The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	355440	379986	6419376	tail,integrase,transposase	Burkholderia_phage(60.0%)	24	372904:372920	391296:391312
WP_006767226.1|355440_355947_+|tail	phage tail protein	tail	R4JGF0	Burkholderia_phage	89.3	8.3e-78
WP_006767227.1|355951_357031_+	phage late control D family protein	NA	R4JDM6	Burkholderia_phage	88.6	7.2e-180
WP_123806780.1|357075_357831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045552353.1|357919_358447_-	hypothetical protein	NA	R4JDM9	Burkholderia_phage	51.7	7.6e-42
WP_035974134.1|358685_360176_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_035975634.1|360772_361669_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035975636.1|362208_362514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006767229.1|362565_363627_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_158380464.1|364381_364858_+	universal stress protein	NA	NA	NA	NA	NA
WP_158380465.1|365038_366211_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_158380466.1|366203_366923_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_123806779.1|366882_367896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035975644.1|368231_368417_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_035975645.1|368613_369000_-	VOC family protein	NA	NA	NA	NA	NA
WP_035975646.1|369241_369679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006767235.1|369869_370778_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035975648.1|371145_373020_+	amidohydrolase	NA	NA	NA	NA	NA
372904:372920	attL	GCGAATCAGTGCGGCGT	NA	NA	NA	NA
WP_006767237.1|373279_373933_+	hydrolase	NA	NA	NA	NA	NA
WP_128567397.1|374197_375580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035975650.1|375597_377334_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_006764058.1|377474_377738_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045552354.1|377764_378460_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_081293702.1|378400_379669_-|transposase	IS256-like element ISBcen18 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	1.7e-39
WP_158380467.1|379749_379986_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	51.8	1.5e-10
391296:391312	attR	GCGAATCAGTGCGGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	1172648	1248250	6419376	plate,protease,tRNA	Vibrio_phage(22.22%)	60	NA	NA
WP_035971520.1|1172648_1173506_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_035973232.1|1173714_1175118_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_006763077.1|1175114_1175705_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_035971521.1|1175694_1178124_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_035971523.1|1178124_1178826_+	response regulator	NA	NA	NA	NA	NA
WP_035971524.1|1179300_1180035_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	43.1	2.1e-50
WP_035971525.1|1180107_1180740_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	35.3	3.0e-08
WP_035971526.1|1180758_1181211_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	31.4	3.4e-14
WP_035971527.1|1181452_1182238_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_035971528.1|1182234_1183005_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_035971529.1|1183128_1184277_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_035971530.1|1184288_1186604_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_006763080.1|1186689_1187202_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_035971531.1|1187198_1188296_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189550.1|1188422_1189466_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_006407213.1|1189834_1190134_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_006763082.1|1190201_1191692_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_006763083.1|1191696_1193172_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_006763084.1|1193288_1194128_+	polyphosphate kinase 2 family protein	NA	NA	NA	NA	NA
WP_006763085.1|1194171_1194945_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	32.3	1.6e-27
WP_035971533.1|1195071_1196124_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.7	1.2e-83
WP_006763087.1|1196352_1197309_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_035973233.1|1197368_1198403_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_035971535.1|1198392_1199814_-	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_006763089.1|1199925_1200534_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_006763090.1|1200530_1201676_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_128567331.1|1203552_1204572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035971538.1|1204743_1205331_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_045552502.1|1205472_1206153_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_162487093.1|1206410_1208939_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_052688723.1|1208978_1209542_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_081293564.1|1209576_1210272_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006763095.1|1210268_1211942_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006763096.1|1212303_1212843_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_035971540.1|1212885_1214385_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_035971542.1|1214586_1215069_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006763099.1|1215205_1215745_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_006763100.1|1215746_1217096_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006763101.1|1217092_1218388_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_006763102.1|1218402_1222314_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_006763103.1|1222719_1223283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035971545.1|1223376_1225956_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.6	2.1e-36
