The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	642962	652853	4105955		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|642962_644255_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_046559404.1|644330_645050_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	6.8e-49
WP_003155758.1|645049_645304_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_014304545.1|645300_645984_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_046559405.1|645967_648196_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	8.5e-159
WP_003155754.1|648171_649602_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_003155753.1|649693_650734_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_003155752.1|650730_651318_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_046559406.1|651314_652853_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	3.0e-78
>prophage 2
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	1202186	1234082	4105955	portal,tail,terminase,plate,holin	Bacillus_phage(33.33%)	42	NA	NA
WP_088005367.1|1202186_1203323_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	9.9e-95
WP_003154881.1|1203312_1203447_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_046559508.1|1203589_1204543_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	68.7	1.6e-61
WP_003154878.1|1204580_1204958_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_032858666.1|1205067_1205673_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.3	1.5e-41
WP_003154873.1|1205827_1206418_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1206566_1206905_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154869.1|1207096_1207276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559509.1|1207265_1208093_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
WP_032861409.1|1207992_1208793_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.9	1.0e-58
WP_046559510.1|1209057_1209399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1209388_1209592_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_003154857.1|1209704_1210217_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	5.0e-22
WP_043867015.1|1210329_1211127_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_046559511.1|1211123_1212422_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	1.1e-150
WP_088005490.1|1212470_1213862_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	3.0e-138
WP_046559512.1|1213881_1214727_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	1.1e-55
WP_003154848.1|1214753_1215689_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	2.5e-104
WP_003154846.1|1215705_1216089_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003154844.1|1216085_1216442_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_046559513.1|1216438_1216942_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_046559514.1|1216938_1217385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154839.1|1217381_1217591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559515.1|1217590_1218988_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.2	3.4e-81
WP_003154837.1|1218989_1219433_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1219508_1219955_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1219996_1220149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559516.1|1220136_1225260_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	41.6	1.2e-41
WP_046559517.1|1225252_1225912_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_046559518.1|1225925_1226903_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.6	4.9e-34
WP_007610818.1|1226902_1227169_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_025851797.1|1227272_1227698_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	35.6	1.5e-11
WP_003154824.1|1227690_1228737_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_003154823.1|1228720_1229299_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_046559519.1|1229295_1229568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559520.1|1229570_1231193_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.7	1.8e-41
WP_014304856.1|1231205_1231577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1231582_1231780_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_046559521.1|1231836_1232598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1232649_1232913_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1232926_1233190_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|1233203_1234082_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 3
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	1782085	1788298	4105955		Bacillus_phage(50.0%)	7	NA	NA
WP_014305044.1|1782085_1782478_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
WP_003154060.1|1782437_1784540_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_003154059.1|1784557_1785547_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.6	8.7e-156
WP_025851155.1|1785594_1786215_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.4	2.1e-46
WP_046559594.1|1786270_1787023_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_015388200.1|1787056_1787281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1787329_1788298_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 4
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	1971564	2016926	4105955	head,portal,integrase,tail,protease,capsid,tRNA,terminase,plate,holin	Bacillus_phage(76.32%)	56	2010814:2010829	2012786:2012801
WP_052749754.1|1971564_1973217_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	54.0	9.7e-67
WP_046341269.1|1973213_1973645_+	SMI1 / KNR4	NA	NA	NA	NA	NA
WP_046341270.1|1973799_1974417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559635.1|1974461_1975475_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.7	7.5e-187
WP_046559636.1|1975530_1975794_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
WP_046559637.1|1975808_1976021_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.4e-15
WP_013353491.1|1976071_1976260_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_046559638.1|1976256_1976619_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	1.4e-55
WP_046559639.1|1976615_1977893_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.1	6.2e-154
