The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	242098	290782	4605301	transposase,integrase	Streptococcus_phage(20.0%)	49	256584:256643	290892:290951
WP_000006255.1|242098_242596_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|242819_244559_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|244503_245289_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|245359_246415_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|246466_246760_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|246762_247161_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|247170_247623_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|247928_248195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|248127_248664_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|248720_250178_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|250438_250897_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|250988_252233_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|252290_252692_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|252730_253786_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|254073_255177_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|255188_256442_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
256584:256643	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|257013_257355_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|257375_257693_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|257711_257933_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|257941_258418_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|258433_258892_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|258989_259229_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|259305_259773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|259795_260239_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|260238_260466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|260869_261691_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|261782_262646_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|262974_263868_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|264288_265440_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|267786_268803_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|269010_270414_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|270400_271333_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|271441_272488_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|273709_274048_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|274070_274421_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|274514_275669_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|275963_276872_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|276886_278854_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|279080_280463_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|280474_282085_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|282089_282848_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|282986_283991_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|285185_285917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|286007_286634_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|286905_287604_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|287630_288485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|288603_288828_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|288824_289265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|289381_290782_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
290892:290951	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	512824	575783	4605301	protease,transposase,terminase,tRNA,integrase,lysis	Enterobacteria_phage(50.0%)	66	558441:558487	579743:579789
WP_001295836.1|512824_513448_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|513418_514105_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|514101_516516_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|516946_521227_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|521266_521635_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|522325_522586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|523817_524912_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|524980_525907_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|526136_526619_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|526696_527512_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|527601_529383_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|529395_530172_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|530271_531150_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|531318_532773_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|532832_534194_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|534250_535552_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|535573_536719_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|536946_537732_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|537742_538978_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|538999_540049_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|540365_542033_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|542042_543302_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|543312_544128_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|544124_545018_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|545212_546280_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|546276_546786_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|546903_547626_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|547628_548123_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|548296_549682_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|549717_550239_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|550346_550559_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|550560_551427_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|551897_552440_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|552659_553352_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|553382_555986_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|555964_557005_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|557015_557531_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|557533_558166_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
558441:558487	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|558500_559664_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|559783_560047_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|560369_560465_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|560527_560827_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|560823_561690_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|562000_562333_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|562380_562530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|562587_564114_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|564578_565130_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|565139_565937_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|566053_566155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|566151_566607_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|566606_566777_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|566769_567060_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|567056_567419_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|567415_567556_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|567641_568025_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|568422_569439_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|569443_570511_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|571083_571299_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|571298_571796_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|572012_572195_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|572285_572579_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|572869_573280_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|573565_573772_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|573936_574131_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|574519_575065_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|575039_575783_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
579743:579789	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	1186352	1207745	4605301	tail,portal,tRNA,integrase,plate	Shigella_phage(25.0%)	32	1178347:1178361	1214448:1214462
1178347:1178361	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1186352_1187459_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1187512_1187974_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1187983_1188637_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1188808_1190059_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1190552_1191218_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1191218_1191923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1192380_1193274_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1193364_1194492_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1194472_1194718_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1194754_1195066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1195182_1195524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1195461_1195770_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1195944_1196619_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1196709_1196910_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1196953_1197511_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1197686_1197866_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1197855_1199223_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1199234_1199417_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1199416_1199890_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1199816_1200608_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1200598_1201183_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1201186_1201816_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1201817_1202231_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1202202_1202805_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1202804_1203299_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1203370_1203925_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1204031_1204865_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1205098_1205263_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1205365_1205689_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1206225_1206336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1206388_1206793_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1207013_1207745_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1214448:1214462	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	1388562	1429380	4605301	tail,transposase,tRNA,integrase,lysis	Escherichia_phage(45.16%)	43	1389709:1389727	1420084:1420102
WP_010723085.1|1388562_1389579_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1389709:1389727	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1389851_1390109_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1390158_1391109_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1391260_1392013_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1392207_1392723_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1392733_1394260_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1394296_1395742_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1395741_1397052_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1397227_1398136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1398465_1399029_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1399049_1400282_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1400536_1401520_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1401997_1403371_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1403499_1404435_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1404486_1405722_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1405723_1405939_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1406017_1406227_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1406219_1406414_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1406470_1407280_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1407272_1409873_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1409974_1410250_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1410324_1410495_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1410494_1410716_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1411157_1411646_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1411642_1411798_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1412251_1412728_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1412851_1413148_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1413170_1413593_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1413605_1414463_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1414469_1415216_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1415238_1415799_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1415886_1416072_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1416268_1417726_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1417863_1418127_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1418107_1418467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1420232_1421213_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1420084:1420102	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1421535_1424898_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1424897_1425473_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1425570_1426161_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1426477_1426711_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1426779_1426893_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1427671_1428106_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1428246_1429380_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	1621939	1641150	4605301	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1621939_1623400_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1623488_1624772_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1625376_1625490_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1625558_1625792_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1626108_1626699_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1626796_1627372_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1627371_1628334_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1628284_1628854_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1629242_1629476_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1629533_1629944_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1630095_1630269_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1630440_1630596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1630674_1630740_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1630742_1630931_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1630941_1631154_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1631516_1632014_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1632010_1632544_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1632540_1632852_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1632856_1633072_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1633825_1634041_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1634341_1634554_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1634608_1634698_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1634975_1635728_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|1635741_1636791_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|1636792_1637071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1637137_1637389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1637605_1637761_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1637832_1638120_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1638119_1638359_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1638383_1638689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1638891_1639224_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1639660_1639810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1640106_1640337_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1640420_1640828_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1640994_1641150_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	2098936	2107607	4605301		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2098936_2100040_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2100047_2101295_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2101291_2101849_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2101848_2102730_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2102787_2103687_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2103686_2104772_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2105144_2106038_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2106212_2107607_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	2457002	2468212	4605301	tail,integrase	Enterobacteria_phage(50.0%)	17	2454977:2454993	2471887:2471903
2454977:2454993	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2457002_2457935_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2458246_2459404_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2459556_2459919_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2459915_2460836_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2460832_2462164_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2462198_2462480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2462778_2463219_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2463245_2463764_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2463813_2464089_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2464088_2464583_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2464579_2464948_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2465305_2465668_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2465733_2466558_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2466685_2467222_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2467212_2467575_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2467574_2467880_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2468011_2468212_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2471887:2471903	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP011324	Escherichia coli strain SQ2203 chromosome, complete genome	4605301	2843186	2850325	4605301		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2843186_2845748_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2845853_2846510_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|2846560_2847358_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|2847523_2848432_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2848428_2849595_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2849686_2850325_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
