The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	1152696	1158500	4844415		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1152696_1155030_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1155044_1155365_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1155361_1155589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1155585_1156137_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1156133_1156400_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|1156937_1157675_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|1157671_1157917_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1157933_1158500_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	1297677	1369072	4844415	tRNA,protease,tail,head,holin,terminase,capsid,integrase	Salmonella_phage(89.8%)	63	1284079:1284095	1352328:1352344
1284079:1284095	attL	TCATCAGCCTGAGCGTT	NA	NA	NA	NA
WP_000003211.1|1297677_1298844_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090890.1|1299135_1300140_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000551804.1|1300166_1301285_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107146.1|1301395_1302670_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000409190.1|1302683_1303304_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177072.1|1303314_1304493_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000249411.1|1304609_1306082_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_023243526.1|1306170_1306392_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_023231848.1|1306737_1308930_+	intimin-like inverse autotransporter SinH	NA	NA	NA	NA	NA
WP_023243525.1|1308987_1309953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071925156.1|1310072_1315673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243961.1|1315831_1316059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071881979.1|1316708_1322870_+	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	25.9	1.1e-25
WP_023243645.1|1323031_1324381_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	2.6e-41
WP_023243644.1|1324541_1326008_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
WP_046722502.1|1326077_1327655_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_023972305.1|1327847_1329098_+|integrase	tyrosine-type recombinase/integrase	integrase	Q858E8	Salmonella_phage	99.8	5.5e-240
WP_015971063.1|1329558_1330137_-	adenine methylase	NA	Q858E6	Salmonella_phage	100.0	3.7e-114
WP_015971065.1|1330283_1330583_-	PerC family transcriptional regulator	NA	Q858E4	Salmonella_phage	100.0	1.4e-48
WP_015971066.1|1330692_1330941_-	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	100.0	4.0e-41
WP_023972301.1|1330989_1332012_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	100.0	4.0e-188
WP_015971068.1|1332021_1332921_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	100.0	2.5e-170
WP_015971069.1|1332917_1333220_-	hypothetical protein	NA	Q858D9	Salmonella_phage	100.0	3.5e-47
WP_000291789.1|1333224_1333407_-	hypothetical protein	NA	T1SA20	Salmonella_phage	100.0	8.5e-25
WP_015971071.1|1333598_1334195_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	100.0	2.0e-107
WP_003037808.1|1334350_1334584_+	hypothetical protein	NA	Q858D6	Salmonella_phage	100.0	5.4e-40
WP_015971074.1|1334928_1336098_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	100.0	4.0e-232
WP_015971076.1|1336900_1337365_+	crossover junction endodeoxyribonuclease RuvC	NA	Q858D2	Salmonella_phage	100.0	1.5e-81
WP_115288255.1|1337700_1338117_+	ead/Ea22-like family protein	NA	Q858D1	Salmonella_phage	99.3	6.2e-71
WP_015971078.1|1338113_1338947_+	ead/Ea22-like family protein	NA	Q858D0	Salmonella_phage	100.0	2.9e-152
WP_015995294.1|1338948_1339167_+	DUF4014 family protein	NA	B9UDM3	Salmonella_phage	100.0	4.9e-35
WP_015971080.1|1339170_1339926_+	DUF551 domain-containing protein	NA	Q858C8	Salmonella_phage	100.0	2.1e-125
WP_015971081.1|1339925_1340198_+	hypothetical protein	NA	Q858C7	Salmonella_phage	100.0	2.4e-39
WP_015971082.1|1340190_1340529_+	hypothetical protein	NA	Q858C6	Salmonella_phage	100.0	3.4e-59
WP_164498438.1|1340551_1341229_+|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	100.0	8.2e-105
WP_015971037.1|1341225_1342701_+	hypothetical protein	NA	Q858H3	Salmonella_phage	100.0	5.2e-298
WP_015971083.1|1342766_1343132_-	hypothetical protein	NA	A0AR14	Salmonella_phage	100.0	1.1e-63
WP_000334867.1|1343622_1343829_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_023231192.1|1343843_1345514_+|head,tail	phage head-tail connector protein	head,tail	T1S9Z7	Salmonella_phage	98.7	0.0e+00
WP_023231193.1|1345510_1345807_+	hypothetical protein	NA	Q858H0	Salmonella_phage	100.0	1.6e-49
WP_023231194.1|1345809_1346526_+|protease	endoprotease	protease	Q858G9	Salmonella_phage	100.0	3.8e-92
WP_015971041.1|1346536_1347544_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	100.0	2.6e-192
WP_015971042.1|1347556_1347949_+	hypothetical protein	NA	T1SA71	Salmonella_phage	100.0	3.2e-61
WP_015971043.1|1347941_1348226_+	hypothetical protein	NA	Q858G6	Salmonella_phage	100.0	1.9e-47
WP_015971044.1|1348290_1348626_+	hypothetical protein	NA	Q858G5	Salmonella_phage	100.0	1.8e-57
WP_023231195.1|1348625_1349231_+	hypothetical protein	NA	Q858G4	Salmonella_phage	100.0	8.1e-112
WP_015971046.1|1349230_1351708_+	hypothetical protein	NA	Q858G3	Salmonella_phage	100.0	0.0e+00
WP_023972415.1|1351707_1352172_+	hypothetical protein	NA	Q858G2	Salmonella_phage	100.0	1.5e-86
WP_015971048.1|1352171_1352714_+	hypothetical protein	NA	Q858G1	Salmonella_phage	100.0	7.3e-72
1352328:1352344	attR	AACGCTCAGGCTGATGA	NA	NA	NA	NA
WP_015971049.1|1352726_1355255_+	minor structural protein	NA	Q858G0	Salmonella_phage	100.0	0.0e+00
WP_015971050.1|1355254_1357159_+	hypothetical protein	NA	Q858F9	Salmonella_phage	100.0	0.0e+00
WP_046722501.1|1357158_1359915_+	hypothetical protein	NA	Q858F8	Salmonella_phage	99.9	0.0e+00
WP_015971052.1|1359911_1360106_+	hypothetical protein	NA	Q858F7	Salmonella_phage	100.0	5.3e-25
WP_015971053.1|1360144_1360405_-	hypothetical protein	NA	Q858F6	Salmonella_phage	100.0	1.3e-42
WP_015971054.1|1360602_1363815_+	right-handed parallel beta-helix repeat-containing protein	NA	G9L6E4	Escherichia_phage	78.3	2.1e-97
WP_023231203.1|1363856_1365035_-	O-antigen ligase family protein	NA	Q858F4	Salmonella_phage	100.0	9.6e-202
WP_015971056.1|1365047_1365248_-	hypothetical protein	NA	Q858F3	Salmonella_phage	100.0	3.8e-26
WP_001275998.1|1365409_1365814_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_015971058.1|1365800_1366109_+|holin	phage holin family protein	holin	Q858F1	Salmonella_phage	100.0	2.0e-50
WP_015971059.1|1366098_1366728_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	100.0	1.1e-119
