The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	262025	363902	5153435	plate,transposase,head,holin,capsid,tail,terminase,portal,protease,integrase	Shigella_phage(40.26%)	116	314115:314163	353283:353331
WP_000381395.1|262025_263597_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|263616_263964_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|263963_264641_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000025662.1|265469_265850_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|265854_266784_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|266838_267519_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|267515_268916_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723071.1|269133_269568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639829.1|269843_270245_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	98.5	7.3e-69
WP_000612626.1|270241_270589_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000978828.1|272828_273278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118035.1|274716_275487_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|275640_276114_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973079.1|276156_278601_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|278840_279419_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_014639830.1|279624_280392_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225682.1|280362_281103_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000729704.1|281530_281791_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001355630.1|281976_282750_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000006255.1|282925_283423_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|283646_285386_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207564.1|285330_286116_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|286186_287242_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|287293_287587_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263493.1|287589_287988_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059847.1|287997_288450_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|289475_290933_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|291193_291652_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|291743_292988_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|293045_293447_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|293485_294541_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|294828_295932_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|295943_297197_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000051886.1|297401_298565_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	7.0e-229
WP_000206058.1|298791_299136_-	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_000335007.1|299132_300011_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	6.3e-166
WP_000008240.1|300001_300538_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.8	6.5e-97
WP_000081317.1|300665_301490_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	8.6e-149
WP_000135680.1|301550_301913_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_014639834.1|302513_302810_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	99.0	3.9e-51
WP_001020634.1|303087_303780_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|303877_304138_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|304130_304682_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|304857_305037_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_014639835.1|305026_305968_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	4.3e-152
WP_021576994.1|305964_306459_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	2.5e-87
WP_001355692.1|306458_307112_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_000210155.1|307108_307435_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000767113.1|307431_307821_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061417.1|307840_308638_+	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	98.5	4.1e-148
WP_001360050.1|308645_309635_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_085948622.1|309649_310018_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	85.0	2.3e-53
WP_000887617.1|310046_311378_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.8	8.5e-21
WP_001120496.1|311674_312001_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001197761.1|312004_312481_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_014639836.1|312464_312857_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	85.4	3.0e-51
WP_001379492.1|313319_313652_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135101.1|313702_314053_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	2.3e-63
314115:314163	attL	GGACTGCCCGCCCCATCGTTTTTTTATACCCGCGAAAAATGAAATTTAA	NA	NA	NA	NA
WP_000929187.1|314178_314673_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	2.5e-87
WP_123008408.1|314906_316403_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	1.4e-290
WP_000838374.1|316399_316561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923139.1|316550_317777_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.5	9.2e-240
WP_000999805.1|317769_318372_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766099.1|318382_319612_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.0	8.4e-225
WP_000924828.1|319690_320014_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|320010_320421_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224835.1|320395_320902_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000779287.1|320898_321459_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|321467_321638_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155750.1|321621_323118_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	98.6	3.7e-275
WP_000090998.1|323117_323474_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|323473_323743_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000807199.1|323884_325717_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.9	1.3e-301
WP_000679479.1|325808_326339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639837.1|326400_327729_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	97.5	3.0e-244
WP_000999526.1|327725_328805_+	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	1.3e-205
WP_000643710.1|328804_329353_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	1.1e-94
WP_000424727.1|329352_329778_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	4.4e-80
WP_000785308.1|329764_330823_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	1.6e-200
WP_000383554.1|330813_331398_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.6e-112
WP_000554718.1|331401_332229_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	9.2e-50
WP_000282065.1|332228_332831_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	9.5e-97
WP_001106832.1|332802_333243_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	3.3e-54
WP_032176127.1|333264_333654_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	4.2e-13
WP_000904981.1|333684_334239_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	1.7e-87
WP_000355476.1|334296_335070_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.9	1.4e-36
WP_000246061.1|335895_336639_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000772644.1|337339_338554_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	5.7e-133
WP_000035054.1|339205_339409_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412539.1|339408_339840_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_001019362.1|339852_340686_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|340678_340861_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000954400.1|340854_341922_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	8.6e-16
WP_001065741.1|341914_342109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024678.1|342105_342369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|342365_342587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058741.1|342579_343182_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	33.3	2.6e-22
