R6PHM5	Moraxella_phage	78.2	4.5e-144
WP_046699146.1|360264_360930_+	hypothetical protein	NA	A0A0R6PH19	Moraxella_phage	69.3	1.4e-45
WP_046699147.1|360933_361950_+	hypothetical protein	NA	A0A0R6PHI9	Moraxella_phage	87.9	1.7e-170
WP_046699148.1|361960_362164_+	hypothetical protein	NA	A0A0R6PCI4	Moraxella_phage	71.6	1.2e-19
WP_046696005.1|362218_362566_+	hypothetical protein	NA	A0A0R6PGY9	Moraxella_phage	53.8	3.6e-24
WP_046696006.1|362567_362942_+	hypothetical protein	NA	A0A0R6PHG4	Moraxella_phage	51.3	8.4e-27
WP_046696007.1|362922_363351_+	HK97 gp10 family phage protein	NA	A0A0R6PHN4	Moraxella_phage	48.6	4.6e-29
WP_046699149.1|363353_363743_+	hypothetical protein	NA	A0A0R6PK03	Moraxella_phage	55.0	8.7e-35
WP_046699116.1|363827_364340_+	hypothetical protein	NA	A0A2H4PAV0	Aphanizomenon_phage	37.9	1.3e-06
WP_046699117.1|364367_365282_+	hypothetical protein	NA	A0A0R6PJY2	Moraxella_phage	68.1	2.1e-116
WP_046696011.1|365519_365975_+	hypothetical protein	NA	A0A0R6PKF1	Moraxella_phage	35.8	1.8e-15
WP_080945912.1|366781_367567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945913.1|367859_368378_+	hypothetical protein	NA	A0A0R6PDR4	Moraxella_phage	75.2	3.0e-38
WP_046699150.1|368736_369228_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_046699123.1|369214_369571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945906.1|369682_370705_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	30.4	2.8e-32
WP_080945914.1|370746_374796_+	tape measure protein	NA	A0A220VZA0	Acinetobacter_phage	31.2	9.4e-55
WP_046699439.1|374797_375130_+	hypothetical protein	NA	A0A0R6PHH7	Moraxella_phage	79.1	4.6e-45
WP_046699125.1|375207_375579_+	hypothetical protein	NA	A0A0R6PK02	Moraxella_phage	64.3	1.8e-37
WP_046699126.1|375622_376291_+|tail	phage minor tail protein L	tail	A0A0R6PJ72	Moraxella_phage	76.0	4.7e-97
WP_046699152.1|376287_377103_+	C40 family peptidase	NA	A0A0R6PIU2	Moraxella_phage	63.2	9.9e-97
WP_046699153.1|377065_377263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696022.1|377665_378259_+|tail	tail assembly protein	tail	A0A0R6PIF0	Moraxella_phage	66.7	2.8e-69
WP_080945907.1|378255_384276_+	DUF1983 domain-containing protein	NA	A0A0R6PHL4	Moraxella_phage	33.2	3.6e-26
WP_046699127.1|384272_384632_+	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	47.5	4.3e-20
WP_046699154.1|384628_385684_+	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	39.4	1.9e-60
WP_046696436.1|385895_386264_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	45.5	1.4e-18
WP_080945915.1|386304_386844_+	DUF882 domain-containing protein	NA	A0A0R6PGV9	Moraxella_phage	62.1	1.7e-60
WP_046699155.1|386876_387068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699156.1|387190_387895_-	anti-CRISPR protein AcrVA4	NA	NA	NA	NA	NA
WP_046699157.1|387899_388178_-	anti-CRISPR N-acetyltransferase AcrVA5	NA	NA	NA	NA	NA
WP_046697128.1|388695_389886_+	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	29.1	2.5e-16
388389:388472	attR	TTGGTAAGGGAGAGGTCTCGAGTTCAATTCTCGATAAGAGCTCCATATGAAAACCCTTGAAACGCTTATGTTTCAAGGGTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	1061398	1070584	2363171		Acinetobacter_phage(42.86%)	10	NA	NA
WP_046696703.1|1061398_1062712_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	85.1	1.7e-191
WP_046696702.1|1062748_1063354_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	52.5	9.1e-39
WP_046696701.1|1063371_1063713_-	quaternary ammonium transporter	NA	NA	NA	NA	NA
WP_046696700.1|1063822_1064518_-	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	35.8	8.9e-30
WP_046696699.1|1064668_1065298_+	MarC family protein	NA	NA	NA	NA	NA
WP_046699212.1|1065366_1066203_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	49.6	5.1e-56
WP_046696697.1|1066232_1067315_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	53.2	5.7e-92
WP_046696696.1|1067347_1067971_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	69.5	2.4e-79
WP_080945990.1|1068146_1069661_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_046696695.1|1070092_1070584_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.2	3.1e-13
>prophage 4
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	1281218	1294023	2363171	capsid	Vibrio_phage(25.0%)	10	NA	NA
WP_046699236.1|1281218_1283726_-	hypothetical protein	NA	U5PW53	Acinetobacter_phage	23.6	8.4e-30
WP_046699237.1|1283790_1285464_-	hypothetical protein	NA	A0A2I7RAT8	Vibrio_phage	33.1	3.1e-12
WP_046699238.1|1285481_1285994_-	hypothetical protein	NA	A0A2I7R0J6	Vibrio_phage	40.0	1.8e-24