WP_046559640.1|1977909_1980471_-	peptidase G2	NA	D6R401	Bacillus_phage	93.9	0.0e+00
WP_046559641.1|1980510_1982214_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	99.1	2.2e-311
WP_046559642.1|1982225_1983065_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	94.3	6.9e-154
WP_046559643.1|1983064_1986940_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.6	0.0e+00
WP_015968224.1|1987140_1987479_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	100.0	9.2e-57
WP_015968223.1|1987530_1988133_-	hypothetical protein	NA	Q9ZXE9	Bacillus_phage	100.0	1.8e-111
WP_079892054.1|1988133_1988622_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	98.1	8.8e-85
WP_046559645.1|1988510_1988894_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	99.2	4.2e-66
WP_046559646.1|1988886_1989246_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	95.8	3.0e-58
WP_046559647.1|1989190_1989526_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	99.1	1.6e-56
WP_046559648.1|1989540_1989978_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	69.6	1.7e-34
WP_046559649.1|1990005_1990317_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	70.2	2.1e-31
WP_046559650.1|1990328_1991522_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	87.4	1.0e-195
WP_046559651.1|1991561_1992188_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	99.5	1.5e-113
WP_046559652.1|1992177_1993428_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.8	5.3e-243
WP_046559654.1|1993672_1995382_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	96.8	0.0e+00
WP_046559655.1|1995381_1995888_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.8	3.1e-85
WP_046559656.1|1995974_1996301_-	hypothetical protein	NA	Q9T203	Bacillus_phage	96.3	1.2e-53
WP_046559657.1|1996269_1996644_-	HNH endonuclease	NA	Q38456	Bacillus_phage	91.1	1.8e-66
WP_046559658.1|1996774_1997632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559659.1|1997765_1998536_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_046559660.1|1998656_1998839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559661.1|1998941_1999733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458303.1|1999952_2000495_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
WP_046560204.1|2000491_2000944_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	7.5e-38
WP_046559662.1|2001280_2001715_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.3	2.4e-49
WP_046559663.1|2001852_2002371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559664.1|2002484_2003309_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	59.0	1.5e-89
WP_046559665.1|2003312_2003573_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	43.2	5.7e-06
WP_046559666.1|2003569_2003950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032859650.1|2004090_2004294_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_024085438.1|2004541_2004682_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_046559667.1|2004789_2005338_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_046560205.1|2005653_2006487_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	2.7e-33
WP_046559668.1|2006470_2007343_-	replication protein	NA	V9QKF6	Oenococcus_phage	43.6	2.2e-46
WP_046559669.1|2007329_2007554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305165.1|2007571_2007895_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	40.7	4.6e-13
WP_032858779.1|2007958_2008165_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305167.1|2008329_2008728_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046559670.1|2009159_2010260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559671.1|2010502_2011609_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	57.8	6.6e-112
2010814:2010829	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
WP_046559672.1|2011883_2012429_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	49.2	1.9e-43
WP_003153848.1|2012743_2012974_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
2012786:2012801	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
WP_014305170.1|2013217_2014993_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_046559673.1|2015039_2016215_-	MFS transporter	NA	NA	NA	NA	NA
WP_003153841.1|2016358_2016661_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076983180.1|2016698_2016926_-|tRNA	threonyl-tRNA synthetase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	2168425	2177894	4105955		Bacillus_phage(88.89%)	16	NA	NA
WP_003153555.1|2168425_2168701_+	hypothetical protein	NA	O64122	Bacillus_phage	42.9	1.0e-05
WP_046559711.1|2170209_2170764_-	hypothetical protein	NA	O64195	Bacillus_phage	90.4	1.8e-89
WP_014470254.1|2170861_2171101_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_052749755.1|2171331_2172006_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_046559713.1|2172045_2172291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559714.1|2172310_2172523_-	hypothetical protein	NA	A0A0A0PKZ9	Bacillus_phage	59.4	3.5e-14
WP_046559715.1|2173029_2173269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559716.1|2173312_2173492_-	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	88.1	2.7e-23
WP_046559717.1|2173538_2173760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559718.1|2173769_2174597_-	metallophosphoesterase	NA	O64184	Bacillus_phage	89.1	7.5e-153
WP_042976081.1|2174756_2174969_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_046559719.1|2175050_2175239_-	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	98.4	2.7e-26
WP_046559720.1|2175599_2175893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559721.1|2176476_2176833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559722.1|2176892_2177258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559723.1|2177387_2177894_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	38.0	2.2e-30
>prophage 6
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	2180985	2238184	4105955	integrase,protease	Bacillus_phage(96.49%)	89	2177276:2177297	2244188:2244209
2177276:2177297	attL	TTATTTTATTTTTATTCTAAAA	NA	NA	NA	NA
WP_046559727.1|2180985_2181285_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	54.7	3.0e-19
WP_046559728.1|2181277_2181586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559729.1|2182201_2182630_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	4.4e-72