WP_015971060.1|1366724_1367207_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	100.0	1.0e-77
WP_023244201.1|1367864_1368194_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000075924.1|1368880_1369072_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 3
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	1720705	1729876	4844415	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1720705_1721653_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1721636_1722368_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_046722494.1|1722348_1722456_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1722515_1723247_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1723469_1725155_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1725151_1725871_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1725917_1726385_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1726441_1726972_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1727143_1727602_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1727842_1729876_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	1797968	1804265	4844415		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1797968_1799372_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1799549_1800443_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1800819_1801905_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1801904_1802804_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1802851_1803730_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1803734_1804265_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	1914555	1921804	4844415		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|1914555_1914975_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1914977_1916246_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1916700_1916913_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1916923_1917112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1917371_1918565_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1919213_1919525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1919604_1920300_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1920373_1921804_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	1990995	2128051	4844415	tRNA,head,tail,holin,plate,lysis,terminase,capsid,portal,integrase	Salmonella_phage(22.61%)	167	2075927:2075949	2134621:2134643
WP_023244247.1|1990995_1992729_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.2	4.9e-85
WP_000024796.1|1992965_1993535_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185769.1|1993554_1994301_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000569035.1|1994536_1995508_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019614.1|1995504_1996248_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	3.2e-25
WP_000252975.1|1996288_1996684_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_045888880.1|1996736_1997510_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	5.5e-57
WP_006669545.1|1997488_1998802_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	87.4	2.3e-228
WP_006669544.1|1998860_1999097_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	93.6	4.2e-40
WP_006669542.1|1999135_1999705_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	83.1	4.3e-91
WP_046722482.1|1999708_2000227_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	58.0	5.6e-45
WP_046722481.1|2001557_2002097_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	73.5	2.7e-66
WP_046722480.1|2002167_2002707_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	1.0e-97
WP_046722479.1|2002843_2003671_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.2	3.0e-149
WP_000997190.1|2003728_2004100_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001749159.1|2004880_2005555_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.9	1.7e-115
WP_046722478.1|2005643_2005844_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	80.0	1.6e-21
WP_000509733.1|2005887_2006442_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	2.0e-101
WP_071925159.1|2006605_2006785_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.1	9.2e-16
WP_046722476.1|2006774_2007719_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	86.0	2.3e-129
WP_046722475.1|2007720_2008203_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	6.7e-85
WP_046722474.1|2008202_2009081_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	87.7	2.7e-148
WP_046722473.1|2009073_2011008_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.8	1.0e-200
WP_046722472.1|2011004_2011394_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	98.4	7.1e-69
WP_046722471.1|2011410_2012271_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	3.5e-161
WP_006762306.1|2012278_2013268_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.2e-190
WP_023195405.1|2013282_2013861_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	3.2e-49
WP_001539755.1|2014085_2014505_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	75.5	6.0e-58
WP_001803642.1|2015005_2015395_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	1.8e-40
WP_000226306.1|2015381_2015663_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_023195402.1|2015662_2016277_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	1.6e-107
WP_000636436.1|2016273_2016816_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_046722470.1|2016918_2017422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023223569.1|2017444_2017636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|2017680_2018226_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_046722469.1|2018197_2020129_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	6.3e-259
WP_046722468.1|2020112_2020316_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	70.8	4.7e-16
WP_000831820.1|2020312_2021893_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_046722467.1|2021882_2023379_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	1.3e-97
WP_000011260.1|2023391_2023739_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_046722466.1|2023793_2024822_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000201485.1|2024879_2025245_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083293.1|2025255_2025633_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000677089.1|2025619_2026198_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000033885.1|2026194_2026596_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|2026603_2027350_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_046722465.1|2027400_2027796_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	55.7	1.7e-30
WP_077906431.1|2027792_2028131_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.0e-31