WP_035971546.1|1226041_1226308_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_035971547.1|1226346_1229799_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_006763106.1|1229877_1231230_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.9	4.3e-105
WP_006763107.1|1231259_1232294_-	fimbrial protein	NA	NA	NA	NA	NA
WP_006763108.1|1232343_1233402_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_006763109.1|1233398_1234460_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_006763110.1|1234463_1236344_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006763111.1|1236345_1236867_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_035973237.1|1236850_1237684_-	ImpE protein	NA	NA	NA	NA	NA
WP_006763113.1|1237707_1238370_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_006763114.1|1238876_1241534_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.0	1.1e-72
WP_006763115.1|1241635_1242307_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_006763116.1|1242273_1243065_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_006490510.1|1243061_1243961_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_035973239.1|1244252_1244477_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_035971549.1|1244582_1246016_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006763117.1|1246029_1246572_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_035971551.1|1246906_1248250_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.2	1.6e-43
>prophage 3
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	2010825	2026667	6419376	integrase	Burkholderia_virus(50.0%)	14	2006462:2006478	2036225:2036241
2006462:2006478	attL	CGTCGTTGCGCAGCCCG	NA	NA	NA	NA
WP_006763729.1|2010825_2013423_+	hypothetical protein	NA	Q6J1R0	Burkholderia_virus	78.4	0.0e+00
WP_081293570.1|2013419_2013914_+	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	43.1	4.1e-29
WP_035971950.1|2013923_2014316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052688661.1|2015984_2018351_+	hypothetical protein	NA	Q6J1Q9	Burkholderia_virus	51.0	2.3e-69
WP_006763731.1|2018363_2018699_+	hypothetical protein	NA	Q6J1Q7	Burkholderia_virus	95.5	1.3e-50
WP_035971951.1|2018695_2018974_+	hypothetical protein	NA	Q6J1Q6	Burkholderia_virus	91.1	1.3e-40
WP_006763733.1|2018960_2019380_+	glycoside hydrolase family protein	NA	A0A1I9L2K1	Xanthomonas_phage	39.0	9.8e-16
WP_035971952.1|2019376_2019874_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	76.7	3.7e-54
WP_035971954.1|2019870_2020842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006763735.1|2020838_2021897_-	acyltransferase	NA	A9YX16	Burkholderia_phage	33.5	1.1e-23
WP_006763736.1|2022069_2023272_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	44.6	5.2e-86
WP_006763737.1|2023680_2023863_-	rubredoxin	NA	NA	NA	NA	NA
WP_035971957.1|2024087_2024492_+	DUF4399 domain-containing protein	NA	NA	NA	NA	NA
WP_035971959.1|2024717_2026667_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	4.1e-48
2036225:2036241	attR	CGTCGTTGCGCAGCCCG	NA	NA	NA	NA
>prophage 4
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	2399542	2437332	6419376	transposase,protease,integrase	Stx2-converting_phage(23.08%)	35	2402185:2402205	2448853:2448873
WP_035972159.1|2399542_2400913_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_006764032.1|2400977_2403284_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
2402185:2402205	attL	ACGTCGACGTGACGACGGTGC	NA	NA	NA	NA
WP_081293580.1|2403318_2403846_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_006764034.1|2403862_2404969_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_006495559.1|2405098_2405566_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_006764035.1|2405624_2406413_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_035972165.1|2406416_2407586_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_006764036.1|2407582_2408230_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	42.8	2.7e-28
WP_006764037.1|2408226_2409009_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_035972167.1|2409123_2409939_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_006764039.1|2410315_2412715_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.7	6.3e-168
WP_006764040.1|2412839_2413274_+	NfeD family protein	NA	NA	NA	NA	NA
WP_006764041.1|2413307_2414243_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_006764042.1|2414396_2414843_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.1	1.0e-26
WP_006764043.1|2414941_2415379_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_006764044.1|2415383_2415707_+	RnfH family protein	NA	NA	NA	NA	NA
WP_006764045.1|2415795_2416779_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006764046.1|2416873_2417566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035972169.1|2417597_2418755_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_006764047.1|2418868_2419633_+	DUF899 domain-containing protein	NA	NA	NA	NA	NA
WP_045552515.1|2419673_2420489_+	DUF2182 domain-containing protein	NA	NA	NA	NA	NA
WP_006764048.1|2420765_2422226_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.6	3.3e-95
WP_035972172.1|2422232_2422850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006764050.1|2422965_2424585_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.6	2.5e-14
WP_006764051.1|2424886_2426143_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	52.8	1.0e-116
WP_081293581.1|2426203_2426479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035973335.1|2426483_2427008_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	36.0	2.4e-11
WP_035972174.1|2427076_2430316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158380473.1|2430379_2431024_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	45.8	6.5e-43
WP_006764054.1|2431114_2431522_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	45.1	1.5e-13
WP_006764055.1|2431518_2431866_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_006764056.1|2431895_2433458_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.3	4.6e-151
WP_006765345.1|2433498_2434095_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.6	6.0e-27
