The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	2289010	2335066	5584358	capsid,terminase,tail,transposase,integrase,head,holin	Salmonella_phage(30.77%)	59	2331435:2331449	2337542:2337556
WP_046481417.1|2289010_2290183_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	1.2e-199
WP_044258215.1|2290626_2290875_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	75.6	1.7e-28
WP_046481418.1|2291663_2291846_-	hypothetical protein	NA	A0A0H4TGH1	Klebsiella_phage	55.9	3.8e-09
WP_046481419.1|2291874_2292117_-	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	61.8	4.4e-21
WP_052746917.1|2292109_2292409_-	hypothetical protein	NA	I6PBW9	Pseudomonas_phage	42.2	2.2e-06
WP_046481420.1|2293362_2294325_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.0	2.3e-116
WP_046481421.1|2294332_2297044_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	85.4	0.0e+00
WP_046481422.1|2297043_2297442_-	hypothetical protein	NA	S4TR39	Salmonella_phage	81.1	2.8e-60
WP_046481423.1|2297448_2298033_-	hypothetical protein	NA	S4TND4	Salmonella_phage	88.7	3.2e-97
WP_046481424.1|2298032_2298626_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	3.1e-108
WP_046481425.1|2298792_2299008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046481426.1|2298999_2299365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046481427.1|2299410_2302740_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	68.4	0.0e+00
WP_046481428.1|2302798_2303212_-	lipoprotein	NA	G8C7Q7	Escherichia_phage	48.9	2.7e-34
WP_046481429.1|2303266_2303545_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	88.0	3.5e-38
WP_046481430.1|2303568_2303937_-|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	76.0	1.5e-49
WP_046481431.1|2303947_2304391_-	hypothetical protein	NA	S4TNM8	Salmonella_phage	94.6	2.4e-73
WP_046481432.1|2304449_2304797_-	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	71.7	9.5e-41
WP_096147877.1|2305126_2306246_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_046481433.1|2306464_2306815_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	73.3	7.8e-43
WP_046481434.1|2306827_2307154_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	90.7	4.0e-49
WP_167337381.1|2309548_2309716_-	hypothetical protein	NA	S4TR49	Salmonella_phage	81.8	7.0e-18
WP_046481437.1|2309754_2311689_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	83.3	3.6e-299
WP_046481438.1|2311747_2313406_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	71.4	1.4e-235
WP_046481440.1|2314234_2314600_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	83.3	1.7e-48
WP_046481441.1|2314592_2315186_-	hypothetical protein	NA	S4TR53	Salmonella_phage	72.4	4.5e-83
WP_046481442.1|2315167_2316625_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	93.4	7.3e-276
WP_046481443.1|2316636_2317110_-	hypothetical protein	NA	K7PH02	Enterobacteria_phage	88.4	3.4e-73
WP_046481444.1|2317254_2317464_-	hypothetical protein	NA	Q38201	Enterobacteria_phage	85.7	4.0e-26
WP_046481445.1|2317468_2317804_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	67.0	2.5e-38
WP_046481446.1|2317865_2318063_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	93.8	4.4e-27
WP_046481447.1|2318435_2319005_-	antirepressor	NA	A0A088CD55	Shigella_phage	72.9	2.0e-80
WP_080949924.1|2319397_2319673_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	68.9	5.4e-23
WP_046481448.1|2319679_2320294_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.9	2.7e-91
WP_046481449.1|2320451_2320733_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	75.0	2.0e-33
WP_046481450.1|2320719_2321115_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	96.2	5.0e-62
WP_046481451.1|2321656_2321869_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_046481452.1|2322472_2323276_-	antitermination protein	NA	F1C595	Cronobacter_phage	77.5	9.3e-116
WP_046481453.1|2323275_2323641_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	61.4	5.1e-37
WP_046481454.1|2323627_2325010_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	69.6	1.8e-175
WP_046481455.1|2325006_2325888_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	65.7	7.2e-85
WP_046481456.1|2325902_2326814_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	67.8	1.5e-98
WP_032635108.1|2326810_2327107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046481457.1|2327132_2327351_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046481458.1|2327464_2328172_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	74.5	3.3e-96
WP_046481459.1|2328544_2328748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046481460.1|2328744_2329164_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	54.1	1.5e-08
WP_046481461.1|2329351_2329552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046481462.1|2329541_2329898_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	49.6	7.0e-23
WP_046481463.1|2329897_2330149_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	71.4	2.5e-27
WP_046481464.1|2330335_2330770_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	72.3	1.5e-51
WP_046498055.1|2330810_2331329_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	82.0	7.0e-80
WP_046481465.1|2331341_2332088_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	85.0	3.0e-116
2331435:2331449	attL	CAGCGGCCAGACGGA	NA	NA	NA	NA
WP_046481466.1|2332087_2332429_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	75.2	6.2e-45
WP_046481467.1|2332429_2332654_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	64.4	2.3e-16
WP_046481468.1|2332754_2333216_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	51.9	6.7e-42
WP_155403991.1|2333215_2333575_+	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	49.1	7.8e-22
WP_044257011.1|2333712_2333904_+	AlpA family phage regulatory protein	NA	A0A0M4RTZ2	Salmonella_phage	78.7	2.3e-20
WP_044257009.1|2333884_2335066_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	89.8	3.0e-211
2337542:2337556	attR	CAGCGGCCAGACGGA	NA	NA	NA	NA
>prophage 2