WP_046722464.1|2028102_2031144_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	63.9	2.3e-287
WP_000447370.1|2031146_2031476_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_023187580.1|2031485_2032184_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	9.3e-104
WP_000662740.1|2032190_2032928_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_006669493.1|2032825_2033473_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.6	7.1e-90
WP_046722463.1|2033535_2036898_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.1	0.0e+00
WP_046722462.1|2036936_2037179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078097278.1|2037234_2039871_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6K1H2	Salmonella_virus	62.4	1.5e-130
WP_078097282.1|2039951_2040407_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	73.0	2.9e-58
WP_046722460.1|2040410_2040929_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.5e-47
WP_046722459.1|2040943_2042212_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	62.6	4.4e-136
WP_046722540.1|2042240_2042810_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.6	1.2e-85
WP_023223471.1|2042967_2043387_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023223470.1|2043389_2044658_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	94.1	1.2e-234
WP_023223469.1|2044742_2045174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023223468.1|2045199_2045871_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	3.4e-79
WP_023243953.1|2046193_2046760_-	hydrolase	NA	NA	NA	NA	NA
WP_001258633.1|2047084_2048857_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000653693.1|2048950_2049403_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907242.1|2049432_2050173_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000022509.1|2050209_2050731_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_000716750.1|2050732_2051332_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001597478.1|2052000_2052897_-	DUF4034 domain-containing protein	NA	NA	NA	NA	NA
WP_000580335.1|2053316_2053928_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568504.1|2053936_2054947_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
WP_000571508.1|2055025_2055811_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203023.1|2055807_2056563_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
WP_000939597.1|2056641_2057586_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184032.1|2057601_2058921_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_000448401.1|2059037_2060009_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091156.1|2060081_2061524_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056720.1|2061647_2062517_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301704.1|2062858_2064334_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	5.8e-79
WP_001069124.1|2064568_2066380_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_023243915.1|2066417_2067059_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173429.1|2067158_2068337_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257723.1|2068467_2068758_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_023243914.1|2068825_2069179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243913.1|2069272_2069932_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936990.1|2070145_2072197_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944282.1|2072231_2072930_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000100257.1|2072953_2073610_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000856224.1|2073717_2073948_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2074085_2074460_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2074460_2075336_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2075352_2075706_+	YebY family protein	NA	NA	NA	NA	NA
2075927:2075949	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_046722458.1|2076079_2077159_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.2	1.2e-105
WP_031603794.1|2077139_2077412_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.8e-10
WP_046722457.1|2077472_2077901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046722456.1|2077897_2079979_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.5	8.7e-198
WP_001524382.1|2079975_2080233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276802.1|2080326_2080506_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_023220247.1|2081155_2081488_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	80.3	4.4e-19
WP_001033921.1|2081480_2081801_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_023220248.1|2081836_2082667_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_046722455.1|2082659_2085350_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	3.7e-116
WP_000799629.1|2085490_2085826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2085901_2086108_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|2086112_2086388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|2086648_2086828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165607.1|2087271_2087697_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
WP_001033909.1|2087794_2088049_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_046722454.1|2088035_2088530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722453.1|2088577_2089585_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	70.2	3.2e-129
WP_176206730.1|2089496_2090039_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.2	2.9e-68
WP_000089421.1|2090051_2090447_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
WP_023892812.1|2090443_2090716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|2090919_2091075_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000911590.1|2091325_2091574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742730.1|2091637_2092237_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_021000145.1|2092233_2092428_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_000861020.1|2092424_2092706_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_042847930.1|2092702_2093257_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
WP_023220365.1|2093502_2093679_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
WP_001270289.1|2093729_2094137_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.0	1.4e-38
WP_001525456.1|2094286_2094589_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001525444.1|2094566_2095106_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	70.6	1.3e-76
WP_046722451.1|2095206_2095677_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	79.2	2.9e-61