WP_014639840.1|343194_345543_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.9	2.1e-70
WP_000987941.1|345719_345950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064134.1|345939_346677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018522.1|347279_347453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729826.1|348785_350903_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	55.9	6.6e-169
WP_001363070.1|350922_351318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678612.1|351802_352003_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_000230716.1|352082_352538_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	67.2	2.9e-45
WP_000617443.1|352788_353070_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000284450.1|353673_354216_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
353283:353331	attR	GGACTGCCCGCCCCATCGTTTTTTTATACCCGCGAAAAATGAAATTTAA	NA	NA	NA	NA
WP_001405000.1|354208_354568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111348.1|354911_355322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121346.1|355300_356257_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667037.1|356266_358465_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
WP_000643332.1|358461_359418_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070699.1|359414_360104_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001339397.1|361286_361964_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|361963_362311_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|362330_363902_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 2
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	580726	592901	5153435	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_001110573.1|580726_581413_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|581409_583824_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014744.1|584254_588535_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|588574_588943_+	YbbC/YhhH family protein	NA	NA	NA	NA	NA
WP_001300714.1|588942_589653_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.9	7.2e-19
WP_000879785.1|589633_590125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|590285_590963_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|590962_591310_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381377.1|591329_592901_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.7e-169
>prophage 3
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	862242	909133	5153435	tail,terminase,integrase,protease,lysis	Enterobacteria_phage(41.82%)	62	851083:851099	901046:901062
851083:851099	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_000533643.1|862242_863313_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|863290_863509_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|863548_863716_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001348592.1|863957_864560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763365.1|864770_864992_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000188870.1|865090_865306_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548527.1|865382_865574_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	3.6e-26
WP_000149532.1|865546_865729_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000186890.1|865725_866406_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	98.7	6.7e-131
WP_000100845.1|866402_867188_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995430.1|867193_867490_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_000372937.1|867565_867709_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|867677_867842_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|867914_868283_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_000392424.1|868478_868928_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	89.3	8.7e-71
WP_000213979.1|868987_869188_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066173.1|869401_869983_+	superinfection exclusion B family protein	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
WP_001358311.1|869999_870272_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
WP_001095981.1|870583_871234_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_000276886.1|871314_871500_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001177650.1|871608_871887_+	lambda phage CII family protein	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000788854.1|872750_873452_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	5.4e-128
WP_000145931.1|873448_873739_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736904.1|873812_874253_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_000153280.1|874249_874777_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254215.1|874773_874950_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	96.6	3.0e-27
WP_000386643.1|874952_875294_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099522.1|875500_875863_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000971057.1|875859_876000_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	7.2e-08
WP_001204791.1|876085_876469_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737280.1|876658_877756_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|878328_878544_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135264.1|878543_879041_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	95.2	1.8e-88
WP_001228688.1|879257_879443_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|879639_881097_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291105.1|881234_882026_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204028.1|882018_882951_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|882886_883138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|883141_884236_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625349.1|884216_885518_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.6e-149
WP_000763708.1|885520_886927_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_001317036.1|886910_888023_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000770042.1|888127_888892_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_000918487.1|888990_890130_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|890172_890349_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|890352_890748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|890747_891131_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|891131_891512_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|891508_891901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639870.1|891927_892857_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.3	9.6e-56
WP_012565075.1|893039_893399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|893506_893707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840619.1|893872_897106_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	5.1e-112
WP_000024051.1|897098_897437_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152424.1|897436_898135_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	2.5e-125
WP_000140696.1|898140_898884_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_014639871.1|898820_899453_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	96.7	5.7e-92
WP_000515651.1|899513_903011_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.5	0.0e+00
901046:901062	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
WP_001233066.1|903081_903681_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	1.4e-108
WP_024185625.1|903745_907144_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001657981.1|907143_907728_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_000586341.1|907801_909133_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 4
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	1289846	1347304	5153435	transposase,head,holin,tRNA,capsid,tail,terminase,portal,integrase,lysis	Enterobacteria_phage(37.74%)	69	1288458:1288473	1306411:1306426
