The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010442	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4660432	574119	632972	4660432	transposase,protease,tRNA	Paramecium_bursaria_Chlorella_virus(15.38%)	51	NA	NA
WP_001162171.1|574119_575472_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_023649327.1|575650_576016_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106233.1|576060_576525_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187778.1|576682_578821_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001336303.1|579214_580870_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001407733.1|580919_582341_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181307.1|582459_583407_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_001387276.1|583591_583645_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|583785_586482_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|586687_587074_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|587146_587608_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|587620_588556_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|588559_588694_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|588974_589370_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500727.1|589500_590214_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256658.1|590284_590878_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583469.1|591022_591475_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000036434.1|591597_593412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012931.1|593467_594472_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|594633_595050_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059402.1|595194_595698_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079634.1|595890_597087_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416392.1|597142_599998_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786400.1|599997_600441_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|600600_602112_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|602378_603479_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|603478_604561_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294573.1|604721_606224_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001309159.1|606301_607300_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|607366_608686_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|608747_609512_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|609535_610567_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|610783_611347_+	gluconokinase	NA	NA	NA	NA	NA
WP_001309160.1|611350_612370_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_085947917.1|614387_615660_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001443048.1|617013_617880_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	3.3e-50
WP_000169527.1|617876_618176_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000131420.1|619082_619271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483319.1|619873_620287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|620392_620857_+	membrane protein	NA	NA	NA	NA	NA
WP_001351580.1|621020_621434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092154.1|621543_622605_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001143750.1|623195_626204_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001235704.1|626367_626919_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
WP_000422420.1|626934_629031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|629409_629484_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083834.1|629717_629975_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|630258_630408_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000802277.1|630808_631120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345829.1|631584_631773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000878218.1|632105_632972_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 2
NZ_CP010442	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4660432	1061632	1110316	4660432	transposase,integrase	Streptococcus_phage(20.0%)	49	1076118:1076177	1110426:1110485
WP_000006255.1|1061632_1062130_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1062353_1064093_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|1064037_1064823_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1064893_1065949_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1066000_1066294_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1066296_1066695_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1066704_1067157_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1067462_1067729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1067661_1068198_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1068254_1069712_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1069972_1070431_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1070522_1071767_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1071824_1072226_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1072264_1073320_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1073607_1074711_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1074722_1075976_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1076118:1076177	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1076547_1076889_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1076909_1077227_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1077245_1077467_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1077475_1077952_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1077967_1078426_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1078523_1078763_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1078839_1079307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1079329_1079773_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1079772_1080000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1080403_1081225_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1081316_1082180_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1082508_1083402_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1083822_1084974_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1087320_1088337_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1088544_1089948_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1089934_1090867_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1090975_1092022_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1093243_1093582_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1093604_1093955_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|1094048_1095203_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1095497_1096406_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1096420_1098388_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|1098614_1099997_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|1100008_1101619_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1101623_1102382_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1102520_1103525_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1104719_1105451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1105541_1106168_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1106439_1107138_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1107164_1108019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1108137_1108362_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1108358_1108799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1108915_1110316_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1110426:1110485	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 3
NZ_CP010442	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4660432	1332265	1395224	4660432	integrase,lysis,transposase,tRNA,terminase,protease	Enterobacteria_phage(50.0%)	66	1377882:1377928	1399184:1399230
WP_001295836.1|1332265_1332889_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1332859_1333546_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1333542_1335957_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1336387_1340668_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1340707_1341076_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1341766_1342027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1343258_1344353_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1344421_1345348_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1345577_1346060_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1346137_1346953_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1347042_1348824_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1348836_1349613_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1349712_1350591_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1350759_1352214_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1352273_1353635_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1353691_1354993_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1355014_1356160_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1356387_1357173_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1357183_1358419_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1358440_1359490_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1359806_1361474_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1361483_1362743_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1362753_1363569_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1363565_1364459_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1364653_1365721_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1365717_1366227_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1366344_1367067_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1367069_1367564_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1367737_1369123_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1369158_1369680_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1369787_1370000_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1370001_1370868_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1371338_1371881_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1372100_1372793_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1372823_1375427_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1375405_1376446_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1376456_1376972_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1376974_1377607_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1377882:1377928	