WP_006764058.1|2434338_2434602_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_006763677.1|2436072_2437332_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
2448853:2448873	attR	ACGTCGACGTGACGACGGTGC	NA	NA	NA	NA
>prophage 5
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	2876764	2930490	6419376	terminase,capsid,plate	Burkholderia_phage(55.0%)	72	NA	NA
WP_045552434.1|2876764_2877241_-	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	85.7	1.3e-56
WP_006764384.1|2877240_2877738_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	87.9	4.3e-79
WP_045552435.1|2877730_2877913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134220896.1|2878010_2879195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045552437.1|2879423_2880416_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	37.0	1.9e-62
WP_045552438.1|2880479_2881145_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	88.1	1.4e-112
WP_006764386.1|2881144_2882326_-|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	91.6	3.1e-192
WP_045552439.1|2882322_2882676_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	94.9	2.8e-56
WP_052688677.1|2882680_2883157_-	HNH endonuclease	NA	A0A0E3M1E6	Bacillus_phage	40.0	4.1e-18
WP_006764388.1|2883165_2883915_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	93.6	3.8e-127
WP_006764389.1|2883918_2884296_+	hypothetical protein	NA	A9YX05	Burkholderia_phage	91.2	2.6e-60
WP_045552440.1|2884292_2885261_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	88.6	5.2e-145
WP_045552441.1|2885257_2885575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045552442.1|2885574_2886150_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	36.8	2.0e-19
WP_006764391.1|2886146_2888141_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	35.0	9.7e-37
WP_045552443.1|2888324_2888894_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	35.4	6.4e-18
WP_045552444.1|2888902_2889400_-	HNH endonuclease	NA	Q2NPG0	Xanthomonas_virus	45.6	2.7e-33
WP_006764395.1|2889399_2889840_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	57.5	7.1e-41
WP_006764396.1|2889855_2891331_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	46.7	1.1e-109
WP_158380477.1|2891445_2891928_+	HNH endonuclease	NA	A0A220GJG3	Streptococcus_phage	38.2	1.0e-16
WP_006764397.1|2891915_2892494_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	88.2	2.0e-91
WP_045552446.1|2892498_2892870_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	94.3	7.2e-63
WP_006764399.1|2892931_2893414_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	88.7	4.2e-71
WP_006764400.1|2893441_2893825_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	90.6	1.3e-59
WP_045552447.1|2893884_2894370_-	hypothetical protein	NA	A9YX24	Burkholderia_phage	78.4	3.5e-17
WP_006764401.1|2894371_2895463_-	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	92.0	8.4e-152
WP_045552448.1|2895530_2896037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006764402.1|2896046_2897498_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	89.9	4.3e-212
WP_045552449.1|2897669_2897963_-	hypothetical protein	NA	A9YWZ9	Burkholderia_phage	92.8	1.1e-53
WP_006764404.1|2897964_2898720_-|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	96.0	9.7e-131
WP_006764405.1|2898716_2900183_-	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	94.8	5.8e-265
WP_006764406.1|2900203_2901757_-|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	45.4	8.7e-110
WP_006764407.1|2901707_2902187_-	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	78.9	4.1e-58
WP_006764408.1|2902204_2902858_-	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	84.9	1.1e-103
WP_045552450.1|2902854_2903034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045552451.1|2903158_2903590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081293711.1|2903586_2903880_-	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	61.2	1.9e-21
WP_006764411.1|2903926_2904397_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	80.1	1.4e-63
WP_045552453.1|2904393_2904654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045552520.1|2904650_2905082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045552454.1|2905750_2906740_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	73.3	1.5e-139
WP_045552522.1|2906724_2907195_-	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	80.0	9.8e-65
WP_045552455.1|2907248_2907896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045552523.1|2907952_2908168_-	hypothetical protein	NA	A9YWY0	Burkholderia_phage	85.7	3.0e-29
WP_045552456.1|2908170_2908545_-	hypothetical protein	NA	A9YWX9	Burkholderia_phage	87.9	1.7e-59
WP_045552457.1|2908711_2909092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045552458.1|2909242_2909488_-	helix-turn-helix domain-containing protein	NA	A0A0M3LQ90	Mannheimia_phage	47.3	2.2e-12
WP_045552459.1|2909574_2909961_+	hypothetical protein	NA	A9YWX7	Burkholderia_phage	64.3	2.4e-08
WP_006764415.1|2910968_2911385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123806838.1|2911481_2912213_+	hypothetical protein	NA	A0A291L9Z7	Bordetella_phage	57.2	2.3e-73
WP_094190562.1|2912261_2912615_+	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	66.2	1.7e-13
WP_045552462.1|2912614_2912905_+	hypothetical protein	NA	Q6V7Q5	Burkholderia_virus	60.8	1.0e-24
WP_045552463.1|2912901_2913081_+	hypothetical protein	NA	A9YWW6	Burkholderia_phage	69.0	2.5e-13
WP_006764418.1|2913384_2914194_+	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	60.9	8.0e-91
WP_045552464.1|2914208_2915408_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	52.2	1.1e-62
WP_045552465.1|2915420_2917187_+	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	37.0	5.7e-73
WP_006764420.1|2917183_2917819_+	hypothetical protein	NA	A9YX18	Burkholderia_phage	85.2	2.1e-17
WP_105773984.1|2918044_2919541_+	hypothetical protein	NA	A0A0K2FMB2	Brevibacillus_phage	45.3	1.4e-80
WP_045552466.1|2919546_2919999_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	90.8	6.3e-77
