The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN832404	Escherichia coli K-12 substr. AG100 chromosome I	4638126	247804	296488	4638126	integrase,transposase	Streptococcus_phage(20.0%)	49	262290:262349	296598:296657
WP_000006255.1|247804_248302_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248525_250265_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250209_250995_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|251065_252121_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252172_252466_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252468_252867_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252876_253329_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253634_253901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|253812_254370_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254426_255884_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|256144_256603_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256694_257939_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257996_258398_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258436_259492_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259779_260883_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260894_262148_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262290:262349	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262719_263061_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|263081_263399_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263417_263639_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263647_264124_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|264139_264598_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264695_264935_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|265011_265479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265501_265945_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|265944_266172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266575_267397_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267488_268352_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268680_269574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|269994_271146_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|273492_274509_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274716_276120_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|276106_277039_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|277147_278194_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279415_279754_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279776_280127_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280220_281375_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281669_282578_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|282592_284560_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284786_286169_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286180_287791_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287795_288554_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288692_289697_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290891_291623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291713_292340_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292611_293310_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293336_294191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294309_294534_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294530_294971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|295087_296488_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
296598:296657	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_LN832404	Escherichia coli K-12 substr. AG100 chromosome I	4638126	529430	582574	4638126	tRNA,terminase,lysis,integrase,transposase,protease	Enterobacteria_phage(52.17%)	59	564054:564100	582998:583044
WP_001157938.1|529430_530525_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|530593_531520_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|531749_532232_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|532309_533125_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001698076.1|533214_534996_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	2.1e-38
WP_000943544.1|535008_535785_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|535884_536763_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|536931_538386_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|538445_539807_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|539863_541165_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|541186_542332_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|542559_543345_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|543355_544591_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|544612_545662_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|545978_547646_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|547655_548915_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|548925_549741_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|549737_550631_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|550825_551893_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|551889_552399_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|552516_553239_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|553241_553736_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|553909_555295_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|555330_555852_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|555959_556172_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|556173_557040_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|557510_558053_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|558272_558965_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|558995_561599_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|561577_562618_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|562628_563144_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|563146_563779_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
564054:564100	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|564113_565277_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|565396_565660_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|565982_566078_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|566140_567302_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|567613_567946_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|567993_568143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|568200_569727_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|570191_570743_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570752_571550_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571666_571768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571764_572220_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|572219_572390_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|572382_572673_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572669_573032_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|573028_573169_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573254_573638_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|574035_575052_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001228695.1|575268_575451_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738492.1|575541_575835_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|576124_576535_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|576820_577027_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|577191_577386_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|577774_578320_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027248.1|578294_579038_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_071592175.1|579092_579719_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|580621_581371_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201845.1|581620_582574_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
582998:583044	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_LN832404	Escherichia coli K-12 substr. AG100 chromosome I	4638126	804356	851629	4638126	tail,terminase,head,capsid,integrase,holin,protease,portal	Enterobacteria_phage(74.19%)	63	802634:802649	824362:824377
802634:802649	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533640.1|804356_805427_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|805404_805623_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|805662_805830_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|805918_806200_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|806391_806940_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|806936_807158_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|807549_807741_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|807713_807896_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|807892_808573_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|808569_809355_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|809360_809657_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|809731_809875_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|809843_810008_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|810080_810449_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|810631_810832_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|811098_811581_+	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|811581_811905_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|812369_812804_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|812819_813659_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|813771_814485_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|814585_814786_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|814904_815198_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|815230_816130_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|816126_816828_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|816824_817115_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|817188_817629_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|817625_818498_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|818494_818668_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|818634_818817_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|818813_818984_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|818976_819588_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|819584_819791_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|819768_820434_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|820430_821054_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000783735.1|821730_822054_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|822037_822514_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_071828414.1|822600_824610_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.6	0.0e+00
824362:824377	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|824606_824813_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|824809_826411_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|826391_827711_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|827720_828053_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|828108_829134_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|829175_829574_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|829585_829939_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|829950_830529_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|830525_830921_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|830928_831669_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|831684_832107_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|832088_832523_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|832515_835077_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|835073_835403_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|835402_836101_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|836106_836850_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|836786_837419_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515496.1|837479_840878_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_001246632.1|840939_841560_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_001407643.1|841624_843949_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_016063193.1|843948_844533_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_000162952.1|844661_845894_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_000735931.1|846484_847375_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000889231.1|847371_848949_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000767389.1|849804_850281_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|850339_851629_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 4
NZ_LN832404	Escherichia coli K-12 substr. AG100 chromosome I	4638126	1633106	1652317	4638126	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1633106_1634567_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1634655_1635939_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1636543_1636657_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1636725_1636959_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1637275_1637866_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1637963_1638539_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1638538_1639501_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_046608202.1|1639451_1640021_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	6.7e-92
WP_001368374.1|1640409_1640643_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1640700_1641111_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1641262_1641436_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1641607_1641763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1641841_1641907_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1641909_1642098_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1642108_1642321_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1642683_1643181_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1643177_1643711_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1643707_1644019_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1644023_1644239_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1644992_1645208_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1645508_1645721_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1645775_1645865_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1646142_1646895_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1646908_1647958_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1647959_1648238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1648304_1648556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1648772_1648928_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1648999_1649287_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1649286_1649526_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1649550_1649856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1650058_1650391_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1650827_1650977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1651273_1651504_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1651587_1651995_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1652161_1652317_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_LN832404	Escherichia coli K-12 substr. AG100 chromosome I	4638126	2110161	2118832	4638126		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2110161_2111265_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2111272_2112520_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2112516_2113074_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2113073_2113955_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2114012_2114912_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2114911_2115997_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2116369_2117263_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2117437_2118832_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 6
NZ_LN832404	Escherichia coli K-12 substr. AG100 chromosome I	4638126	2468176	2479386	4638126	tail,integrase	Enterobacteria_phage(53.33%)	16	2466151:2466167	2483061:2483077
2466151:2466167	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2468176_2469109_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2469420_2470578_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2470730_2471093_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2471089_2472010_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2472006_2473338_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2473372_2473654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2473952_2474393_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2474419_2474938_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2474987_2475263_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2475262_2475757_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2476479_2476842_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2476907_2477732_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2477859_2478396_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2478386_2478749_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2478748_2479054_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2479185_2479386_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2483061:2483077	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_LN832404	Escherichia coli K-12 substr. AG100 chromosome I	4638126	2853396	2860535	4638126		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2853396_2855958_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2856063_2856720_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2856770_2857538_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2857733_2858642_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2858638_2859805_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2859896_2860535_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