1288458:1288473	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_000074983.1|1289846_1290965_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|1290933_1291203_-	excisionase	NA	NA	NA	NA	NA
WP_000048605.1|1291264_1293736_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001365098.1|1293829_1294021_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001358566.1|1294017_1294206_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000102679.1|1294768_1295044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387734.1|1295012_1295342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387735.1|1295353_1295506_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_001420344.1|1295798_1296137_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|1296528_1296771_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|1296754_1297180_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262336.1|1297251_1298322_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|1298362_1298785_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|1298842_1299199_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224659.1|1299292_1299475_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	7.7e-26
WP_000753060.1|1299467_1299644_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_000813254.1|1300565_1300721_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_023141427.1|1300888_1301161_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_001387739.1|1301162_1302221_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.2e-89
WP_000140024.1|1302221_1302587_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640017.1|1302595_1303138_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|1303369_1303567_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611206.1|1303717_1304767_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.1	2.8e-184
WP_000907693.1|1305088_1305313_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	75.4	1.1e-21
WP_000833651.1|1305309_1305462_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001297664.1|1305550_1305943_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_000950576.1|1305932_1306208_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	1.9e-44
WP_001117825.1|1306210_1306588_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	5.6e-63
1306411:1306426	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_001297666.1|1306720_1306834_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_001138287.1|1306862_1307018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000415817.1|1307192_1307585_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.9	3.7e-49
WP_000867506.1|1308169_1308715_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.9	5.6e-80
WP_001027268.1|1308689_1310615_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1310611_1310818_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_014639892.1|1310814_1312416_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.1e-308
WP_000123302.1|1312396_1313716_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	1.6e-234
WP_001338090.1|1313725_1314058_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_001339397.1|1314227_1314905_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1314904_1315252_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1315271_1316843_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_044519273.1|1316883_1317846_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	96.6	3.3e-176
WP_000158878.1|1317887_1318283_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000785282.1|1318294_1318648_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975090.1|1318659_1319238_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683112.1|1319234_1319630_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_001361512.1|1319637_1320378_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
WP_000479193.1|1320393_1320816_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|1320797_1321232_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840292.1|1321224_1323786_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.4	0.0e+00
WP_000847379.1|1323782_1324112_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152634.1|1324111_1324810_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	2.1e-132
WP_000140716.1|1324815_1325559_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	7.3e-147
WP_000090917.1|1325495_1326128_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515474.1|1326188_1329668_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233112.1|1329735_1330335_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	3.8e-106
WP_077634928.1|1330399_1333501_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q1MVL8	Enterobacteria_phage	60.5	3.5e-203
WP_000972151.1|1333503_1334037_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	97.2	3.9e-94
WP_001164127.1|1334065_1334593_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	94.9	7.5e-90
WP_001171271.1|1334596_1335433_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	92.1	1.1e-148
WP_000239881.1|1335918_1336587_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|1337141_1338005_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1337988_1339125_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|1339374_1340601_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1340649_1341771_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1341846_1343307_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1343306_1343978_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1344146_1345517_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1345520_1346162_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1346197_1347304_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	2091309	2168640	5153435	plate,transposase,head,holin,capsid,tail,terminase,portal,integrase	Enterobacteria_phage(69.81%)	78	2091089:2091148	2169583:2169707
2091089:2091148	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_000381395.1|2091309_2092881_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2092900_2093248_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2093247_2093925_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000419015.1|2094235_2096032_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000251941.1|2096018_2097047_-	PD-(D/E)XK motif protein	NA	NA	NA	NA	NA
WP_000056168.1|2097030_2099889_-	Z1 domain-containing protein	NA	NA	NA	NA	NA
WP_000210399.1|2099885_2101388_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000555092.1|2101384_2103436_-	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.3	6.5e-28
WP_000640254.1|2103873_2105052_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001255892.1|2105156_2106284_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_000039876.1|2106342_2108181_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001290570.1|2108239_2108995_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001077332.1|2108991_2112276_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.6	3.6e-65
WP_000779013.1|2112328_2113012_-	YecA family protein	NA	NA	NA	NA	NA
WP_000248953.1|2113008_2114253_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000998251.1|2114242_2115766_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	6.4e-89
WP_000020408.1|2116138_2117305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462045.1|2117811_2118942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121920.1|2119085_2120216_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	27.9	1.2e-15
WP_000281555.1|2120366_2120567_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000256735.1|2120556_2121195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639927.1|2121245_2123846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000280683.1|2123894_2124221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000515818.1|2124599_2125502_+	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	31.9	4.4e-37