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	2410309	2420264	5584358	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_046481527.1|2410309_2411713_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	30.1	6.6e-32
WP_046481528.1|2411709_2412432_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.0	1.9e-30
WP_042318041.1|2412599_2413961_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.1e-206
WP_046481530.1|2414358_2415258_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	1.0e-14
WP_080949927.1|2415706_2417911_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.3	1.7e-21
WP_046481532.1|2417921_2420264_+	chitinase	NA	Q5ZGC9	Flavobacterium_phage	37.6	6.9e-18
>prophage 3
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	2453202	2461621	5584358	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_046481571.1|2453202_2455236_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_046481573.1|2455435_2455894_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	67.3	3.9e-50
WP_046481574.1|2455939_2456410_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	75.5	1.3e-61
WP_046481576.1|2456456_2457176_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_046481577.1|2457168_2458857_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.4	4.8e-279
WP_046481579.1|2459079_2459811_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.0	1.5e-104
WP_042318015.1|2459870_2459978_+	protein YohO	NA	NA	NA	NA	NA
WP_046481580.1|2459958_2460690_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046481582.1|2460673_2461621_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	1.3e-07
>prophage 4
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	3569346	3647528	5584358	plate,protease,transposase	Staphylococcus_phage(33.33%)	52	NA	NA
WP_080949964.1|3569346_3570318_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046487193.1|3570281_3572003_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_046487196.1|3572021_3572402_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_046487199.1|3572401_3572887_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_046487201.1|3572904_3574386_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_046487203.1|3574403_3574916_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_052746946.1|3575285_3575756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046487205.1|3575757_3577095_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046487208.1|3577078_3577825_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_046487213.1|3577821_3581385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046487218.1|3581372_3582293_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_046487223.1|3582289_3582682_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_046487227.1|3582741_3584091_-	MFS transporter	NA	NA	NA	NA	NA
WP_046487233.1|3584111_3585029_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_046487238.1|3585040_3586237_-	CoA transferase	NA	NA	NA	NA	NA
WP_046487242.1|3586472_3588398_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_046487244.1|3588549_3589311_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046487247.1|3589323_3590940_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_046487250.1|3590950_3592330_-	MFS transporter	NA	NA	NA	NA	NA
WP_046487254.1|3592660_3594628_-	YjhG/YagF family D-xylonate dehydratase	NA	NA	NA	NA	NA
WP_046487256.1|3594887_3595238_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_046487259.1|3595250_3596843_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_046498293.1|3596951_3597908_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_046487262.1|3598157_3599711_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	1.3e-20
WP_046487265.1|3599704_3600754_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_046487268.1|3600753_3601752_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000155278.1|3601780_3602803_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_046487278.1|3602831_3603707_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_046487280.1|3603755_3604046_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_046487282.1|3604057_3604807_+	epimerase	NA	NA	NA	NA	NA
WP_046487283.1|3605169_3606864_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_052746947.1|3606876_3617763_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	40.7	3.0e-31
WP_080950078.1|3618817_3618970_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_052746949.1|3619107_3620535_+	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_080950079.1|3620693_3621305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052746950.1|3621983_3624254_+	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_046487290.1|3624250_3624589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155404014.1|3624785_3625130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155404052.1|3625126_3625246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046487295.1|3625242_3625731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046487298.1|3625931_3626186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046487300.1|3626877_3627477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080950080.1|3627617_3627980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096147877.1|3628596_3629717_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_046487307.1|3630859_3631453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046487310.1|3631999_3633151_+	lactonase family protein	NA	NA	NA	NA	NA
WP_046487311.1|3633280_3633685_+	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_080721708.1|3634075_3634678_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_046487313.1|3634674_3635277_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_046487315.1|3635288_3638930_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_046487317.1|3642835_3645433_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001193068.1|3645443_3647528_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
>prophage 5