WP_046699239.1|1286066_1287224_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2P0PAU2	Pectobacterium_phage	56.6	6.5e-118
WP_046699240.1|1287242_1288367_-	hypothetical protein	NA	S4TT67	Salmonella_phage	38.5	1.6e-41
WP_046699241.1|1288359_1288662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699242.1|1288726_1291027_-	hypothetical protein	NA	A0A0A0YRN0	Escherichia_phage	47.7	1.0e-167
WP_046699243.1|1291023_1291668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699244.1|1291677_1293252_-	hypothetical protein	NA	A0A2P0PAT7	Pectobacterium_phage	62.0	2.6e-194
WP_046699245.1|1293339_1294023_-	hypothetical protein	NA	A0A0A0YUA7	Escherichia_phage	53.3	2.8e-60
>prophage 5
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	1300387	1335163	2363171	integrase	Moraxella_phage(20.83%)	39	1325507:1325524	1337201:1337218
WP_080946170.1|1300387_1301596_+	hypothetical protein	NA	A0A2P9J4X1	Pectobacterium_phage	37.3	5.2e-70
WP_046699254.1|1301795_1301996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699255.1|1301996_1302230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699256.1|1302226_1302721_+	hypothetical protein	NA	A0A0R6PGZ8	Moraxella_phage	33.1	6.3e-14
WP_046699257.1|1302722_1303718_+	hypothetical protein	NA	M4SLY4	Vibrio_phage	41.0	2.8e-69
WP_046699258.1|1303782_1303992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699260.1|1304362_1305475_+	hypothetical protein	NA	A0A2P0N9T7	Pectobacterium_phage	35.1	6.1e-57
WP_046699261.1|1305589_1306030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699456.1|1306026_1307649_+	hypothetical protein	NA	S4TTM6	Salmonella_phage	48.8	1.1e-131
WP_080946171.1|1307841_1308291_+	HNH endonuclease	NA	A0A0B5HDZ3	Vibrio_phage	50.3	2.0e-30
WP_046699263.1|1309448_1309670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946019.1|1309666_1310296_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	34.6	4.4e-12
WP_046699264.1|1310755_1311418_-	hypothetical protein	NA	D6QWP0	uncultured_phage	57.4	3.4e-47
WP_046699266.1|1311616_1312018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400203.1|1312111_1313146_-	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	34.8	1.5e-41
WP_046699268.1|1313142_1313493_-	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	43.6	4.8e-24
WP_155400202.1|1313489_1320215_-	hypothetical protein	NA	A0A0R6PD22	Moraxella_phage	87.7	8.6e-21
WP_046699270.1|1320362_1320587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699271.1|1320567_1320888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699272.1|1320887_1321199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699273.1|1321400_1321688_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046699459.1|1321808_1322135_+	hypothetical protein	NA	B5AXA3	Iodobacteriophage	69.5	9.5e-35
WP_155400241.1|1322199_1322475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155400201.1|1322522_1322912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699275.1|1322968_1323358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946172.1|1323353_1324262_+	hypothetical protein	NA	G0YVB3	Pseudomonas_phage	54.3	4.1e-83
WP_046699277.1|1324258_1324543_+	hypothetical protein	NA	I2GUJ4	Acinetobacter_phage	43.4	3.0e-08
WP_046699278.1|1324520_1325483_+	hypothetical protein	NA	A0A1X9I8L0	Pseudomonas_phage	48.6	1.3e-87
1325507:1325524	attL	ATTATGTTAAATAAATTA	NA	NA	NA	NA
WP_046699280.1|1325712_1325946_+	hypothetical protein	NA	A0A1J0GV14	Vibrio_phage	54.8	8.6e-14
WP_046699281.1|1326199_1326817_+	hypothetical protein	NA	A0A240EWM4	Vibrio_phage	51.4	3.1e-50
WP_046699282.1|1328982_1329705_+	AAA family ATPase	NA	M4SNJ2	Pseudoalteromonas_phage	61.1	1.1e-78
WP_046699283.1|1329685_1330192_+	HNH endonuclease	NA	A0A2P9J4Z6	Pectobacterium_phage	47.0	5.6e-34
WP_046699284.1|1330214_1330913_+	hypothetical protein	NA	A0A1L2C917	Pseudomonas_phage	43.3	4.0e-46
WP_046699285.1|1330922_1331138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699286.1|1331137_1331656_+	hypothetical protein	NA	U5PZY8	Acinetobacter_phage	44.4	5.2e-35
WP_046699287.1|1331636_1331939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699288.1|1331944_1333042_+	ribonucleotide-diphosphate reductase subunit beta	NA	M4M9S3	Vibrio_phage	70.6	5.5e-151
WP_046699289.1|1333042_1334026_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	44.7	1.5e-67
WP_046699290.1|1334083_1335163_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	2.3e-08