WP_046722450.1|2095750_2095954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046722449.1|2096033_2096426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133177249.1|2096466_2096817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046722447.1|2097145_2097346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722446.1|2097349_2097979_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	1.5e-108
WP_046722445.1|2097981_2099601_+	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.0	1.3e-260
WP_046722444.1|2099600_2101121_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.9	3.3e-106
WP_001525462.1|2101161_2101851_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	4.5e-58
WP_023220053.1|2101847_2103194_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.2	4.2e-68
WP_046722443.1|2103195_2103678_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
WP_001031913.1|2103677_2104706_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_046722442.1|2104709_2105057_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	36.3	9.6e-09
WP_000537613.1|2105063_2105519_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	46.0	9.6e-17
WP_001525439.1|2105512_2106097_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	7.2e-17
WP_001048640.1|2106093_2106459_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.0e-20
WP_001525438.1|2106443_2106989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525460.1|2106969_2108454_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.4	4.7e-89
WP_000016414.1|2108454_2108901_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|2108900_2109305_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228830.1|2109346_2109529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722441.1|2109512_2111684_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.1e-49
WP_023219641.1|2111680_2112391_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_001525448.1|2112390_2112693_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_001525442.1|2112689_2113559_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	33.1	4.1e-32
WP_023219640.1|2113539_2114217_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	4.1e-32
WP_001191865.1|2114229_2114586_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_023219639.1|2114582_2115824_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
WP_022742713.1|2115825_2116428_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_046722440.1|2116417_2117878_+|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	75.8	2.1e-44
WP_046722439.1|2117874_2118699_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	91.2	6.8e-146
WP_001525039.1|2118688_2119258_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.7	1.1e-89
WP_046722438.1|2119408_2120263_+	protein YibB	NA	NA	NA	NA	NA
WP_046722437.1|2120335_2121877_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_020438172.1|2122648_2123728_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2123724_2124831_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2124861_2125092_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2125145_2125679_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2125935_2126103_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2126167_2126356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2126410_2126902_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2127454_2128051_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2134621:2134643	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	2915508	3009644	4844415	tRNA,protease,head,tail,holin,terminase,capsid,portal	Salmonella_phage(58.06%)	102	NA	NA
WP_000938188.1|2915508_2916189_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000374046.1|2916863_2917523_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2917609_2917939_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023243627.1|2917935_2918217_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548091.1|2918265_2919045_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2919070_2919619_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2919833_2921045_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2921102_2921420_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2921464_2921878_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2922051_2922714_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2922808_2923267_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_024155604.1|2923302_2925357_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_023243628.1|2925480_2925927_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950869.1|2925945_2928099_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2928085_2928691_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2928907_2929417_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2929773_2930826_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2930897_2931350_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_023242978.1|2931535_2933296_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2933364_2933883_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2933982_2934150_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2934405_2934969_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2934965_2936606_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2936610_2937864_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2937878_2939786_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086481.1|2939798_2941907_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224073.1|2942005_2943115_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2943111_2943654_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2943819_2944830_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023242979.1|2945037_2947650_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497440.1|2948076_2948283_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_000776343.1|2948975_2950178_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	100.0	6.3e-209
WP_001805559.1|2950392_2950551_+	DinI-like family protein	NA	S4TND2	Salmonella_phage	100.0	5.8e-22
WP_023137449.1|2950619_2951750_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	100.0	4.4e-204
WP_001113925.1|2951760_2952720_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_001110473.1|2952728_2955449_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_000682267.1|2955448_2955847_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_000967282.1|2955853_2956438_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_010835817.1|2956437_2957031_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.5	1.9e-110
WP_000064923.1|2957196_2957409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171561.1|2957447_2957759_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	80.2	1.7e-36