WP_045552467.1|2919995_2920190_+	hypothetical protein	NA	A9YX20	Burkholderia_phage	82.1	1.7e-18
WP_105773983.1|2920194_2920674_+	hypothetical protein	NA	A0A0K2FHI1	Achromobacter_phage	48.2	5.0e-32
WP_045552468.1|2920813_2921137_+	hypothetical protein	NA	A0A076G9A8	Mycobacterium_phage	31.3	2.7e-05
WP_006764424.1|2921169_2921994_+	YfdQ family protein	NA	I6NVL7	Burkholderia_virus	37.5	1.9e-39
WP_006764425.1|2922223_2924233_+	DNA cytosine methyltransferase	NA	A9YX21	Burkholderia_phage	74.8	2.9e-158
WP_006764426.1|2924229_2925264_+	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	66.8	1.2e-134
WP_045552470.1|2926073_2927390_+	hypothetical protein	NA	A4JWW2	Burkholderia_virus	56.2	1.0e-10
WP_123806839.1|2927379_2927751_+	hypothetical protein	NA	Q6JIJ2	Burkholderia_virus	41.2	5.6e-07
WP_006764430.1|2927753_2927963_-	hypothetical protein	NA	A9YWV5	Burkholderia_phage	77.9	2.8e-24
WP_045552471.1|2927998_2928919_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	66.9	5.5e-128
WP_045552472.1|2928921_2929257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006764431.1|2929294_2929783_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	52.5	5.4e-42
WP_006764432.1|2929779_2930490_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	42.9	3.6e-34
>prophage 6
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	3339080	3406359	6419376	transposase,holin	Leptospira_phage(28.57%)	54	NA	NA
WP_045552534.1|3339080_3340211_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_035972705.1|3340727_3342176_-	NYN domain-containing protein	NA	A0A2P0VNQ4	Tetraselmis_virus	33.0	2.9e-06
WP_006764722.1|3342470_3343097_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035972708.1|3343152_3343701_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_035972710.1|3343884_3345717_+	cyclic di-GMP phosphodiesterase CdpA	NA	NA	NA	NA	NA
WP_035972712.1|3345744_3347244_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_035972714.1|3347343_3348138_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035972715.1|3348443_3349502_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_035972717.1|3349485_3350826_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_035972719.1|3350840_3352304_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_035972720.1|3352311_3353358_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_006764730.1|3353354_3354422_-	arginine/ornithine succinyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_006764731.1|3354452_3355685_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_094190579.1|3355878_3357008_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.5	1.9e-50
WP_123806846.1|3357682_3360172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094190580.1|3360264_3361498_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	6.9e-102
WP_123806847.1|3363158_3364112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123806848.1|3364656_3364920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006764737.1|3365037_3366078_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006764738.1|3366100_3366895_-	ATP-binding cassette domain-containing protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	23.1	9.2e-07
WP_006764739.1|3366916_3367630_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035972727.1|3367626_3368316_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_006764740.1|3368590_3369148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035972729.1|3369256_3370294_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_035972731.1|3370290_3371175_-	hopanoid biosynthesis-associated protein HpnK	NA	NA	NA	NA	NA
WP_035972733.1|3371178_3372600_-	hopanoid biosynthesis associated radical SAM protein HpnJ	NA	NA	NA	NA	NA
WP_035972735.1|3372760_3373936_-	bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI	NA	NA	NA	NA	NA
WP_035972737.1|3374566_3375565_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006764746.1|3375622_3376684_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006764747.1|3376858_3377719_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_035972739.1|3377977_3380119_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_006764750.1|3380485_3381634_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035972741.1|3381859_3382621_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006764752.1|3383041_3384394_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_006764753.1|3384546_3385011_-	DUF2214 family protein	NA	NA	NA	NA	NA
WP_006764754.1|3385048_3385852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006764755.1|3386097_3387162_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035972743.1|3387730_3389563_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	8.6e-40
WP_006764757.1|3389771_3391151_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_006764758.1|3391147_3391900_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_035972744.1|3392192_3392828_+	SCO family protein	NA	NA	NA	NA	NA
WP_006764759.1|3392836_3393277_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_006764760.1|3393287_3394157_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_035972745.1|3394181_3394673_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035973394.1|3394796_3395663_-	pirin family protein	NA	NA	NA	NA	NA
WP_006764762.1|3395772_3396690_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006764764.1|3396822_3397326_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_035972746.1|3397498_3398305_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_035972748.1|3398304_3398541_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_035972750.1|3398687_3399311_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006764767.1|3399349_3399898_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_052688700.1|3402071_3402719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094190582.1|3402754_3403884_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.5	1.9e-50