WP_000710653.1|2125563_2126382_+	DUF726 domain-containing protein	NA	NA	NA	NA	NA
WP_000045627.1|2127499_2128033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639930.1|2128256_2128430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001172377.1|2128798_2129998_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000413229.1|2130078_2130819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300279.1|2131221_2132223_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2132228_2132576_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290346.1|2132605_2133256_-	membrane protein	NA	NA	NA	NA	NA
WP_000786770.1|2133271_2133676_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2133765_2133903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014505.1|2133974_2134178_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739032.1|2134199_2134550_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	84.5	2.7e-51
WP_000158971.1|2134560_2134848_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|2134859_2135102_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|2135098_2135212_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|2135298_2135502_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|2135498_2135744_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001274214.1|2135740_2136040_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.8	8.2e-41
WP_014639932.1|2136051_2136669_+	ash family protein	NA	S5MQL6	Escherichia_phage	48.1	5.0e-08
WP_000599410.1|2136665_2137031_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_000123425.1|2137037_2139845_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.7	0.0e+00
WP_000686494.1|2139921_2140881_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	1.2e-178
WP_000211268.1|2140885_2141197_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.3	8.5e-41
WP_000087825.1|2143707_2144754_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	5.0e-202
WP_000613809.1|2144753_2146505_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262655.1|2146659_2147496_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055107.1|2147519_2148572_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_000632322.1|2148617_2149418_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_000063077.1|2149521_2150016_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.6	1.9e-87
WP_000864897.1|2150015_2150216_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2150218_2150542_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072347.1|2150538_2150931_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	3.2e-69
WP_000780535.1|2150927_2151335_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_000920578.1|2151472_2151940_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	5.9e-86
WP_000356349.1|2151932_2152568_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_077634929.1|2152579_2153146_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.9e-100
WP_001067548.1|2153163_2153493_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111967.1|2153496_2154393_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071732.1|2154385_2154916_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108562.1|2154918_2157276_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	63.1	4.9e-213
WP_000972151.1|2157278_2157812_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	97.2	3.9e-94
WP_001164126.1|2157840_2158368_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	94.3	1.7e-89
WP_001171280.1|2158371_2159208_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	93.5	7.1e-151
WP_000905056.1|2159312_2159900_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.5	6.0e-104
WP_000979956.1|2159935_2160424_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.6e-86
WP_000853397.1|2160436_2163244_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000333495.1|2163230_2163386_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|2163394_2163760_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2163814_2164327_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005413.1|2164326_2165511_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_000132783.1|2165668_2165998_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	96.7	1.4e-41
WP_001254932.1|2165948_2167100_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000488107.1|2168049_2168310_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2168499_2168640_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
2169583:2169707	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	2220597	2313940	5153435	transposase,integrase	Stx2-converting_phage(30.43%)	65	2217235:2217250	2289922:2289937
2217235:2217250	attL	GCGACCTTGTTAATCA	NA	NA	NA	NA
WP_024185638.1|2220597_2221860_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.8e-73
WP_000703040.1|2222053_2223358_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286281.1|2223385_2224666_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_014639938.1|2224658_2226461_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.8	2.1e-22
WP_001327954.1|2226447_2228160_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.4e-31
WP_000140405.1|2228416_2229376_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623034.1|2229566_2235674_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000369498.1|2235761_2245253_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_000982861.1|2245249_2246350_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000194281.1|2246346_2247150_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088812.1|2247153_2248731_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000784545.1|2248862_2250884_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_000039786.1|2251534_2252284_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000702803.1|2253925_2254375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149006549.1|2254665_2255894_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	4.5e-170
WP_000378582.1|2257982_2259299_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060232.1|2259400_2260855_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532912.1|2261197_2261914_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122452224.1|2262542_2264186_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011017.1|2264303_2265254_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011485.1|2265355_2266273_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986328.1|2266729_2267665_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193788.1|2267726_2268806_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001366311.1|2268817_2269561_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973159.1|2269557_2270103_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001128463.1|2270567_2270732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148936544.1|2271591_2272754_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001221604.1|2274539_2274950_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000271005.1|2276113_2276506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|2276671_2277241_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000235221.1|2278840_2279047_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813455.1|2279141_2279744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250234.1|2280944_2281862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407301.1|2281946_2282819_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000820451.1|2283190_2286037_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|2286107_2286266_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234725.1|2286420_2287239_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
WP_000680585.1|2287238_2287484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024185640.1|2287577_2288051_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	3.3e-12