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	4604688	4663177	5584358	capsid,lysis,terminase,portal,tail,plate,integrase,head,protease	Escherichia_phage(31.71%)	69	4607434:4607475	4639751:4639792
WP_046493226.1|4604688_4606062_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	6.5e-16
WP_001033731.1|4606058_4606757_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_046498482.1|4606907_4607408_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4607434:4607475	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_046493307.1|4607598_4608579_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	85.0	8.9e-161
WP_046493310.1|4608648_4608942_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	73.2	4.2e-34
WP_046493313.1|4609137_4609410_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	74.4	2.3e-34
WP_046493317.1|4609579_4610080_+	hypothetical protein	NA	M1SV55	Escherichia_phage	75.3	5.3e-69
WP_046493320.1|4610143_4610476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493322.1|4610503_4610815_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	43.6	6.8e-14
WP_046493325.1|4610801_4610993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493326.1|4610992_4611268_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	62.6	1.5e-25
WP_046493327.1|4611257_4613552_+	replication endonuclease	NA	Q858T4	Yersinia_virus	74.5	0.0e+00
WP_052746970.1|4613552_4613858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493329.1|4613858_4614095_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	66.7	6.9e-19
WP_046493332.1|4614307_4615423_+	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	25.7	8.7e-19
WP_046493333.1|4615426_4616446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493335.1|4616448_4617456_-	DNA adenine methylase	NA	M1HZJ7	Paramecium_bursaria_Chlorella_virus	29.0	1.3e-10
WP_023223238.1|4617849_4618887_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.3	1.2e-163
WP_046493337.1|4618886_4620656_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.3	2.9e-287
WP_046493340.1|4620820_4621684_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.6	3.1e-101
WP_046493343.1|4621715_4622876_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.8	8.2e-129
WP_046493346.1|4622879_4623638_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.3	3.0e-79
WP_000177982.1|4623735_4624236_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_001100637.1|4624235_4624439_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000524754.1|4624429_4624651_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_046493353.1|4624634_4625144_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	83.2	1.6e-76
WP_046493356.1|4625140_4625554_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.1	1.2e-34
WP_044701608.1|4625661_4626129_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	70.3	9.7e-57
WP_046493363.1|4626121_4626577_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.5	8.6e-50
WP_046493365.1|4626590_4627334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493367.1|4627408_4628050_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.6	1.7e-96
WP_000213440.1|4628046_4628394_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
WP_046493369.1|4628398_4629307_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.8	7.8e-135
WP_046493372.1|4629299_4629911_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.6	6.3e-96
WP_046493375.1|4629907_4631119_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	74.4	1.7e-105
WP_046493377.1|4631102_4631288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493379.1|4631351_4631783_-|tail	tail assembly chaperone	tail	A0A0M4S6V4	Salmonella_phage	56.1	6.9e-25
WP_046493384.1|4632405_4632984_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.2	1.0e-79
WP_046493386.1|4633048_4634236_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.3	1.2e-188
WP_023223221.1|4634248_4634767_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_044701589.1|4634829_4635111_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_000763326.1|4635143_4635263_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_046493389.1|4635255_4637685_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	75.9	1.1e-263
WP_023252154.1|4637696_4638161_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	75.5	5.9e-62
WP_046493395.1|4638163_4639357_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.9	2.3e-166
WP_052746971.1|4639419_4639641_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	72.6	2.1e-25
WP_046493396.1|4639873_4640776_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4639751:4639792	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_046493399.1|4640960_4641923_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_046493401.1|4642126_4643116_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_046493404.1|4643219_4643975_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_046493407.1|4644240_4645575_+	MFS transporter	NA	NA	NA	NA	NA
WP_046493410.1|4645585_4646536_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_046493412.1|4646554_4647595_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_042325679.1|4647657_4648380_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046493415.1|4648465_4649770_+	anion permease	NA	NA	NA	NA	NA
WP_046493416.1|4649882_4651355_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_046493417.1|4651397_4652165_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_046493418.1|4652394_4652997_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_046493420.1|4653097_4653517_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_046493421.1|4653560_4654307_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_046493423.1|4654403_4655414_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_046493424.1|4655573_4657082_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_046493425.1|4657104_4657950_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	2.6e-15