WP_046559730.1|2182681_2183188_-	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	34.3	1.8e-11
WP_046559731.1|2183187_2183436_-	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	85.0	5.2e-33
WP_038458545.1|2184016_2184538_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	91.9	7.5e-90
WP_046559732.1|2185258_2185561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102422311.1|2187209_2187887_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.9	4.8e-121
WP_046559734.1|2187894_2188290_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	84.7	3.7e-57
WP_046559735.1|2188286_2188637_-	hypothetical protein	NA	O64171	Bacillus_phage	48.3	1.5e-22
WP_020954075.1|2188655_2188805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559736.1|2188879_2189080_-	hypothetical protein	NA	O64170	Bacillus_phage	97.0	1.3e-31
WP_014721253.1|2189344_2189479_-	hypothetical protein	NA	O64168	Bacillus_phage	93.2	8.1e-17
WP_079892070.1|2189491_2189719_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	78.3	7.8e-28
WP_148230871.1|2189753_2189972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559737.1|2190078_2190435_-	hypothetical protein	NA	O64166	Bacillus_phage	47.5	2.3e-18
WP_038458560.1|2190471_2190744_-	hypothetical protein	NA	A0A223LFV4	Bacillus_phage	82.9	1.9e-12
WP_038458567.1|2191006_2191354_-	hypothetical protein	NA	O64164	Bacillus_phage	93.9	9.8e-54
WP_038458570.1|2191368_2191776_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	64.2	4.0e-38
WP_038458573.1|2191787_2192237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559740.1|2193028_2193787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021493499.1|2193974_2194172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559741.1|2194185_2194410_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	81.3	8.5e-27
WP_046559742.1|2194447_2194666_-	hypothetical protein	NA	O64155	Bacillus_phage	60.0	3.3e-15
WP_046559743.1|2194704_2194914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559744.1|2194961_2195522_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_046559745.1|2195649_2195997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559746.1|2196036_2196534_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	77.6	6.9e-69
WP_046559747.1|2196693_2196897_-	hypothetical protein	NA	O64150	Bacillus_phage	73.1	3.6e-24
WP_046559748.1|2196908_2197616_-	hypothetical protein	NA	O64147	Bacillus_phage	32.3	1.6e-23
WP_046559749.1|2197642_2201572_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	84.7	0.0e+00
WP_046559750.1|2201584_2203312_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	81.4	1.2e-274
WP_046559751.1|2203311_2204448_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.7	1.4e-205
WP_046559752.1|2204463_2205978_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	94.8	1.1e-274
WP_046559753.1|2205992_2206463_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	90.4	2.0e-81
WP_046559754.1|2206504_2207476_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	95.7	1.3e-172
WP_046559755.1|2207565_2208480_-	hypothetical protein	NA	O64140	Bacillus_phage	89.8	2.3e-155
WP_046559756.1|2208501_2208882_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	78.4	8.2e-54
WP_046559757.1|2209044_2210040_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_046559758.1|2210103_2210460_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_046559759.1|2210518_2210896_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	77.0	9.9e-52
WP_046559760.1|2210934_2212677_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.0	6.8e-220
WP_046559761.1|2212673_2213498_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	60.2	4.3e-84
WP_154018562.1|2213610_2213754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559762.1|2213787_2214225_-	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	37.3	1.0e-15
WP_046559763.1|2214221_2214407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559764.1|2214492_2214708_-	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	85.5	9.7e-28
WP_014470187.1|2214778_2215453_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.4e-77
WP_046559765.1|2215522_2216335_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	85.9	1.4e-135
WP_046559766.1|2216447_2216813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020954112.1|2217683_2218046_-	hypothetical protein	NA	A0A140HLN5	Bacillus_phage	48.4	6.4e-32
WP_020954113.1|2218082_2218598_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	55.1	4.5e-47
WP_076983647.1|2218718_2218979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154018563.1|2219017_2219248_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	95.8	4.5e-31
WP_046559768.1|2219709_2220048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559769.1|2220101_2220299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559770.1|2220426_2220630_-	hypothetical protein	NA	O64115	Bacillus_phage	95.5	3.2e-33
WP_046559771.1|2220664_2220901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559772.1|2220916_2221603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559773.1|2221609_2222239_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046559774.1|2222281_2222689_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	96.3	1.6e-71
WP_046559775.1|2222695_2223034_-	hypothetical protein	NA	O64111	Bacillus_phage	75.9	7.1e-41
WP_046559776.1|2223030_2223246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020954128.1|2224151_2224397_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_020954129.1|2224471_2224771_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	1.0e-19
WP_021493552.1|2224936_2225158_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
WP_046559778.1|2225378_2226362_-	hypothetical protein	NA	A0A1P8CWX4	Bacillus_phage	77.7	7.4e-139
WP_046559779.1|2226382_2227732_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.2	2.8e-189
WP_046559780.1|2227808_2228867_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.7	1.1e-153