WP_023137450.1|2957804_2961119_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	99.9	0.0e+00
WP_000404385.1|2961165_2961501_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
WP_024134502.1|2961557_2961836_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_001129939.1|2961859_2962231_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
WP_046722419.1|2962258_2962963_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	73.9	2.2e-92
WP_001648721.1|2963019_2963367_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
WP_010835820.1|2963363_2963813_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
WP_020898872.1|2963809_2964148_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_001648719.1|2964157_2964484_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_001648718.1|2964483_2964681_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	4.9e-10
WP_001648716.1|2964724_2965942_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	89.6	5.8e-202
WP_000039020.1|2965951_2966800_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.7e-131
WP_000002707.1|2966813_2968118_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.9	6.2e-218
WP_023194832.1|2968117_2969860_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	9.7e-142
WP_000919036.1|2969813_2970278_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	7.4e-49
WP_023137451.1|2970410_2970755_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
WP_000495546.1|2970822_2971200_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	66.1	1.2e-41
WP_001050802.1|2971242_2971782_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.6	3.7e-07
WP_001075994.1|2971778_2972393_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.6	2.2e-109
WP_000226307.1|2972392_2972674_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294874.1|2972660_2973050_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000658039.1|2973139_2973328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001648707.1|2973832_2974630_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	99.6	2.0e-150
WP_001648706.1|2974619_2974766_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	1.5e-19
WP_023136402.1|2974762_2975404_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	99.5	1.3e-115
WP_023136401.1|2975406_2975613_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	100.0	7.8e-35
WP_023136400.1|2975612_2976212_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	97.5	2.0e-107
WP_001217668.1|2976617_2976851_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	4.7e-36
WP_000062345.1|2977180_2978326_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	32.7	2.7e-44
WP_023137432.1|2978322_2978937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001648689.1|2979416_2979701_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	46.5	2.3e-16
WP_000208078.1|2979697_2980123_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	84.6	3.0e-65
WP_046722418.1|2980133_2980889_-	hypothetical protein	NA	H6WRY1	Salmonella_phage	98.8	1.3e-148
WP_023136498.1|2981025_2981718_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	58.9	5.6e-77
WP_020843826.1|2981714_2982620_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.3	4.5e-175
WP_001648682.1|2982711_2983035_-	bacteriophage CII	NA	H6WRX6	Salmonella_phage	59.1	7.2e-27
WP_001555460.1|2983069_2983297_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2983402_2983837_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000186242.1|2984021_2984222_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995352.1|2984312_2984609_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_001648679.1|2984614_2985400_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.2	1.4e-148
WP_001648676.1|2985396_2986077_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.3	1.3e-129
WP_001648675.1|2986073_2986943_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	95.2	1.3e-158
WP_023137216.1|2986948_2987188_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	2.8e-36
WP_000065276.1|2987228_2987477_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2987521_2988814_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191404.1|2989008_2990211_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023243872.1|2990291_2991725_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023243871.1|2991970_2993185_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_046722417.1|2993502_2993964_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023243869.1|2994164_2995565_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.6	1.3e-80
WP_153274566.1|2995729_2995888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977709.1|2996171_2997263_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|2997447_2998638_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2998699_2999347_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2999374_2999923_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925888.1|3000182_3002030_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572733.1|3002374_3006841_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|3006840_3007545_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3007525_3008848_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|3008840_3009644_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	3081200	3090282	4844415	protease,integrase	Ralstonia_phage(16.67%)	8	3079593:3079605	3098778:3098790
3079593:3079605	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|3081200_3082442_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|3082969_3083347_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|3083508_3083706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3083918_3086195_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3086225_3086546_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3086869_3087091_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3087220_3089167_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|3089163_3090282_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3098778:3098790	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	3444171	3488906	4844415	coat,head,protease,holin,lysis,portal,integrase	Salmonella_phage(61.54%)	67	3446055:3446072	3494308:3494325
WP_023243093.1|3444171_3445497_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.8e-103
WP_023243092.1|3445712_3446567_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3446055:3446072	attL	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
WP_046722403.1|3447291_3448344_+	acyltransferase	NA	A9YX16	Burkholderia_phage	28.8	1.2e-25
WP_046722402.1|3448353_3450183_-|head	phage head-binding domain-containing protein	head	Q0H8C6	Salmonella_phage	67.1	1.5e-241