1337201:1337218	attR	ATTATGTTAAATAAATTA	NA	NA	NA	NA
>prophage 6
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	1514020	1522519	2363171	transposase	Moraxella_phage(62.5%)	11	NA	NA
WP_046696441.1|1514020_1514269_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	7.8e-13
WP_046696440.1|1514284_1514626_+	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_036362158.1|1514898_1515135_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003659281.1|1515177_1515333_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_046696439.1|1515398_1515857_+	hypothetical protein	NA	A0A0R6PHL4	Moraxella_phage	63.9	1.8e-15
WP_046696305.1|1515958_1518433_+	DUF1983 domain-containing protein	NA	A0A0R6PD22	Moraxella_phage	78.3	2.2e-62
WP_046696438.1|1518429_1518792_+	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	45.8	9.9e-25
WP_046696437.1|1518788_1519886_+	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	34.7	4.3e-47
WP_046696436.1|1520097_1520466_+	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	45.5	1.4e-18
WP_080946037.1|1520506_1521046_+	peptidase M15	NA	A0A0R6PID9	Moraxella_phage	59.9	1.0e-57
WP_046696435.1|1521346_1522519_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	36.5	3.8e-57
>prophage 7
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	1560012	1673069	2363171	head,integrase,tail,plate,capsid,terminase,protease,transposase,portal,tRNA	uncultured_Caudovirales_phage(14.81%)	126	1638183:1638200	1673224:1673241
WP_046697470.1|1560012_1561458_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_046696403.1|1561536_1561992_-	YchJ family protein	NA	NA	NA	NA	NA
WP_046697469.1|1561991_1564130_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_046696402.1|1564295_1564970_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_046696401.1|1565026_1565425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696400.1|1565670_1567422_+	L-lactate permease	NA	NA	NA	NA	NA
WP_046696398.1|1567788_1568997_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_046696397.1|1569068_1570898_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_036366277.1|1571068_1571341_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	59.6	1.5e-20
WP_046697468.1|1571855_1572479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046697467.1|1572734_1573247_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_046699309.1|1573243_1574467_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	29.4	5.7e-32
WP_036366269.1|1574574_1574958_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	80.6	1.3e-51
WP_046696395.1|1574983_1575304_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.0	2.8e-23
WP_046696394.1|1575313_1575835_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_046696393.1|1575948_1577817_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.0	5.4e-98
WP_046696392.1|1577854_1578193_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_155399994.1|1578237_1578885_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-24
WP_046696390.1|1578954_1579998_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	2.9e-77
WP_046696389.1|1580182_1581280_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_046696388.1|1581451_1582213_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_046696387.1|1582261_1582915_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_046696386.1|1583040_1583298_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_036366243.1|1583353_1583665_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_046696385.1|1583795_1584146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696384.1|1584145_1584661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080946041.1|1584736_1585912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699310.1|1585913_1586579_-	LemA family protein	NA	NA	NA	NA	NA
WP_046699311.1|1587001_1588510_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_046697465.1|1589004_1591062_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_036366232.1|1591185_1591311_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_046696381.1|1591326_1592466_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_046696380.1|1592468_1594073_-	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_046696379.1|1594238_1595237_-	porin	NA	NA	NA	NA	NA
WP_046699464.1|1595789_1596479_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_046696378.1|1596536_1597994_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_046696377.1|1598051_1598738_-	pirin family protein	NA	NA	NA	NA	NA