WP_046559781.1|2229079_2229310_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_014472000.1|2229324_2229537_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_154018564.1|2229974_2230106_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_046559782.1|2230135_2231275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022553109.1|2231436_2231847_-	HicB family protein	NA	A0A1L2JY34	Aeribacillus_phage	58.1	3.1e-38
WP_021493562.1|2231929_2232262_-	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	52.9	3.1e-25
WP_046559783.1|2232267_2232813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021493564.1|2232861_2232993_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	86.0	1.0e-16
WP_046559784.1|2233004_2233220_-	hypothetical protein	NA	O64089	Bacillus_phage	50.7	2.6e-12
WP_021493566.1|2233222_2233474_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.2	9.3e-22
WP_041482308.1|2233544_2233727_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
WP_021493568.1|2233739_2233964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021493569.1|2233988_2234216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021493570.1|2234258_2234810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559785.1|2234946_2235210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041482335.1|2235307_2235529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470137.1|2235618_2235822_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
WP_046559786.1|2235915_2236353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559787.1|2236657_2237755_+	acyltransferase	NA	NA	NA	NA	NA
WP_052749758.1|2237797_2238184_-	hypothetical protein	NA	F8WPL1	Bacillus_phage	48.4	4.0e-32
2244188:2244209	attR	TTATTTTATTTTTATTCTAAAA	NA	NA	NA	NA
>prophage 7
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	2265352	2284791	4105955	integrase,tail	Bacillus_phage(100.0%)	17	2265897:2265911	2273564:2273578
WP_046559813.1|2265352_2266018_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.0	2.0e-47
2265897:2265911	attL	TTTTTCTTTCTTTTT	NA	NA	NA	NA
WP_095836098.1|2266020_2266521_+	hypothetical protein	NA	A0A1P8CWR3	Bacillus_phage	68.7	1.2e-63
WP_022553075.1|2266517_2267228_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	64.7	6.0e-90
WP_046559814.1|2267268_2268072_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	56.6	1.0e-69
WP_046559815.1|2268087_2268489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022553073.1|2268560_2268917_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_046559816.1|2268916_2270251_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	34.2	1.1e-25
WP_076983649.1|2270584_2270785_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	63.0	3.4e-11
WP_014417863.1|2270867_2271353_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.9	4.8e-59
WP_046559817.1|2271352_2271769_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.9	3.6e-47
WP_014472041.1|2271782_2272784_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.7	2.2e-170
WP_046560223.1|2272828_2273044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559818.1|2273166_2273640_+	hypothetical protein	NA	O64047	Bacillus_phage	43.3	4.5e-25
2273564:2273578	attR	AAAAAGAAAGAAAAA	NA	NA	NA	NA
WP_046559819.1|2273707_2274388_+	hypothetical protein	NA	Q37974	Bacillus_phage	68.7	2.8e-76
WP_046559820.1|2274446_2281337_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	60.5	0.0e+00
WP_046559821.1|2281381_2282143_+	hypothetical protein	NA	A0A1P8CWP8	Bacillus_phage	78.8	1.0e-108
WP_046559822.1|2282157_2284791_+	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	70.4	0.0e+00
>prophage 8
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	2291043	2298099	4105955	holin	Bacillus_phage(100.0%)	11	NA	NA
WP_014417852.1|2291043_2291436_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	97.7	7.1e-61
WP_046559825.1|2291456_2291708_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	6.9e-33
WP_041482578.1|2292066_2292327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079892059.1|2292477_2293638_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	9.9e-34
WP_046559826.1|2293801_2295052_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	92.1	2.1e-223
WP_038458779.1|2295044_2295377_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	1.8e-41
WP_076983650.1|2295593_2296352_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_038458783.1|2296479_2296683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458785.1|2296701_2297043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076982784.1|2297245_2297335_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_014470070.1|2297640_2298099_-	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.2	5.2e-71
>prophage 9
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	2404832	2411085	4105955		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003153378.1|2404832_2405426_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2405415_2406171_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2406378_2406468_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|2406555_2407077_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2407142_2407517_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2407633_2408098_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153371.1|2408130_2409327_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_046559850.1|2409341_2409989_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	3.3e-39
WP_024085544.1|2409969_2411085_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	5.2e-56
>prophage 10
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	2766461	2874616	4105955	head,portal,tail,protease,tRNA,capsid,terminase,coat,plate,holin	Bacillus_phage(60.38%)	110	NA	NA
WP_044053490.1|2766461_2767226_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.5	3.1e-20
WP_003152727.1|2767552_2769331_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_003152726.1|2769345_2770620_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046559920.1|2771277_2772840_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	1.5e-13
WP_025853068.1|2772867_2773311_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|2773323_2775528_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2775685_2776198_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_046559921.1|2776203_2778564_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.4e-90