WP_155404026.1|4658338_4658584_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_046493430.1|4658796_4659540_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_042998924.1|4659731_4660217_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_046493433.1|4660309_4661239_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_046493436.1|4661305_4662637_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	30.3	4.9e-45
WP_046493441.1|4662646_4663177_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 6
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	4834119	4894306	5584358	tRNA,capsid,tail,terminase,plate,integrase,transposase,head,protease	Pseudomonas_phage(36.36%)	72	4829750:4829767	4893691:4893708
4829750:4829767	attL	TGTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_046493906.1|4834119_4835115_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_046493907.1|4835248_4835491_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_046493910.1|4835779_4836763_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_046493911.1|4836827_4838243_+	replicative DNA helicase	NA	O80281	Escherichia_phage	76.6	1.2e-198
WP_046493915.1|4838392_4839472_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	2.0e-28
WP_046493918.1|4839665_4840859_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_046493920.1|4841092_4841806_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_046493923.1|4842054_4842405_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_046493924.1|4842445_4845268_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.4	1.0e-311
WP_046493925.1|4845520_4846048_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.5	6.0e-55
WP_003030312.1|4846305_4846866_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	72.4	5.2e-73
WP_003030314.1|4847071_4847494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046493926.1|4847886_4848318_+|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	41.6	1.1e-17
WP_046493927.1|4848289_4848883_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	56.1	1.0e-55
WP_080950100.1|4848882_4849689_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	50.3	9.6e-36
WP_046493928.1|4849769_4850342_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	44.9	1.7e-34
WP_046493929.1|4850338_4851406_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	43.9	1.1e-66
WP_046493930.1|4851405_4851756_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	61.7	3.6e-32
WP_046493931.1|4851847_4852435_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	47.5	5.9e-35
WP_046493932.1|4852418_4853645_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.8	2.9e-76
WP_046493933.1|4853628_4854960_-	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	28.8	9.6e-41
WP_046493934.1|4854956_4857167_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_046493935.1|4857301_4857694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493936.1|4857694_4858069_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	55.7	2.5e-31
WP_046493937.1|4858082_4859501_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	45.8	1.0e-96
WP_046493938.1|4859487_4859706_-	DUF2635 domain-containing protein	NA	A0A2H4JED6	uncultured_Caudovirales_phage	46.6	1.1e-05
WP_046493939.1|4859692_4860352_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.8	6.4e-22
WP_046493940.1|4860351_4860780_-	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	34.3	1.5e-11
WP_046493941.1|4860783_4861239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493942.1|4861238_4862147_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	63.2	5.8e-106
WP_046493943.1|4862158_4862551_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	45.0	6.5e-22
WP_046493944.1|4862562_4863660_-|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	40.6	1.3e-59
WP_046493945.1|4863882_4864425_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	40.9	5.3e-22
WP_046493946.1|4864421_4865681_-|capsid	minor capsid protein	capsid	H6V8N8	Pseudomonas_phage	36.9	6.5e-55
WP_046493947.1|4865667_4867245_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	46.9	5.7e-125
WP_046493948.1|4867248_4868904_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	64.9	2.0e-205
WP_046493949.1|4868908_4869268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493950.1|4869264_4869498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493951.1|4869490_4869991_-	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	54.6	4.0e-48
WP_046493952.1|4869992_4870277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493953.1|4870273_4870516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493954.1|4870524_4871157_-	hypothetical protein	NA	A0A2D1GNR2	Pseudomonas_phage	33.0	6.0e-17
WP_080950011.1|4871128_4871380_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	55.0	4.2e-14
WP_046493955.1|4871376_4872021_-	glycoside hydrolase family 19 protein	NA	A0A2D1GNI0	Pseudomonas_phage	62.9	5.6e-63
WP_046493956.1|4872099_4872600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493957.1|4872612_4873047_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.2	1.2e-27
WP_046493958.1|4872991_4873468_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	66.7	2.8e-43
WP_052746975.1|4873702_4873921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493959.1|4873917_4874133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493960.1|4874125_4874491_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	48.5	3.9e-21
WP_052746976.1|4874487_4874991_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	50.9	1.1e-24
WP_046493961.1|4874987_4875710_-	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	31.9	5.2e-17
WP_155404029.1|4875714_4876164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493962.1|4876241_4876433_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	66.7	1.1e-14
WP_046493963.1|4876413_4876656_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046493964.1|4876657_4877302_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	61.2	4.8e-70
WP_046493965.1|4877291_4877489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052746978.1|4877490_4877712_-	hypothetical protein	NA	A0A0S3UG15	Pseudomonas_phage	34.3	8.2e-06
