The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010444	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4609629	1010830	1059514	4609629	integrase,transposase	Streptococcus_phage(20.0%)	49	1025316:1025375	1059624:1059683
WP_000006255.1|1010830_1011328_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1011551_1013291_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|1013235_1014021_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1014091_1015147_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1015198_1015492_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1015494_1015893_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1015902_1016355_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1016660_1016927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1016859_1017396_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1017452_1018910_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1019170_1019629_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1019720_1020965_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1021022_1021424_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1021462_1022518_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1022805_1023909_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1023920_1025174_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1025316:1025375	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1025745_1026087_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1026107_1026425_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1026443_1026665_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1026673_1027150_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1027165_1027624_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1027721_1027961_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1028037_1028505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1028527_1028971_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1028970_1029198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1029601_1030423_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1030514_1031378_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1031706_1032600_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1033020_1034172_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1036518_1037535_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1037742_1039146_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1039132_1040065_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1040173_1041220_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1042441_1042780_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1042802_1043153_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|1043246_1044401_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1044695_1045604_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1045618_1047586_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|1047812_1049195_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|1049206_1050817_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1050821_1051580_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1051718_1052723_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1053917_1054649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1054739_1055366_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1055637_1056336_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1056362_1057217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1057335_1057560_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1057556_1057997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1058113_1059514_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1059624:1059683	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP010444	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4609629	1281463	1344422	4609629	lysis,terminase,integrase,protease,tRNA,transposase	Enterobacteria_phage(50.0%)	66	1327080:1327126	1348382:1348428
WP_001295836.1|1281463_1282087_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1282057_1282744_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1282740_1285155_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1285585_1289866_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1289905_1290274_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1290964_1291225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1292456_1293551_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1293619_1294546_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1294775_1295258_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1295335_1296151_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1296240_1298022_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1298034_1298811_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1298910_1299789_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1299957_1301412_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1301471_1302833_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1302889_1304191_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1304212_1305358_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1305585_1306371_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1306381_1307617_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1307638_1308688_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1309004_1310672_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1310681_1311941_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1311951_1312767_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1312763_1313657_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1313851_1314919_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1314915_1315425_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1315542_1316265_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1316267_1316762_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1316935_1318321_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1318356_1318878_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1318985_1319198_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1319199_1320066_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1320536_1321079_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1321298_1321991_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1322021_1324625_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1324603_1325644_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1325654_1326170_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1326172_1326805_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1327080:1327126	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1327139_1328303_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1328422_1328686_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1329008_1329104_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1329166_1329466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1329462_1330329_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1330639_1330972_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1331019_1331169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1331226_1332753_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1333217_1333769_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1333778_1334576_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1334692_1334794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1334790_1335246_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1335245_1335416_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1335408_1335699_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1335695_1336058_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1336054_1336195_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1336280_1336664_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1337061_1338078_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1338082_1339150_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1339722_1339938_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1339937_1340435_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1340651_1340834_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1340924_1341218_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1341508_1341919_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1342204_1342411_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1342575_1342770_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1343158_1343704_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1343678_1344422_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1348382:1348428	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP010444	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4609629	2141642	2182460	4609629	lysis,tail,integrase,tRNA,transposase	Escherichia_phage(45.16%)	43	2142789:2142807	2173164:2173182
WP_010723085.1|2141642_2142659_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
2142789:2142807	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|2142931_2143189_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2143238_2144189_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2144340_2145093_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|2145287_2145803_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2145813_2147340_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|2147376_2148822_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|2148821_2150132_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|2150307_2151216_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2151545_2152109_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2152129_2153362_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2153616_2154600_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2155077_2156451_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2156579_2157515_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2157566_2158802_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2158803_2159019_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2159097_2159307_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2159299_2159494_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2159550_2160360_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2160352_2162953_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2163054_2163330_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2163404_2163575_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2163574_2163796_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2164237_2164726_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2164722_2164878_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2165331_2165808_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2165931_2166228_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2166250_2166673_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2166685_2167543_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2167549_2168296_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2168318_2168879_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2168966_2169152_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2169348_2170806_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2170943_2171207_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2171187_2171547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2173312_2174293_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2173164:2173182	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|2174615_2177978_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|2177977_2178553_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2178650_2179241_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2179557_2179791_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2179859_2179973_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2180751_2181186_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2181326_2182460_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
NZ_CP010444	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4609629	2375019	2394230	4609629	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2375019_2376480_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2376568_2377852_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2378456_2378570_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2378638_2378872_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|2379188_2379779_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2379876_2380452_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2380451_2381414_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2381364_2381934_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2382322_2382556_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2382613_2383024_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2383175_2383349_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2383520_2383676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2383754_2383820_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2383822_2384011_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2384021_2384234_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2384596_2385094_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2385090_2385624_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2385620_2385932_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2385936_2386152_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2386905_2387121_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2387421_2387634_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2387688_2387778_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2388055_2388808_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2388821_2389871_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2389872_2390151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2390217_2390469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2390685_2390841_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2390912_2391200_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2391199_2391439_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2391463_2391769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2391971_2392304_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2392740_2392890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2393186_2393417_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2393500_2393908_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2394074_2394230_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_CP010444	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4609629	3210826	3222037	4609629	integrase,tail	Enterobacteria_phage(50.0%)	17	3208801:3208817	3225712:3225728
3208801:3208817	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3210826_3211759_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3212070_3213228_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3213380_3213743_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3213739_3214660_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3214656_3215988_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3216022_3216304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3216602_3217043_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3217069_3217588_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3217637_3217913_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3217912_3218407_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3218403_3218772_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3219130_3219493_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3219558_3220383_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3220510_3221047_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3221037_3221400_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3221399_3221705_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3221836_3222037_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3225712:3225728	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP010444	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4609629	3596168	3603307	4609629		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3596168_3598730_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3598835_3599492_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|3599542_3600340_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|3600505_3601414_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3601410_3602577_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|3602668_3603307_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