WP_003152709.1|2778619_2778946_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003152707.1|2779009_2779507_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_003152704.1|2779637_2781857_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
WP_003152702.1|2781893_2782190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152700.1|2782305_2783862_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_003152699.1|2783869_2784526_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|2784692_2785079_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2785130_2785391_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014305500.1|2785421_2786567_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|2786593_2787622_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|2787647_2787848_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|2787840_2788845_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|2788855_2789461_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_046559922.1|2789595_2790105_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_046559923.1|2790235_2790475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152677.1|2790488_2791082_-	sporulation protein	NA	NA	NA	NA	NA
WP_014305504.1|2791229_2792435_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_046559924.1|2792561_2793665_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_046559925.1|2793666_2794515_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_046559926.1|2794496_2796062_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_015387895.1|2796167_2797319_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	27.5	2.1e-31
WP_014305508.1|2797315_2797858_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003152668.1|2797887_2798745_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2798758_2799202_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003152665.1|2799255_2800542_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003152664.1|2800573_2801152_-	sporulation protein	NA	NA	NA	NA	NA
WP_003152662.1|2801469_2801754_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2801766_2802108_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2802110_2802419_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003152659.1|2802564_2803431_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_007408168.1|2803423_2804227_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2804354_2805158_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|2805160_2805841_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003152650.1|2805894_2806413_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003152649.1|2806409_2807273_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2807303_2808317_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_046559927.1|2809144_2810257_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	96.5	9.7e-204
WP_046559928.1|2810556_2812137_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	55.2	8.4e-68
WP_046559929.1|2812151_2812541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559930.1|2812779_2813613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559931.1|2813646_2814618_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.1	2.6e-64
WP_046559932.1|2814673_2814937_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	3.2e-25
WP_046559933.1|2814952_2815231_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	67.4	6.2e-27
WP_013353491.1|2815309_2815498_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_046559934.1|2815494_2815857_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	5.4e-55
WP_046559935.1|2815853_2817086_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	85.9	1.2e-146
WP_046559936.1|2817098_2819663_-	peptidase G2	NA	D6R401	Bacillus_phage	57.1	3.8e-288
WP_046559937.1|2819713_2821417_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.7	4.6e-181
WP_017417292.1|2821431_2822271_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	57.9	1.1e-93
WP_046559938.1|2822264_2826752_-|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.8	7.2e-64
WP_046559939.1|2826957_2827326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559940.1|2827384_2827999_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	34.1	8.4e-24
WP_046559941.1|2828013_2828397_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014305139.1|2828393_2828792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418480.1|2828788_2829106_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
WP_046559942.1|2829095_2829398_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	8.9e-11
WP_046559943.1|2829415_2829823_-	phage protein	NA	D6R3Z0	Bacillus_phage	48.2	9.8e-13
WP_046559944.1|2829850_2831143_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.8	1.7e-90
WP_046559945.1|2831181_2831808_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.2	4.8e-83
WP_046559946.1|2831770_2833051_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	5.8e-152
WP_046559947.1|2833238_2834948_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.4	4.6e-205
WP_046559948.1|2834944_2835460_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_046559950.1|2835687_2836053_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	6.1e-30
WP_046560232.1|2836122_2836398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559951.1|2836793_2837528_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_046559951.1|2837654_2838389_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_046559952.1|2838518_2838731_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	45.0	8.4e-08
WP_019260088.1|2839559_2839937_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	99.2	9.0e-61
WP_046559953.1|2840074_2840275_-	hypothetical protein	NA	Q38589	Bacillus_phage	81.8	3.0e-23
WP_046559955.1|2840451_2840967_-	hypothetical protein	NA	D6R425	Bacillus_phage	97.7	4.5e-95
WP_046559956.1|2840996_2841536_-	nuclease	NA	Q9ZXC2	Bacillus_phage	99.4	5.0e-97
WP_046559957.1|2841532_2841970_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	93.8	2.0e-75
WP_046559958.1|2842170_2844588_-	DNA primase	NA	D6R422	Bacillus_phage	93.2	0.0e+00
WP_046559959.1|2844649_2845087_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	96.6	1.1e-78
WP_014479857.1|2845107_2845422_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