WP_046493966.1|4877722_4878013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046493967.1|4878023_4878917_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.1	1.2e-98
WP_046493968.1|4878924_4880979_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.8	1.7e-169
WP_046493969.1|4881001_4881271_-	helix-turn-helix domain-containing protein	NA	A0A2P9JZG5	Alteromonadaceae_phage	57.7	2.2e-21
WP_052747015.1|4881441_4882182_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	38.3	3.6e-29
WP_046493970.1|4882543_4885252_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.7	1.1e-67
WP_042999048.1|4885808_4886090_-	YjcB family protein	NA	NA	NA	NA	NA
WP_046493971.1|4886685_4888272_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_046493972.1|4888274_4888598_-	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_046493973.1|4888683_4889148_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_046493974.1|4889402_4890071_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_046493975.1|4890419_4891769_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	72.0	3.6e-160
WP_046493976.1|4891917_4893564_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_046493977.1|4893814_4894306_+|transposase	transposase	transposase	NA	NA	NA	NA
4893691:4893708	attR	TGTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 7
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	4956727	4962996	5584358	transposase	Escherichia_phage(100.0%)	6	NA	NA
WP_001310555.1|4956727_4957744_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_046494054.1|4957947_4960380_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	83.2	0.0e+00
WP_046494056.1|4960393_4961020_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
WP_046494058.1|4961012_4961786_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	79.8	7.9e-104
WP_046494060.1|4961869_4962466_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	69.7	1.2e-78
WP_046494062.1|4962462_4962996_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	57.4	1.1e-48
>prophage 8
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	5077387	5085749	5584358	transposase	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_042999128.1|5077387_5077903_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	34.8	2.4e-16
WP_042999129.1|5078182_5079406_+	MFS transporter	NA	NA	NA	NA	NA
WP_000968905.1|5079434_5079932_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	38.3	2.4e-21
WP_042999130.1|5080006_5080435_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_042999131.1|5080447_5081737_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.3e-172
WP_046494309.1|5081784_5083536_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_046494310.1|5083553_5083916_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_072134376.1|5083962_5084316_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.2	6.9e-23
WP_100245182.1|5084628_5085749_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	42.9	7.3e-50
>prophage 9
NZ_CP011132	Citrobacter amalonaticus Y19 chromosome, complete genome	5584358	5283258	5333830	5584358	tRNA,capsid,tail,transposase,integrase,head	uncultured_Caudovirales_phage(18.75%)	51	5292425:5292471	5334765:5334811
WP_046495716.1|5283258_5283591_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_167337382.1|5283668_5285048_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.1e-31
WP_046495720.1|5285478_5286999_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	36.1	6.4e-33
WP_046495725.1|5287309_5288875_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	1.7e-12
WP_162200270.1|5288871_5289432_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155404060.1|5289659_5290424_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_080950026.1|5290509_5290833_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_046498607.1|5291485_5292022_+	fimbrial protein	NA	NA	NA	NA	NA
5292425:5292471	attL	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_046495753.1|5292668_5293985_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.0	1.0e-34
WP_046498612.1|5293989_5294604_+	Fic family protein	NA	NA	NA	NA	NA
WP_100247371.1|5294600_5294756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046495757.1|5294884_5295325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080950027.1|5295659_5295890_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_046495760.1|5296023_5297436_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_046498619.1|5297756_5298383_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_080950104.1|5298473_5299661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162200225.1|5300653_5300824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046495765.1|5301030_5301801_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_007372177.1|5301904_5303554_-	glycerone kinase	NA	NA	NA	NA	NA
WP_023336797.1|5303628_5305047_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372179.1|5305057_5305690_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_020077889.1|5305700_5306771_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001310555.1|5307602_5308619_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_046495790.1|5309506_5310916_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_046495793.1|5310918_5312799_-	ATP-dependent endonuclease	NA	E5E3R2	Burkholderia_phage	71.7	6.3e-248
WP_046495798.1|5313518_5316797_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.3	3.8e-232
WP_046495804.1|5317145_5318009_+	GTPase family protein	NA	NA	NA	NA	NA
WP_046495809.1|5318106_5318940_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	3.3e-47
WP_046495813.1|5319141_5319846_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_046495819.1|5319842_5320457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046495825.1|5320545_5320956_+	hypothetical protein	NA	A0A1B2IBY1	Erwinia_phage	47.8	5.8e-29