WP_046696376.1|1598903_1599299_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_046696375.1|1599329_1600034_-	LrgB family protein	NA	NA	NA	NA	NA
WP_046696374.1|1600037_1600463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399992.1|1600688_1601006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696372.1|1601083_1602475_-	GTPase HflX	NA	NA	NA	NA	NA
WP_046699312.1|1602552_1603419_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_046697463.1|1603421_1604459_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_046696370.1|1604924_1605335_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	3.3e-48
WP_046696369.1|1606878_1607298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080946042.1|1609183_1609384_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_046699313.1|1609491_1610187_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_046699314.1|1610084_1611578_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_155399991.1|1611633_1612236_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_046699315.1|1612501_1614352_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_046697462.1|1614488_1617266_+	lactoferrin/transferrin family TonB-dependent receptor	NA	NA	NA	NA	NA
WP_155400103.1|1617343_1617679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946043.1|1617819_1620126_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	44.5	2.1e-107
WP_155399990.1|1620169_1620310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946178.1|1620306_1620450_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_046696363.1|1620487_1620790_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_046696362.1|1620905_1621418_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	50.9	7.9e-44
WP_046696361.1|1621440_1622829_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.5	1.3e-96
WP_046696360.1|1622841_1623348_-	hypothetical protein	NA	A4JWK3	Burkholderia_virus	36.6	6.9e-24
WP_046696359.1|1623347_1623815_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	30.0	7.1e-07
WP_046696358.1|1623818_1624118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399989.1|1624128_1624512_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_046697459.1|1625363_1626449_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	36.4	2.5e-47
WP_080946046.1|1626698_1627040_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	42.5	4.4e-14
WP_046696356.1|1627060_1627534_-	regulatory protein GemA	NA	NA	NA	NA	NA
WP_046696355.1|1627600_1627876_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	53.3	4.4e-17
WP_046696354.1|1628440_1628686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696353.1|1628695_1628923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696352.1|1628949_1630089_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	55.1	1.6e-89
WP_155400102.1|1630098_1630857_-	hypothetical protein	NA	J9STP5	Pseudomonas_phage	34.7	4.2e-33
WP_080946048.1|1630819_1632085_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	40.4	4.2e-78
WP_080946049.1|1632081_1633305_+	hypothetical protein	NA	Q6QIB9	Burkholderia_phage	47.8	7.0e-46
WP_046699316.1|1633422_1633905_+	phage virion morphogenesis protein	NA	A0A0A1IUZ3	Pseudomonas_phage	29.7	1.9e-10
WP_046696350.1|1634180_1635542_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	23.7	5.8e-17
WP_080946050.1|1635751_1636462_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046696349.1|1636526_1637105_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_046699317.1|1637227_1638199_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1638183:1638200	attL	TCTTTAAAATCAATCATT	NA	NA	NA	NA
WP_046699318.1|1638372_1639521_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	40.9	1.4e-75
WP_080946051.1|1639531_1639798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400193.1|1639853_1640030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400192.1|1640026_1640188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080946052.1|1640177_1640591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699320.1|1640647_1641226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155400191.1|1641225_1641399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699321.1|1641656_1642571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699322.1|1642629_1643400_-	DUF1829 domain-containing protein	NA	NA	NA	NA	NA
WP_155400190.1|1643390_1643828_-	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	32.5	1.5e-06