WP_046722401.1|3450283_3451186_-	antirepressor	NA	Q0H8C7	Salmonella_phage	92.0	8.2e-161
WP_001161120.1|3451254_3451416_-	Arc family DNA-binding protein	NA	B9UDL5	Salmonella_phage	94.3	3.8e-21
WP_099554642.1|3451542_3451752_+	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	100.0	1.2e-30
WP_000437781.1|3451754_3451988_+	hypothetical protein	NA	I6S5X8	Salmonella_phage	100.0	1.7e-38
WP_016049822.1|3451984_3452194_+	hypothetical protein	NA	I6R975	Salmonella_phage	100.0	3.5e-30
WP_000151196.1|3452168_3452354_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_022630937.1|3452379_3452679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040079452.1|3452724_3454893_-	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	28.8	8.6e-47
WP_046722400.1|3454877_3456227_-	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	50.4	2.3e-111
WP_046722399.1|3456236_3456911_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	68.1	5.5e-53
WP_000403515.1|3456885_3457365_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	73.4	8.4e-64
WP_046722398.1|3457364_3458213_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	99.6	1.1e-103
WP_046722397.1|3458212_3459631_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	99.4	1.4e-276
WP_001166098.1|3459590_3460091_-	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_000684729.1|3460074_3460284_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_046722396.1|3460322_3461615_-|coat	coat protein	coat	I1TEI8	Salmonella_phage	99.5	1.6e-242
WP_000433852.1|3461614_3462526_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_046722395.1|3462539_3464717_-|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.2	0.0e+00
WP_046722394.1|3464716_3466165_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	71.3	2.7e-206
WP_045718261.1|3466133_3466637_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	47.8	7.3e-26
WP_046722393.1|3466649_3467054_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	2.0e-66
WP_046722392.1|3467053_3467443_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	98.4	4.3e-74
WP_000808099.1|3467446_3467689_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_046722391.1|3468039_3468528_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	96.9	3.4e-84
WP_010835562.1|3468736_3469204_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	88.4	1.4e-68
WP_024157166.1|3469292_3469790_-	lysozyme	NA	I6S1V9	Salmonella_phage	98.2	7.1e-90
WP_024157167.1|3469767_3469971_-|holin	phage holin family protein	holin	O80287	Bacteriophage	97.0	1.2e-32
WP_024157168.1|3470507_3471281_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	98.4	9.9e-131
WP_023994514.1|3471277_3471457_-	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	96.6	1.3e-22
WP_071925160.1|3471437_3471641_-	phage NinH family protein	NA	Q5G8R8	Enterobacteria_phage	94.0	8.8e-31
WP_046722390.1|3471637_3472246_-	recombination protein NinG	NA	I6S604	Salmonella_phage	96.0	3.4e-94
WP_071925161.1|3472220_3472400_-	NinF family protein	NA	I6R994	Salmonella_phage	94.9	4.0e-27
WP_000113771.1|3472396_3472579_-	NinE family protein	NA	Q716C5	Shigella_phage	98.3	4.8e-28
WP_071925162.1|3472545_3472719_-	protein ninD	NA	C6ZR56	Salmonella_phage	98.2	7.5e-31
WP_046722389.1|3472715_3473153_-	recombination protein NinB	NA	C6ZR55	Salmonella_phage	99.3	3.8e-79
WP_001064628.1|3473226_3473505_-	hypothetical protein	NA	C6ZR54	Salmonella_phage	100.0	5.2e-50
WP_015995304.1|3473505_3475386_-	toprim domain-containing protein	NA	B9UDH8	Salmonella_phage	100.0	0.0e+00
WP_015995303.1|3475496_3476345_-	replication protein	NA	C6ZR51	Salmonella_phage	100.0	2.2e-155
WP_000166968.1|3476331_3476493_-	hypothetical protein	NA	I6R9C7	Salmonella_phage	100.0	1.0e-21
WP_000424138.1|3476513_3476804_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_001059982.1|3476937_3477147_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_001104735.1|3477256_3477910_+	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	100.0	4.6e-129
WP_000968836.1|3477909_3478380_+	hypothetical protein	NA	B9UDH1	Salmonella_phage	100.0	3.6e-83
WP_000097748.1|3478366_3478678_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	100.0	9.7e-45
WP_000834165.1|3478814_3479018_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	100.0	9.1e-28
WP_046722388.1|3479349_3479739_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	85.6	2.5e-37
WP_000213981.1|3479817_3480012_+	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_046722387.1|3480095_3480809_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	78.4	1.2e-77
WP_000776963.1|3480960_3481275_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3481359_3481518_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3481498_3481687_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_046722386.1|3481676_3481820_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	2.1e-18
WP_046722385.1|3481816_3482524_+	recombinase	NA	I6R0N0	Salmonella_phage	99.1	1.3e-137
WP_046722384.1|3482524_3483031_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	6.5e-91
WP_001016182.1|3483039_3483588_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_046722383.1|3483603_3483897_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	96.9	8.0e-49
WP_071925164.1|3483907_3484078_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	98.2	7.9e-25
WP_046722382.1|3484074_3484659_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	63.9	2.2e-53
WP_046722381.1|3484655_3485300_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.6	3.7e-131
WP_071925165.1|3485296_3486202_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	86.3	1.2e-135
WP_015995294.1|3486203_3486422_+	DUF4014 family protein	NA	B9UDM3	Salmonella_phage	100.0	4.9e-35
WP_015971081.1|3487180_3487453_+	hypothetical protein	NA	Q858C7	Salmonella_phage	100.0	2.4e-39
WP_046722380.1|3487742_3488906_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.4	3.9e-224
3494308:3494325	attR	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
>prophage 10