WP_006763677.1|3405099_3406359_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
>prophage 7
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	3683798	3697840	6419376		Enterobacteria_phage(42.86%)	10	NA	NA
WP_035972937.1|3683798_3687524_-	glycosyltransferase	NA	A0A1X9SJW0	Sulfolobus_islandicus_rod-shaped_virus	26.3	1.6e-05
WP_045552536.1|3687524_3688853_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_006765006.1|3689195_3690641_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.2	2.0e-52
WP_035972940.1|3690863_3691754_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	7.6e-26
WP_035972942.1|3691750_3692302_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.6	2.7e-50
WP_035972943.1|3692286_3693180_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.2	1.3e-97
WP_006765010.1|3693191_3694253_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	1.6e-86
WP_081293608.1|3694749_3696102_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_035973415.1|3696098_3696722_+	acetyltransferase	NA	NA	NA	NA	NA
WP_046377167.1|3696736_3697840_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	33.7	9.1e-45
>prophage 8
NZ_CP011301	Burkholderia cepacia strain LO6 chromosome, complete genome	6419376	4061422	4131773	6419376	transposase,plate,tRNA	Stx2-converting_phage(25.0%)	57	NA	NA
WP_006765301.1|4061422_4062721_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_006765302.1|4062803_4063886_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_006765303.1|4063893_4064736_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006765304.1|4064803_4065115_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_006765305.1|4065143_4065740_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_006765306.1|4065960_4066752_+	dioxygenase	NA	NA	NA	NA	NA
WP_006765307.1|4066863_4068462_-	APC family permease	NA	NA	NA	NA	NA
WP_006477070.1|4068885_4069089_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_045552539.1|4069187_4070438_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_035973132.1|4070632_4071238_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_035973134.1|4071371_4072655_-	MFS transporter	NA	NA	NA	NA	NA
WP_006765310.1|4072875_4073496_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035973136.1|4073557_4074130_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_006765312.1|4074193_4075084_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035973137.1|4075173_4076307_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035973138.1|4076621_4077113_-	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_006765315.1|4077757_4079926_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	26.4	1.4e-49
WP_035973435.1|4080045_4081074_-	transporter	NA	NA	NA	NA	NA
WP_006765317.1|4081269_4082232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006765318.1|4082353_4083199_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_006765319.1|4083500_4087442_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_006765320.1|4087438_4088428_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_006765321.1|4088432_4089386_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006765322.1|4089741_4090878_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_006765323.1|4090919_4093586_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.6	5.9e-90
WP_006765324.1|4093630_4094731_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_006765325.1|4094694_4096530_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006765326.1|4096607_4097093_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006765327.1|4097155_4097659_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006765328.1|4097729_4099220_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006765329.1|4099235_4099751_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_035973140.1|4099788_4100421_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006765331.1|4100797_4101409_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_006765332.1|4101511_4102858_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006765333.1|4102854_4103637_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006765334.1|4103709_4104018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123806799.1|4104348_4104942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081293616.1|4105465_4105669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081293617.1|4105793_4106123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006765336.1|4110747_4113924_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.8	5.4e-58
WP_006765337.1|4114249_4115050_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006765338.1|4115159_4115363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052688713.1|4115957_4117712_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_094190595.1|4117774_4118903_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.5	1.9e-50
WP_006765340.1|4120003_4120711_-	pirin family protein	NA	NA	NA	NA	NA
WP_035973142.1|4120794_4121559_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.3	7.8e-11
WP_006765341.1|4121697_4122615_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006765343.1|4122777_4123743_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	39.2	5.9e-56
WP_035973143.1|4123776_4124181_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_035973439.1|4124451_4125882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035973144.1|4126421_4126997_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	42.6	1.2e-24
WP_035973145.1|4127352_4127853_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_035973146.1|4127849_4128974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105773880.1|4129141_4129333_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_006764054.1|4129429_4129837_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	45.1	1.5e-13
WP_006764055.1|4129833_4130181_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_006764056.1|4130210_4131773_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.3	4.6e-151