WP_046699323.1|1643827_1644571_-	LexA family transcriptional regulator	NA	A0A0R6PJ00	Moraxella_phage	48.2	3.0e-52
WP_080946054.1|1644677_1644851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699324.1|1644847_1645096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699325.1|1645092_1645314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699326.1|1645366_1645720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946055.1|1645716_1646595_+	hypothetical protein	NA	A0A0P0HSN8	Acinetobacter_phage	59.2	1.2e-23
WP_046699327.1|1646668_1647184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946056.1|1647468_1648194_+	Bro-N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	50.0	2.3e-44
WP_046699328.1|1648219_1648477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946057.1|1648724_1648961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080946058.1|1649013_1650249_-	hypothetical protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	45.1	5.7e-80
WP_080946059.1|1650251_1650758_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	48.2	1.2e-31
WP_046699329.1|1650768_1654446_-|tail	phage tail tape measure protein	tail	A0A0R6PDG4	Moraxella_phage	33.6	5.9e-48
WP_080946060.1|1654671_1654863_-|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	53.7	7.1e-06
WP_080946061.1|1654793_1655084_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	29.3	1.3e-06
WP_046699330.1|1655322_1655838_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	62.9	4.5e-55
WP_046699331.1|1656073_1657240_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	71.5	1.4e-157
WP_046699332.1|1657402_1658047_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	54.6	7.9e-33
WP_046699333.1|1658043_1658379_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	46.3	4.9e-18
WP_046699334.1|1658387_1659281_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	49.7	7.1e-72
WP_080946062.1|1659277_1659823_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	37.1	2.4e-30
WP_080946063.1|1659819_1661367_+|tail	phage tail protein	tail	A0A2H4J194	uncultured_Caudovirales_phage	36.2	1.2e-26
WP_046699335.1|1661366_1661978_+	DUF4376 domain-containing protein	NA	A0A0R6PC75	Moraxella_phage	55.2	2.0e-49
WP_080946064.1|1662412_1662709_+	hypothetical protein	NA	A0A1B1P9F5	Acinetobacter_phage	44.6	1.3e-17
WP_080946065.1|1662705_1663038_+	hypothetical protein	NA	A0A0B5L5G5	Acinetobacter_phage	63.8	6.3e-18
WP_046699336.1|1663047_1663527_+	peptidase M15	NA	A0A0R6PGV9	Moraxella_phage	56.2	1.4e-39
WP_046699337.1|1663583_1664042_-	phage virion morphogenesis protein	NA	E5FFH6	Burkholderia_phage	35.1	2.4e-15
WP_046699338.1|1664038_1664569_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	54.8	2.1e-39
WP_046699339.1|1664565_1665363_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	47.1	2.4e-55
WP_046699340.1|1665364_1665568_-	LysM peptidoglycan-binding domain-containing protein	NA	A4PE33	Ralstonia_virus	47.7	2.3e-07
WP_046699341.1|1665564_1666014_-|head	head completion protein	head	Q9ZXM1	Pseudomonas_virus	35.8	4.0e-15
WP_046699342.1|1666126_1666813_-	hypothetical protein	NA	Q9ZXM2	Pseudomonas_virus	45.6	3.8e-41
WP_046699343.1|1666822_1667839_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	58.2	2.1e-104
WP_046699344.1|1667849_1668662_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	47.5	2.1e-54
WP_046699345.1|1668819_1670586_+|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	64.8	9.3e-225
WP_080946066.1|1670602_1671385_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	44.6	1.1e-31
WP_155400189.1|1671725_1671881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080946067.1|1672091_1673069_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	61.9	7.4e-115
1673224:1673241	attR	TCTTTAAAATCAATCATT	NA	NA	NA	NA
>prophage 8
NZ_CP011376	Moraxella bovoculi strain 22581, complete genome	2363171	2041029	2083490	2363171	head,integrase,capsid,portal,terminase,tail	Moraxella_phage(86.49%)	49	2060990:2061005	2092382:2092397
WP_046699373.1|2041029_2041662_-	N-acetylmuramidase family protein	NA	M4SQ91	Psychrobacter_phage	38.5	2.9e-27
WP_046696436.1|2041702_2042071_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	45.5	1.4e-18
WP_046696437.1|2042282_2043380_-	hypothetical protein	NA	A0A0R6PHT2	Moraxella_phage	34.7	4.3e-47
WP_046696438.1|2043376_2043739_-	hypothetical protein	NA	A0A0R6PHL5	Moraxella_phage	45.8	9.9e-25