WP_001186774.1|2288066_2288543_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2288605_2288827_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_024185641.1|2288989_2289358_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854755.1|2289447_2289822_+	toxin	NA	NA	NA	NA	NA
WP_000976829.1|2289818_2290025_+	hypothetical protein	NA	NA	NA	NA	NA
2289922:2289937	attR	TGATTAACAAGGTCGC	NA	NA	NA	NA
WP_001161660.1|2290037_2290151_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_139371347.1|2291685_2292898_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000624722.1|2293228_2293579_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2293575_2294001_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001254932.1|2294238_2295390_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_071596603.1|2297240_2297702_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809341.1|2297698_2298316_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000105682.1|2298639_2299860_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_001045641.1|2299852_2302822_+	autotransporter adhesin/invasin glycoprotein TibA	NA	NA	NA	NA	NA
WP_077631950.1|2302934_2303264_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000998068.1|2304017_2305556_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.3	3.1e-293
WP_000612591.1|2305605_2305953_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000536902.1|2305949_2306351_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	1.3e-70
WP_000381318.1|2306453_2308025_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|2308044_2308392_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001704819.1|2308391_2309069_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_014639948.1|2309109_2310114_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	1.0e-191
WP_001297096.1|2310110_2310890_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001667686.1|2311163_2311346_+	ethanolamine utilization - propanediol utilization family protein	NA	NA	NA	NA	NA
WP_000450409.1|2311446_2311776_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_148936545.1|2312778_2313940_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 7
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	2839108	2887143	5153435	transposase,holin,tail,terminase,integrase	Escherichia_phage(38.18%)	60	2840947:2840963	2884029:2884045
WP_000017552.1|2839108_2839261_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2839278_2839470_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_014639964.1|2839782_2840301_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755173.1|2840316_2840856_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
2840947:2840963	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_000637738.1|2841073_2841556_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	92.5	2.5e-71
WP_000354072.1|2841552_2842179_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	91.8	1.6e-107
WP_000207019.1|2842168_2842477_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	99.0	7.6e-50
WP_001275998.1|2842463_2842868_-	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_000381395.1|2844526_2846098_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2846117_2846465_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2846464_2847142_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001188253.1|2848202_2848460_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
WP_000451762.1|2848481_2849210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110221350.1|2849473_2849560_+	ash family protein	NA	NA	NA	NA	NA
WP_001093358.1|2849605_2850298_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.2	2.9e-97
WP_000472086.1|2850495_2850714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028685.1|2850704_2851082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|2851175_2851337_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001147906.1|2851368_2851665_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	4.7e-49
WP_001248445.1|2851860_2854335_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	93.6	0.0e+00
WP_000119841.1|2854339_2856142_-	hypothetical protein	NA	T1SAQ5	Salmonella_phage	95.7	2.8e-301
WP_001143617.1|2856138_2858649_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	83.2	0.0e+00
WP_000337197.1|2858661_2859204_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	69.3	1.6e-55
WP_000588338.1|2859203_2859668_-	hypothetical protein	NA	T1SA73	Salmonella_phage	92.9	1.5e-81
WP_001018558.1|2859667_2862145_-	hypothetical protein	NA	Q858G3	Salmonella_phage	95.8	0.0e+00
WP_000179263.1|2862144_2862750_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
WP_000424489.1|2862749_2863073_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
WP_000012391.1|2863123_2863459_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	2.2e-55
WP_000627061.1|2863469_2863907_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	98.6	3.1e-73
WP_000268716.1|2863958_2864945_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	4.3e-187
WP_000051491.1|2864959_2865655_-	hypothetical protein	NA	G9L6C4	Escherichia_phage	99.6	2.3e-94
WP_000133160.1|2865657_2865954_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_000852155.1|2865950_2867630_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	87.6	2.8e-279
WP_000334867.1|2867644_2867851_-	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_000122958.1|2869154_2870636_-	hypothetical protein	NA	M1F3C4	Salmonella_phage	97.8	2.5e-292
WP_166427843.1|2870632_2871310_-|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	99.5	1.4e-104
WP_001129702.1|2871331_2871670_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	84.8	4.1e-49
WP_000210446.1|2871859_2872714_-	hypothetical protein	NA	K7P6H7	Enterobacteria_phage	38.3	5.8e-31
WP_001229290.1|2872710_2873076_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	97.5	5.6e-68
WP_044519775.1|2873460_2873655_-	hypothetical protein	NA	A0A1P8DTU9	Salmonella_phage	60.0	2.0e-16
WP_001283044.1|2873771_2873969_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	52.7	1.2e-11
WP_000805520.1|2873965_2874439_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	51.7	9.0e-34
WP_001231257.1|2874610_2874955_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	1.4e-60
WP_001406039.1|2875072_2875858_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_000086422.1|2875854_2876670_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	98.2	3.6e-123
WP_000402895.1|2876685_2876886_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	100.0	2.1e-32
WP_001282459.1|2877036_2877267_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2877421_2878006_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|2878159_2878312_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102261.1|2878314_2878614_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	1.2e-44
WP_000805233.1|2878610_2878817_+	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	86.0	6.7e-18
WP_001091671.1|2878813_2879635_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	98.5	3.7e-160
WP_000063839.1|2879631_2880573_+	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	99.7	5.0e-177
WP_000675390.1|2880622_2880871_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_024185651.1|2881028_2881280_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	97.6	1.5e-40
WP_000163452.1|2881272_2881923_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	98.6	4.3e-127
WP_001055438.1|2881919_2882579_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.0	2.2e-102
WP_000954574.1|2882581_2883838_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	6.8e-238
WP_000138270.1|2884030_2885608_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2884029:2884045	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|2885676_2887143_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 8
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	2950215	2986424	5153435	plate,holin,tRNA,tail,terminase	Salmonella_phage(53.85%)	47	NA	NA