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1377941_1379105_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1379224_1379488_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1379810_1379906_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1379968_1380268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1380264_1381131_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1381441_1381774_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1381821_1381971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1382028_1383555_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1384019_1384571_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1384580_1385378_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1385494_1385596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1385592_1386048_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1386047_1386218_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1386210_1386501_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1386497_1386860_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1386856_1386997_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1387082_1387466_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1387863_1388880_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1388884_1389952_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1390524_1390740_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1390739_1391237_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1391453_1391636_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1391726_1392020_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1392310_1392721_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1393006_1393213_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1393377_1393572_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1393960_1394506_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1394480_1395224_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1399184:1399230	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP010442	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4660432	2192444	2233262	4660432	integrase,lysis,transposase,tRNA,tail	Escherichia_phage(45.16%)	43	2193591:2193609	2223966:2223984
WP_010723085.1|2192444_2193461_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
2193591:2193609	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|2193733_2193991_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2194040_2194991_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2195142_2195895_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|2196089_2196605_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2196615_2198142_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|2198178_2199624_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|2199623_2200934_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|2201109_2202018_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2202347_2202911_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2202931_2204164_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2204418_2205402_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2205879_2207253_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2207381_2208317_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2208368_2209604_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2209605_2209821_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2209899_2210109_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2210101_2210296_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2210352_2211162_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2211154_2213755_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2213856_2214132_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2214206_2214377_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2214376_2214598_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2215039_2215528_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2215524_2215680_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2216133_2216610_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2216733_2217030_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2217052_2217475_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2217487_2218345_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2218351_2219098_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2219120_2219681_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2219768_2219954_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2220150_2221608_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2221745_2222009_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2221989_2222349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2224114_2225095_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2223966:2223984	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|2225417_2228780_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|2228779_2229355_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2229452_2230043_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2230359_2230593_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2230661_2230775_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2231553_2231988_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2232128_2233262_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP010442	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4660432	2425821	2445032	4660432	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2425821_2427282_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2427370_2428654_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2429258_2429372_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2429440_2429674_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|2429990_2430581_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2430678_2431254_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2431253_2432216_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2432166_2432736_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2433124_2433358_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2433415_2433826_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2433977_2434151_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2434322_2434478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2434556_2434622_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2434624_2434813_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2434823_2435036_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2435398_2435896_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2435892_2436426_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2436422_2436734_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2436738_2436954_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2437707_2437923_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2438223_2438436_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2438490_2438580_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2438857_2439610_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2439623_2440673_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2440674_2440953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2441019_2441271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2441487_2441643_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2441714_2442002_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2442001_2442241_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2442265_2442571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2442773_2443106_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2443542_2443692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2443988_2444219_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2444302_2444710_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2444876_2445032_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP010442	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4660432	3261629	3272840	4660432	tail,integrase	Enterobacteria_phage(50.0%)	17	3259604:3259620	3276515:3276531
3259604:3259620	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3261629_3262562_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3262873_3264031_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3264183_3264546_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3264542_3265463_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3265459_3266791_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3266825_3267107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3267405_3267846_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3267872_3268391_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3268440_3268716_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3268715_3269210_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3269206_3269575_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3269933_3270296_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3270361_3271186_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3271313_3271850_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3271840_3272203_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3272202_3272508_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3272639_3272840_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3276515:3276531	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP010442	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4660432	3646971	3654110	4660432		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3646971_3649533_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3649638_3650295_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|3650345_3651143_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|3651308_3652217_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3652213_3653380_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|3653471_3654110_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