WP_046559960.1|2845411_2846347_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	97.1	1.8e-171
WP_046559961.1|2846350_2846905_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	95.7	2.0e-93
WP_046559962.1|2847105_2847375_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	98.9	8.4e-45
WP_046559963.1|2847600_2847873_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	100.0	2.3e-42
WP_046559964.1|2848134_2848569_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	99.3	3.0e-68
WP_015968241.1|2848582_2849029_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	100.0	2.4e-81
WP_046559965.1|2849074_2850499_+	recombinase family protein	NA	Q9T200	Bacillus_phage	99.4	2.4e-268
WP_076983652.1|2850502_2850919_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003152645.1|2850950_2851520_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_046559966.1|2851660_2852662_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_044053500.1|2852788_2853541_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014305515.1|2853680_2854973_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014305516.1|2855031_2857674_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	3.7e-161
WP_003152639.1|2858126_2858318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012118110.1|2858332_2859355_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_046559967.1|2859388_2861338_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_003152633.1|2861470_2862760_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003152632.1|2862788_2863763_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_046559968.1|2863765_2864548_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003152630.1|2864537_2865479_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003152629.1|2865513_2866344_-	cytochrome c	NA	NA	NA	NA	NA
WP_015387890.1|2866351_2867719_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014305520.1|2867913_2868405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|2868437_2869025_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_025853133.1|2869021_2871346_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.3	2.3e-183
WP_032856936.1|2871545_2873204_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	2.5e-14
WP_003152620.1|2873353_2874616_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 11
NZ_CP011346	Bacillus velezensis strain JJ-D34 chromosome, complete genome	4105955	3781241	3826361	4105955	protease,coat	Cafeteria_roenbergensis_virus(11.11%)	47	NA	NA
WP_014306025.1|3781241_3781901_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3782006_3782195_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003151040.1|3782232_3782652_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151037.1|3783042_3784422_+	amino acid permease	NA	NA	NA	NA	NA
WP_003151036.1|3784485_3784986_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003151035.1|3785025_3786327_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3786487_3786712_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003151032.1|3786916_3787690_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151030.1|3787990_3788266_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151028.1|3788266_3788821_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_003151027.1|3788918_3789839_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	8.4e-36
WP_003151025.1|3789835_3790789_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014306028.1|3790778_3791615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014306029.1|3791605_3792403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151021.1|3792371_3793295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3793343_3793523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151016.1|3793674_3794538_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003151014.1|3794584_3795484_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_014306030.1|3795599_3796577_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3796613_3797585_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|3797847_3798612_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_024085927.1|3798731_3799511_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014306032.1|3799527_3800727_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014306033.1|3800739_3801921_-	MFS transporter	NA	NA	NA	NA	NA
WP_014306034.1|3801917_3803336_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003151003.1|3803353_3804115_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.4e-22
WP_003151000.1|3804111_3804822_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003150997.1|3804811_3805426_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_014306036.1|3805587_3806826_-	MFS transporter	NA	NA	NA	NA	NA
WP_014306037.1|3807048_3808251_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	6.4e-28
WP_014306038.1|3808283_3809702_-	amino acid permease	NA	NA	NA	NA	NA
WP_014306039.1|3809726_3811409_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014306040.1|3811480_3813028_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003150991.1|3813235_3814522_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_025853628.1|3814707_3815169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387544.1|3815384_3815840_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024085934.1|3815836_3816685_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
WP_014306044.1|3816705_3817653_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	7.7e-69
WP_003150981.1|3817655_3818393_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_024085935.1|3818420_3819425_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306047.1|3819426_3820170_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024085936.1|3820159_3821281_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003150977.1|3821280_3822144_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014306049.1|3822144_3823314_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_014306050.1|3823335_3824760_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_014306051.1|3824764_3825535_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_003150971.1|3825815_3826361_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