WP_001295367.1|2950215_2950752_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|2950776_2951412_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001351829.1|2951620_2952469_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001288821.1|2953108_2953756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077634915.1|2954417_2954819_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	37.7	7.7e-10
WP_000376433.1|2954822_2955242_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.7	1.4e-35
WP_000805566.1|2955213_2955807_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	64.0	5.4e-60
WP_001096970.1|2955806_2956676_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	58.2	7.2e-45
WP_000049950.1|2956675_2957356_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001197085.1|2957352_2958552_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
WP_001270633.1|2958551_2958905_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001007933.1|2958904_2959657_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.3	5.9e-88
WP_000213605.1|2959719_2959890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033880.1|2959893_2960448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000832849.1|2960455_2960803_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	3.5e-27
WP_000081745.1|2960805_2961870_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	3.0e-154
WP_001007341.1|2961872_2962175_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	8.2e-49
WP_001300247.1|2962174_2962762_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	2.6e-83
WP_000990884.1|2962761_2964750_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
WP_000393954.1|2964927_2965380_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000109249.1|2965383_2965824_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046933.1|2965834_2966980_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	6.1e-161
WP_012816811.1|2966983_2967547_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.0e-80
WP_001142484.1|2967521_2967911_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
WP_000008726.1|2967897_2968452_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	2.5e-67
WP_000042170.1|2968448_2968856_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	4.3e-69
WP_001040697.1|2968821_2969190_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	88.5	1.4e-53
WP_000627490.1|2969230_2970172_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	1.4e-155
WP_001066733.1|2970183_2970690_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	80.5	9.8e-71
WP_000873183.1|2970693_2971914_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	1.1e-200
WP_000184969.1|2971928_2972663_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.6	2.1e-98
WP_000113491.1|2972553_2974020_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	3.9e-261
WP_001130793.1|2974019_2975642_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000162796.1|2975644_2976217_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_000779566.1|2976278_2976803_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|2976786_2977263_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2977266_2977608_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174014.1|2978053_2978395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|2978426_2978849_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001520086.1|2979133_2981320_-	replication protein	NA	B6SD37	Bacteriophage	72.4	2.4e-174
WP_000016209.1|2981323_2981524_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_000567466.1|2981665_2982340_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_001288046.1|2982758_2983283_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	47.5	1.4e-35
WP_000801965.1|2983507_2983657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051355.1|2983653_2984556_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113513.1|2984558_2985860_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.6	3.6e-133
WP_000769004.1|2985875_2986424_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	66.5	7.1e-67
>prophage 9
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	3150866	3164049	5153435		Escherichia_phage(50.0%)	12	NA	NA
WP_001272909.1|3150866_3153428_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141322.1|3153533_3154190_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3154240_3155008_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3155203_3156112_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3156108_3157371_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3157367_3158006_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3158010_3158787_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104442.1|3158875_3160240_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3160333_3161326_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3161388_3162528_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3162667_3163294_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3163287_3164049_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 10
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	3404926	3460563	5153435	tRNA,transposase,integrase	Enterobacteria_phage(25.0%)	52	3398757:3398772	3436251:3436266
3398757:3398772	attL	CGGGCCACTGCGCCGC	NA	NA	NA	NA
WP_000786911.1|3404926_3405646_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3405806_3406859_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3406886_3407162_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_014640005.1|3407226_3408306_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001299430.1|3408507_3409764_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_014640006.1|3409813_3411949_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234517.1|3412346_3413054_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218861.1|3413432_3414695_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001283626.1|3415862_3416384_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|3416380_3417334_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188275.1|3417420_3419745_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879160.1|3419789_3420692_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|3420688_3421687_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684859.1|3421683_3422640_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175452.1|3422640_3423408_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	1.4e-12
WP_001356111.1|3423945_3424233_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_001429619.1|3424204_3425260_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_000833174.1|3425775_3426165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273201.1|3426229_3427288_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001350106.1|3427328_3428051_+	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_001350105.1|3428047_3428869_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001148680.1|3428843_3429101_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_000132059.1|3429112_3429364_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_001350104.1|3429368_3429950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077065.1|3429946_3431305_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_001304725.1|3431291_3431645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000115638.1|3431635_3433312_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000930891.1|3433315_3433738_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000670565.1|3433734_3434340_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000180166.1|3434308_3436627_+	MMPL family transporter	NA	NA	NA	NA	NA
3436251:3436266	attR	GCGGCGCAGTGGCCCG	NA	NA	NA	NA
