The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010443	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4606859	1008059	1056743	4606859	integrase,transposase	Streptococcus_phage(20.0%)	49	1022545:1022604	1056853:1056912
WP_000006255.1|1008059_1008557_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1008780_1010520_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|1010464_1011250_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1011320_1012376_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1012427_1012721_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1012723_1013122_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1013131_1013584_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1013889_1014156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1014088_1014625_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1014681_1016139_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1016399_1016858_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1016949_1018194_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1018251_1018653_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1018691_1019747_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1020034_1021138_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1021149_1022403_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1022545:1022604	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1022974_1023316_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1023336_1023654_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1023672_1023894_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1023902_1024379_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1024394_1024853_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1024950_1025190_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1025266_1025734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1025756_1026200_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1026199_1026427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1026830_1027652_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1027743_1028607_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1028935_1029829_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1030249_1031401_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1033747_1034764_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1034971_1036375_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1036361_1037294_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1037402_1038449_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1039670_1040009_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1040031_1040382_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|1040475_1041630_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1041924_1042833_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1042847_1044815_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|1045041_1046424_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|1046435_1048046_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1048050_1048809_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1048947_1049952_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1051146_1051878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1051968_1052595_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1052866_1053565_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1053591_1054446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1054564_1054789_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1054785_1055226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1055342_1056743_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1056853:1056912	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP010443	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4606859	1278692	1341651	4606859	protease,lysis,transposase,tRNA,terminase,integrase	Enterobacteria_phage(50.0%)	66	1324309:1324355	1345611:1345657
WP_001295836.1|1278692_1279316_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1279286_1279973_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1279969_1282384_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1282814_1287095_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1287134_1287503_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1288193_1288454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1289685_1290780_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1290848_1291775_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1292004_1292487_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1292564_1293380_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1293469_1295251_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1295263_1296040_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1296139_1297018_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1297186_1298641_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1298700_1300062_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1300118_1301420_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1301441_1302587_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1302814_1303600_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1303610_1304846_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1304867_1305917_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1306233_1307901_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1307910_1309170_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1309180_1309996_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1309992_1310886_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1311080_1312148_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1312144_1312654_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1312771_1313494_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1313496_1313991_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1314164_1315550_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1315585_1316107_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1316214_1316427_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1316428_1317295_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1317765_1318308_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1318527_1319220_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1319250_1321854_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1321832_1322873_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1322883_1323399_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1323401_1324034_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1324309:1324355	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1324368_1325532_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1325651_1325915_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1326237_1326333_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1326395_1326695_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1326691_1327558_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1327868_1328201_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1328248_1328398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1328455_1329982_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1330446_1330998_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1331007_1331805_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1331921_1332023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1332019_1332475_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1332474_1332645_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1332637_1332928_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1332924_1333287_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1333283_1333424_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1333509_1333893_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1334290_1335307_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1335311_1336379_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1336951_1337167_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1337166_1337664_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1337880_1338063_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1338153_1338447_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1338737_1339148_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1339433_1339640_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1339804_1339999_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1340387_1340933_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1340907_1341651_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1345611:1345657	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP010443	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4606859	2138872	2179690	4606859	lysis,tail,tRNA,transposase,integrase	Escherichia_phage(45.16%)	43	2140019:2140037	2170394:2170412
WP_010723085.1|2138872_2139889_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
2140019:2140037	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|2140161_2140419_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2140468_2141419_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2141570_2142323_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|2142517_2143033_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2143043_2144570_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|2144606_2146052_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|2146051_2147362_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|2147537_2148446_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2148775_2149339_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2149359_2150592_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2150846_2151830_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2152307_2153681_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2153809_2154745_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2154796_2156032_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2156033_2156249_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2156327_2156537_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2156529_2156724_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2156780_2157590_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2157582_2160183_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2160284_2160560_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2160634_2160805_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2160804_2161026_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2161467_2161956_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2161952_2162108_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2162561_2163038_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2163161_2163458_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2163480_2163903_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2163915_2164773_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2164779_2165526_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2165548_2166109_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2166196_2166382_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2166578_2168036_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2168173_2168437_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2168417_2168777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2170542_2171523_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2170394:2170412	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|2171845_2175208_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|2175207_2175783_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2175880_2176471_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2176787_2177021_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2177089_2177203_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2177981_2178416_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2178556_2179690_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
NZ_CP010443	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4606859	2372249	2391460	4606859	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2372249_2373710_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2373798_2375082_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2375686_2375800_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2375868_2376102_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|2376418_2377009_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2377106_2377682_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2377681_2378644_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2378594_2379164_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2379552_2379786_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2379843_2380254_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2380405_2380579_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2380750_2380906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2380984_2381050_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2381052_2381241_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2381251_2381464_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2381826_2382324_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2382320_2382854_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2382850_2383162_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2383166_2383382_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2384135_2384351_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2384651_2384864_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2384918_2385008_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2385285_2386038_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2386051_2387101_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2387102_2387381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2387447_2387699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2387915_2388071_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2388142_2388430_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2388429_2388669_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2388693_2388999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2389201_2389534_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2389970_2390120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2390416_2390647_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2390730_2391138_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2391304_2391460_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_CP010443	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4606859	3208056	3219267	4606859	tail,integrase	Enterobacteria_phage(50.0%)	17	3206031:3206047	3222942:3222958
3206031:3206047	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3208056_3208989_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3209300_3210458_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3210610_3210973_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3210969_3211890_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3211886_3213218_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3213252_3213534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3213832_3214273_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3214299_3214818_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3214867_3215143_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3215142_3215637_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3215633_3216002_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3216360_3216723_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3216788_3217613_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3217740_3218277_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3218267_3218630_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3218629_3218935_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3219066_3219267_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3222942:3222958	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP010443	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4606859	3593398	3600537	4606859		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3593398_3595960_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3596065_3596722_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|3596772_3597570_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|3597735_3598644_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3598640_3599807_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|3599898_3600537_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