NZ_CP007584	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 isolate SAN2113-2 chromosome, complete genome	4844415	4476430	4521208	4844415	tRNA,holin,tail,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4476430_4477429_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4477516_4478827_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4479073_4479589_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4479688_4479898_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4479919_4480033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4480029_4481355_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4481533_4482142_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4482250_4482619_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4482789_4485210_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4485308_4486181_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4486194_4486692_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4486872_4487790_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_046722532.1|4487953_4489312_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4489400_4490510_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4490871_4492062_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4492193_4493738_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4493752_4494643_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4494808_4495219_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4495361_4497458_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4497457_4498195_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4498191_4498860_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4498893_4499136_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4499579_4501229_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4501573_4502923_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4503053_4503401_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4503976_4504264_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4504266_4504872_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4504884_4505199_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4505358_4505814_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_023242908.1|4505810_4506008_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4505997_4507425_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4507424_4507949_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4508000_4508318_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4508277_4508406_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4508502_4510857_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4510856_4511810_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4511809_4512019_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4512006_4513050_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4513059_4513782_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4514109_4514472_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4514468_4515398_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4515397_4516945_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4517108_4517468_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4517458_4518574_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4518566_4519199_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4519201_4520683_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4520692_4521208_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 1
NZ_CP014707	Salmonella enterica subsp. enterica serovar Anatum strain USMARC-1735 plasmid pSAN1-1735, complete sequence	101118	0	100917	101118	terminase,portal,integrase,tail	Salmonella_phage(92.16%)	113	13833:13848	24697:24712
WP_176547638.1|0_1218_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.6	2.2e-76
WP_063592800.1|1781_1994_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	85.7	5.1e-29
WP_063592801.1|1993_2329_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.9	1.2e-51
WP_063592802.1|2325_2505_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	91.5	3.1e-19
WP_063592803.1|2545_2821_-	hypothetical protein	NA	J9Q738	Salmonella_phage	93.4	1.9e-44
WP_063592804.1|2888_3299_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	95.6	5.9e-74
WP_023221824.1|3282_3654_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	8.8e-61
WP_063592805.1|3650_4385_-	hypothetical protein	NA	G4KK93	Yersinia_phage	30.8	5.0e-23
WP_063592806.1|4460_5285_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.8	2.7e-17
WP_046594026.1|5380_6211_-	SPFH domain-containing protein	NA	J9Q7Z4	Salmonella_phage	95.7	1.3e-123
WP_063592899.1|6210_6414_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	67.7	4.9e-13
WP_063592808.1|7581_7848_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	94.3	1.2e-38
WP_063592809.1|7847_8792_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.9	3.0e-174
WP_063592810.1|8852_9890_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	93.6	1.6e-155
WP_063592811.1|10007_10439_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	2.8e-66
WP_063592812.1|10575_14097_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.4	0.0e+00
13833:13848	attL	ATGATTCCATACATCC	NA	NA	NA	NA
WP_063592813.1|14277_15510_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	90.8	1.5e-218
WP_063592814.1|15605_17930_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	78.6	1.8e-284
WP_063592815.1|18035_18248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063592816.1|18510_18897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063592817.1|18888_19995_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	31.7	5.2e-24
WP_063592818.1|20202_20775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063592819.1|21027_21276_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	45.2	3.0e-12
WP_063592820.1|21285_22059_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	64.2	1.6e-88
WP_140439919.1|22300_23485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171995759.1|24896_25055_-	hypothetical protein	NA	NA	NA	NA	NA
24697:24712	attR	GGATGTATGGAATCAT	NA	NA	NA	NA
WP_063592822.1|25261_25564_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	78.6	4.0e-35
WP_063592823.1|25551_25713_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	60.0	3.7e-08
WP_063592824.1|25709_25925_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.9	5.5e-23
WP_176547637.1|25908_26088_-	hypothetical protein	NA	J9Q729	Salmonella_phage	75.9	1.9e-16
WP_063592825.1|26084_27407_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	88.4	2.6e-232
WP_023222375.1|27441_27918_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.2	2.1e-78
WP_063592826.1|27999_28794_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	91.3	2.9e-133
WP_063592827.1|28874_29990_-	toprim domain-containing protein	NA	J9Q720	Salmonella_phage	93.0	2.9e-208
WP_063592828.1|30123_31464_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.6	2.8e-242
WP_063592829.1|31514_32249_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	91.2	6.7e-129
WP_171995805.1|32452_32806_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.9e-44
WP_063592831.1|32811_33477_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	90.5	1.2e-108
WP_063592832.1|33780_34035_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	71.6	2.5e-22
WP_063592833.1|34034_34727_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	90.9	2.0e-122