WP_000597696.1|3436623_3437208_+	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_001350102.1|3437209_3438379_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_000020242.1|3438375_3438840_+	3-hydroxy-fatty acyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000091658.1|3438839_3439571_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_000198472.1|3439567_3440797_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000416157.1|3441636_3442668_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_096957441.1|3443164_3444534_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000705928.1|3444843_3445131_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_024185656.1|3445676_3446456_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	5.8e-139
WP_000255946.1|3446455_3447478_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001390632.1|3448574_3448796_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	65.2	1.6e-17
WP_000107474.1|3449280_3450294_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998349.1|3450305_3451622_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3451649_3452570_-	ribokinase	NA	NA	NA	NA	NA
WP_001315616.1|3452872_3453655_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001221615.1|3454657_3455092_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000271027.1|3455079_3455481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221565.1|3455740_3456310_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001339397.1|3456546_3457224_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3457223_3457571_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381368.1|3457590_3459162_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.3e-169
WP_000343747.1|3459354_3460563_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
>prophage 11
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	4685558	4727871	5153435	plate,head,holin,tRNA,capsid,tail,terminase,portal,protease,integrase	Shigella_phage(42.59%)	61	4702394:4702408	4733359:4733373
WP_000390070.1|4685558_4685732_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.6	8.3e-22
WP_001128526.1|4685870_4686905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093922.1|4687097_4687379_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	94.6	2.0e-41
WP_001061351.1|4687415_4687988_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	7.4e-107
WP_000206747.1|4687987_4688797_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	60.9	8.1e-75
WP_001242732.1|4688796_4689159_-	phage protein	NA	S5MC15	Escherichia_phage	100.0	1.2e-65
WP_000008232.1|4689149_4689686_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081287.1|4689813_4690638_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135672.1|4690703_4691066_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	7.3e-60
WP_000981537.1|4691523_4692177_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|4692272_4692470_+	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514179.1|4692497_4693082_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	1.6e-56
WP_001188051.1|4693257_4693437_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_000104989.1|4693426_4694368_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	3.3e-152
WP_077634920.1|4694364_4694859_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.6e-86
WP_001355692.1|4694858_4695512_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_000210163.1|4695508_4695835_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	1.0e-52
WP_000767113.1|4695831_4696221_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061445.1|4696240_4697050_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_001360050.1|4697057_4698047_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001047102.1|4698060_4698813_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	3.1e-137
WP_001542448.1|4698963_4699221_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	7.2e-38
WP_001283169.1|4699300_4699687_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|4699673_4699955_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001075801.1|4699954_4700569_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.0	6.3e-112
WP_001476996.1|4700565_4700958_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	91.4	7.4e-58
WP_000651450.1|4701204_4701525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135203.1|4701617_4701968_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	1.4e-63
WP_000929180.1|4702093_4702588_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	6.6e-88
4702394:4702408	attL	CAGGGCAACACCATT	NA	NA	NA	NA
WP_148936548.1|4702821_4704318_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	9.1e-290
WP_000838376.1|4704314_4704476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923135.1|4704465_4705692_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
WP_000999805.1|4705684_4706287_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766102.1|4706297_4707527_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.8	1.5e-226
WP_000924830.1|4707605_4707929_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
WP_000702407.1|4707925_4708336_+|head	phage head closure protein	head	U5P0R0	Shigella_phage	96.3	2.7e-71
WP_014640058.1|4708307_4708832_+	hypothetical protein	NA	U5P416	Shigella_phage	97.7	8.0e-92
WP_000779283.1|4708828_4709389_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000497757.1|4709397_4709568_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000155696.1|4709551_4711048_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	8.5e-272
WP_000090998.1|4711047_4711404_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000571713.1|4711400_4711724_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000774665.1|4711808_4713710_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.5	0.0e+00
WP_000738066.1|4713774_4714263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347687.1|4714319_4715693_+	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	98.0	4.1e-244
WP_000999519.1|4715689_4716769_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	2.6e-206
WP_001259082.1|4716768_4717317_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	1.5e-96
WP_000424732.1|4717316_4717742_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785312.1|4717728_4718787_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	8.6e-202
WP_000383548.1|4718777_4719362_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_000554685.1|4719365_4720187_+	hypothetical protein	NA	U5P0I1	Shigella_phage	99.0	1.3e-51
WP_000805566.1|4720186_4720780_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	64.0	5.4e-60
WP_000376433.1|4720751_4721171_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.7	1.4e-35
WP_001420297.1|4721174_4721531_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	36.3	8.3e-08
WP_000639149.1|4721607_4722171_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_001217553.1|4722314_4722563_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332264.1|4722624_4723722_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_000543829.1|4723810_4724848_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891409.1|4724981_4725224_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|4725389_4726373_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|4726455_4727871_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
4733359:4733373	attR	AATGGTGTTGCCCTG	NA	NA	NA	NA
>prophage 12
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	4805506	4867932	5153435	tRNA,transposase,integrase	uncultured_virus(17.65%)	48	4820042:4820056	4869214:4869228
WP_000343746.1|4805506_4806715_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_000343747.1|4807004_4808213_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_000198773.1|4809603_4810233_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_000066707.1|4810355_4812002_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_000899522.1|4812079_4813420_-	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_000611288.1|4813990_4814710_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_001216477.1|4814706_4816338_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_000371704.1|4816518_4816749_+	(4Fe-4S)-binding protein	NA	NA	NA	NA	NA