WP_046495830.1|5321033_5321270_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_046495834.1|5321348_5321807_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	34.6	4.8e-16
WP_046495838.1|5321822_5322299_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691995.1|5322307_5322529_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_046495841.1|5322547_5322865_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_048215514.1|5322885_5323227_+	toxin	NA	NA	NA	NA	NA
WP_046495848.1|5323342_5324176_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_046495851.1|5324497_5325934_+|integrase	integrase family protein	integrase	K7PHM9	Enterobacterial_phage	25.7	5.0e-11
WP_046495854.1|5325923_5326607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046495857.1|5326747_5326954_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080950105.1|5327435_5327627_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_046495862.1|5327760_5328012_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	58.4	7.4e-19
WP_046495865.1|5328004_5328196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046275065.1|5328188_5328497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046275066.1|5328493_5328862_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	89.3	2.9e-56
WP_046275067.1|5328858_5330658_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.8	4.6e-131
WP_046275068.1|5331198_5332239_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.1	1.3e-64
WP_046275069.1|5332248_5332590_+|head	head decoration protein	head	NA	NA	NA	NA
WP_046495875.1|5332600_5332984_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_052746986.1|5333254_5333830_+|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	73.8	2.0e-72
5334765:5334811	attR	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
>prophage 1
NZ_CP011133	Citrobacter amalonaticus Y19 plasmid unnamed, complete sequence	290993	178852	227411	290993	transposase	uncultured_Caudovirales_phage(35.29%)	49	NA	NA
WP_046499206.1|178852_179278_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	9.5e-51
WP_032409266.1|179290_180580_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	3.4e-168
WP_004206577.1|180624_180945_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
WP_016151343.1|181030_181729_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
WP_004206574.1|181857_182163_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|182173_183379_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_046499216.1|183554_184133_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	38.3	7.9e-24
WP_046499219.1|184291_187276_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.5	3.6e-306
WP_040133153.1|190453_191020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040133152.1|191016_191412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011711644.1|191435_191870_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020833625.1|191889_192690_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020833624.1|192701_194369_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.2	3.6e-37
WP_007642843.1|194406_194826_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_011711647.1|194829_195105_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_007642845.1|195160_195508_-	mercury transporter	NA	NA	NA	NA	NA
WP_046499251.1|195601_195988_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011711649.1|197092_198142_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_040133149.1|198261_198594_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	59.8	9.7e-27
WP_116967879.1|198686_199703_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_000528119.1|199811_200015_-	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_000974596.1|200107_200692_-	two-component system response regulator TtrR	NA	NA	NA	NA	NA
WP_080950116.1|200666_202400_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_077910396.1|202609_203362_+	tetrathionate reductase subunit TtrB	NA	NA	NA	NA	NA
WP_044864557.1|203362_204385_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_000002334.1|204377_207443_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
WP_046499266.1|207537_208350_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155404066.1|208418_209435_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_074091250.1|209665_210634_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	3.8e-180
WP_046499267.1|210786_213864_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	29.9	6.2e-51
WP_046499268.1|213954_214320_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046499270.1|214322_214802_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	48.1	1.7e-35
WP_046499272.1|214814_215183_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_046499274.1|215204_216965_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_046499276.1|216976_217471_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	40.0	2.7e-25
WP_046499277.1|217496_218564_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_046499278.1|218564_219515_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.9	5.6e-59
WP_046499281.1|219541_220042_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_046499284.1|220133_220703_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_046499287.1|220769_221516_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_046499290.1|221512_222427_+	cation transporter	NA	NA	NA	NA	NA
WP_046499295.1|222492_223089_-	formylmethanofuran dehydrogenase	NA	NA	NA	NA	NA
WP_080950117.1|223246_223474_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_046499575.1|223708_224704_+	permease	NA	NA	NA	NA	NA
WP_046499300.1|224731_224971_+	TM0996/MTH895 family glutaredoxin-like protein	NA	NA	NA	NA	NA
WP_046499302.1|224983_225349_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_046499305.1|225376_225763_+	DUF2703 domain-containing protein	NA	NA	NA	NA	NA
WP_011977766.1|225944_226280_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_046499309.1|226430_227411_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	97.9	7.5e-184