WP_080946112.1|2043735_2049777_-	DUF1983 domain-containing protein	NA	A0A0R6PGJ9	Moraxella_phage	41.4	8.3e-31
WP_046699487.1|2049817_2050393_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	89.0	8.3e-74
WP_046699374.1|2050800_2050998_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	43.1	2.8e-05
WP_046699375.1|2050972_2051764_-	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	83.3	1.3e-130
WP_046696310.1|2051819_2052206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696311.1|2052205_2052979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699376.1|2053802_2054201_-	hypothetical protein	NA	A0A0R6PK02	Moraxella_phage	59.8	2.3e-38
WP_080946113.1|2054278_2054614_-|tail	phage tail protein	tail	A0A0R6PHZ9	Moraxella_phage	80.7	1.2e-51
WP_080946114.1|2054623_2058316_-	hypothetical protein	NA	A0A0R6PD92	Moraxella_phage	34.9	9.8e-144
WP_046699377.1|2058346_2058748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699378.1|2058792_2059110_-	DUF4035 domain-containing protein	NA	A0A0R6PHY9	Moraxella_phage	56.2	2.1e-23
WP_046699379.1|2059130_2059463_-	hypothetical protein	NA	A0A0R6PJ73	Moraxella_phage	38.1	1.0e-12
WP_046699380.1|2059498_2059927_-	hypothetical protein	NA	A0A0R6PKQ7	Moraxella_phage	73.8	6.6e-52
WP_046699381.1|2059930_2060299_-	DUF3168 domain-containing protein	NA	A0A0R6PKK8	Moraxella_phage	49.1	1.2e-25
WP_046699382.1|2060322_2060865_-	hypothetical protein	NA	A0A0R6PK38	Moraxella_phage	51.4	5.8e-45
WP_046699383.1|2060861_2061191_-|head	phage head closure protein	head	A0A0R6PCW7	Moraxella_phage	67.6	4.0e-33
2060990:2061005	attL	GATGGCGAATGGTGGC	NA	NA	NA	NA
WP_046699384.1|2061200_2061488_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0R6PHI1	Moraxella_phage	82.1	2.8e-38
WP_046699385.1|2061484_2062810_-|portal	phage portal protein	portal	A0A0R6PGT4	Moraxella_phage	82.2	2.0e-208
WP_046699386.1|2063084_2064440_-|capsid	phage major capsid protein	capsid	A0A0R6PCM7	Moraxella_phage	83.6	1.0e-207
WP_080946115.1|2064436_2065054_-	peptidase U35	NA	A0A0R6PGX0	Moraxella_phage	84.9	4.2e-92
WP_046696326.1|2065121_2065340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696327.1|2065336_2065753_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_080946116.1|2065797_2067420_-|terminase	terminase large subunit	terminase	A0A0R6PCM3	Moraxella_phage	88.3	2.5e-285
WP_046696329.1|2067514_2067874_-	DUF3310 domain-containing protein	NA	A0A0R6PC49	Moraxella_phage	69.6	3.4e-41
WP_046696330.1|2067857_2068037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046696331.1|2068033_2068477_-	hypothetical protein	NA	A0A0R6PGM4	Moraxella_phage	53.0	2.4e-36
WP_046696332.1|2068593_2068899_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	80.8	9.8e-42
WP_155399987.1|2068901_2069054_-	hypothetical protein	NA	A0A0R6PKL5	Moraxella_phage	60.0	1.4e-09
WP_046696333.1|2069257_2069680_-	hypothetical protein	NA	A0A0R6PGQ4	Moraxella_phage	69.3	1.4e-49
WP_046699388.1|2069999_2072666_-	hypothetical protein	NA	A0A0R6PCH4	Moraxella_phage	81.7	0.0e+00
WP_046699389.1|2072658_2073399_-	phage antirepressor protein	NA	A0A0R6PGU3	Moraxella_phage	85.8	2.7e-117
WP_046699390.1|2073479_2073689_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHU4	Moraxella_phage	55.2	2.4e-15
WP_080946117.1|2073828_2074482_+	LexA family transcriptional regulator	NA	A0A0R6PHW4	Moraxella_phage	70.5	7.2e-90
WP_046699391.1|2074490_2074835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046699392.1|2074995_2075307_-	hypothetical protein	NA	A0A0R6PGK1	Moraxella_phage	89.1	1.0e-46
WP_046699492.1|2075702_2076041_+	hypothetical protein	NA	A0A0R6PH37	Moraxella_phage	86.4	2.1e-24
WP_046696341.1|2076031_2076322_+	hypothetical protein	NA	A0A0R6PGT5	Moraxella_phage	57.1	4.8e-22
WP_046696342.1|2076321_2076546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046696343.1|2076569_2076908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080946118.1|2076919_2077750_+	DUF2303 family protein	NA	K7ZMK3	Xanthomonas_citri_phage	31.5	2.6e-20
WP_046699393.1|2077803_2078028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046699394.1|2078024_2079239_-|integrase	integrase family protein	integrase	A0A0R6PIF4	Moraxella_phage	48.4	1.1e-102
WP_080946119.1|2079622_2080525_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_080946120.1|2080521_2080728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046699395.1|2080853_2083490_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	35.0	1.2e-95
2092382:2092397	attR	GATGGCGAATGGTGGC	NA	NA	NA	NA