WP_000405651.1|4816760_4817033_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000398619.1|4817259_4817556_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_001173343.1|4817583_4817757_+	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_001295074.1|4817875_4819393_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|4819629_4821087_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
4820042:4820056	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
WP_001295383.1|4821145_4823293_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|4823372_4824707_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187175.1|4825072_4826611_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000492893.1|4828190_4829726_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001290175.1|4829796_4830642_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_087891818.1|4830726_4830924_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001094449.1|4831145_4831523_-	toxin	NA	NA	NA	NA	NA
WP_001280916.1|4831612_4831981_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086751.1|4831996_4832641_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.3	1.4e-24
WP_000692315.1|4832659_4832881_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186781.1|4832943_4833420_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855079.1|4833434_4833908_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.5e-12
WP_001234607.1|4834209_4835028_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	1.1e-44
WP_001119729.1|4835127_4835361_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001339397.1|4835418_4836096_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4836095_4836443_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4836462_4838034_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000581511.1|4838146_4838602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000939408.1|4838677_4841194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024185664.1|4841314_4844161_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069713.1|4844532_4845405_-	GTPase family protein	NA	NA	NA	NA	NA
WP_014640066.1|4846593_4848078_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_014640067.1|4848400_4849009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095908.1|4849095_4849302_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000220730.1|4850805_4851375_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271021.1|4851540_4851924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013295.1|4851920_4852346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343747.1|4853483_4854692_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_001254932.1|4854723_4855875_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000366614.1|4856877_4858935_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.4	4.9e-36
WP_000005570.1|4858927_4860214_+	McrC family protein	NA	NA	NA	NA	NA
WP_001034307.1|4860917_4863932_+	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	23.3	6.6e-21
WP_000668950.1|4864001_4865627_-	N-6 DNA methylase	NA	A0A2I6UHU5	Bacillus_phage	27.7	1.4e-14
WP_001051770.1|4865616_4865805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218808.1|4866666_4867932_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	5.3e-81
4869214:4869228	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
>prophage 13
NZ_CP007594	Escherichia coli strain SEC470 chromosome, complete genome	5153435	5072385	5116864	5153435	transposase,head,capsid,tail,terminase,portal,integrase,lysis	Enterobacteria_phage(39.58%)	50	5070391:5070405	5115037:5115051
5070391:5070405	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
WP_001218277.1|5072385_5073609_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
WP_001159678.1|5073791_5077619_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000206803.1|5078015_5078636_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_001242723.1|5078635_5078998_-	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000008209.1|5078988_5079525_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_000081316.1|5079652_5080477_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000135688.1|5080542_5080905_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	5.6e-60
WP_000848749.1|5081573_5082248_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000388778.1|5082338_5082539_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	2.3e-31
WP_000521508.1|5082582_5083134_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087321.1|5083130_5083967_+	ash family protein	NA	Q8SBF3	Shigella_phage	97.8	4.3e-148
WP_000933947.1|5083959_5084196_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	96.2	1.9e-37
WP_000061531.1|5084192_5085011_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	5.2e-122
WP_001315196.1|5085007_5085502_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_014640085.1|5085501_5086155_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.8e-126
WP_000210169.1|5086151_5086478_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_000767103.1|5086474_5086864_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_149006549.1|5087047_5088275_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	4.5e-170
WP_044519660.1|5088282_5089029_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.8	1.1e-137
WP_024185670.1|5089036_5090026_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001047110.1|5090039_5090792_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_000917724.1|5091045_5091249_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|5091399_5092452_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|5092519_5092735_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135305.1|5092734_5093232_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	99.4	7.6e-92
WP_014640088.1|5093228_5093672_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	77.9	1.6e-56
WP_000025002.1|5094052_5094373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453611.1|5094710_5095256_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027267.1|5095230_5097156_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198157.1|5097152_5097359_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	1.7e-29
WP_001356325.1|5097355_5098957_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.2e-310
WP_000123256.1|5098937_5100257_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|5100266_5100599_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063221.1|5100654_5101680_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_000158880.1|5101721_5102117_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000753008.1|5102128_5102482_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	5.8e-62
WP_000985119.1|5102493_5103072_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000381395.1|5103375_5104947_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5104966_5105314_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5105313_5105991_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_014640089.1|5106178_5106919_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.0e-129
WP_000479151.1|5106934_5107357_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	7.4e-72
WP_000459458.1|5107338_5107773_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840197.1|5107765_5110345_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	100.0	0.0e+00
WP_000847331.1|5110341_5110671_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152622.1|5110670_5111369_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_014640090.1|5111374_5112118_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	1.0e-140
WP_000090847.1|5112054_5112657_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_000515695.1|5112717_5116197_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
5115037:5115051	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
WP_001233112.1|5116264_5116864_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	3.8e-106