WP_063592834.1|34740_35064_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	78.5	5.3e-38
WP_063592901.1|35133_35700_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	90.7	1.1e-89
WP_078097290.1|36235_36934_+|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	55.6	3.0e-62
WP_078097291.1|37014_37470_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	74.3	2.0e-59
WP_063592836.1|37473_37992_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	5.9e-47
WP_071925175.1|38006_39632_-|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	62.6	9.0e-142
WP_063592837.1|45612_46206_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.4	2.2e-98
WP_063592838.1|46193_46991_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	90.2	1.2e-147
WP_063592839.1|46980_47682_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	89.7	3.0e-126
WP_063592840.1|47769_48105_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	4.0e-52
WP_063592841.1|48144_52734_-	tape measure protein	NA	J9Q712	Salmonella_phage	83.6	0.0e+00
WP_171995754.1|52741_52966_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	97.3	2.1e-33
WP_063592843.1|53091_53409_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	3.3e-48
WP_063592844.1|53458_54205_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	91.5	1.3e-119
WP_063592845.1|54277_54661_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	83.5	2.9e-59
WP_063592846.1|54662_55136_-	hypothetical protein	NA	J9Q711	Salmonella_phage	92.4	8.6e-77
WP_063592847.1|55126_55471_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	90.4	4.3e-54
WP_063592848.1|55568_56402_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	89.9	7.4e-140
WP_063592849.1|56401_56836_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	9.3e-62
WP_071925170.1|56875_57538_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	69.1	1.1e-77
WP_063592850.1|57612_58494_-	hypothetical protein	NA	J9Q710	Salmonella_phage	91.1	1.2e-148
WP_063592851.1|58519_59416_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	90.6	1.4e-139
WP_063592852.1|59438_61004_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	90.6	3.2e-277
WP_063592853.1|61036_62293_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
WP_063592854.1|62295_62937_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	92.5	1.8e-101
WP_023221759.1|63130_63397_-	hypothetical protein	NA	J9Q757	Salmonella_phage	96.6	7.3e-41
WP_063592855.1|63406_64297_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.1e-165
WP_063592856.1|64302_64557_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	85.7	2.3e-36
WP_063592857.1|64549_65188_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	5.2e-109
WP_063592858.1|65184_65853_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	1.2e-113
WP_063592859.1|65852_66551_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	97.8	3.6e-124
WP_063592860.1|66615_68175_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	95.8	2.0e-284
WP_063592861.1|68177_68456_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	85.7	1.2e-33
WP_140439922.1|68518_69055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063592863.1|69099_69888_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	32.9	5.9e-06
WP_063592864.1|70012_70534_+	hypothetical protein	NA	J9Q6L0	Salmonella_phage	70.3	3.2e-56
WP_063592865.1|70852_71503_+	hypothetical protein	NA	J9Q754	Salmonella_phage	85.2	9.9e-100
WP_063592866.1|71553_71757_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	86.6	1.6e-24
WP_063592867.1|72388_72871_-	hypothetical protein	NA	J9Q805	Salmonella_phage	88.1	1.0e-77
WP_140439921.1|73075_73336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063592868.1|73350_73632_-	hypothetical protein	NA	J9Q753	Salmonella_phage	82.8	1.1e-39
WP_063592869.1|73624_73867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063592870.1|73994_74390_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	6.8e-35
WP_176547642.1|74510_74810_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	69.7	2.9e-30
WP_176547641.1|74960_75176_-	hypothetical protein	NA	J9Q804	Salmonella_phage	82.4	3.1e-26
WP_063592872.1|76965_77283_-	hypothetical protein	NA	J9Q750	Salmonella_phage	81.0	4.0e-46
WP_063592873.1|77276_77519_-	hypothetical protein	NA	J9Q7H8	Salmonella_phage	87.0	4.1e-35
WP_063592874.1|77756_78326_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	69.5	2.2e-74
WP_063592875.1|78360_78573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063592876.1|78787_79063_-	DUF1456 family protein	NA	NA	NA	NA	NA
WP_063592877.1|79107_79533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071925173.1|79617_79788_-	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	98.2	1.3e-24
WP_063592878.1|80030_80402_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	60.2	4.9e-35
WP_063592879.1|80460_82146_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	89.8	2.0e-309
WP_063592880.1|82262_82832_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.6	7.0e-57
WP_071925174.1|83014_83509_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	57.9	2.7e-41
WP_063592882.1|83652_84258_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	1.4e-92
WP_063592883.1|84842_85070_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	80.3	6.6e-27
WP_063592884.1|86034_86829_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	63.6	2.7e-67
WP_063592885.1|86955_87513_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	85.2	3.0e-89
WP_063592886.1|87522_87942_-	hypothetical protein	NA	J9Q743	Salmonella_phage	82.7	7.4e-56
WP_063592887.1|88004_88649_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	84.6	4.0e-101
WP_063592888.1|88648_89125_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	91.1	3.3e-84
WP_063592889.1|89121_89535_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.6	2.3e-62
WP_063592890.1|89536_90640_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	93.7	1.4e-207
WP_063592891.1|90830_91706_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	85.1	4.5e-140
WP_063592892.1|91785_92928_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	93.9	5.6e-207
WP_063592893.1|93045_95355_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	93.4	0.0e+00
WP_063592894.1|95432_96002_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	96.8	2.3e-100
WP_176547640.1|96013_96718_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.3	1.5e-69
WP_063592896.1|96743_98660_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	85.1	7.8e-302
WP_063592897.1|98889_99975_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	94.5	1.4e-199
WP_063592906.1|100272_100917_-	hypothetical protein	NA	J9Q739	Salmonella_phage	90.1	3.8e-112
