The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010439	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4604543	994978	1043662	4604543	integrase,transposase	Streptococcus_phage(20.0%)	49	1009464:1009523	1043772:1043831
WP_000006255.1|994978_995476_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|995699_997439_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|997383_998169_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|998239_999295_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|999346_999640_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|999642_1000041_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1000050_1000503_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1000808_1001075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1001007_1001544_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1001600_1003058_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1003318_1003777_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1003868_1005113_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1005170_1005572_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1005610_1006666_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1006953_1008057_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1008068_1009322_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1009464:1009523	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1009893_1010235_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1010255_1010573_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1010591_1010813_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1010821_1011298_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1011313_1011772_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1011869_1012109_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1012185_1012653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1012675_1013119_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1013118_1013346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1013749_1014571_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1014662_1015526_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1015854_1016748_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1017168_1018320_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1020666_1021683_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1021890_1023294_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1023280_1024213_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1024321_1025368_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1026589_1026928_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1026950_1027301_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|1027394_1028549_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1028843_1029752_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1029766_1031734_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|1031960_1033343_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|1033354_1034965_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1034969_1035728_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1035866_1036871_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1038065_1038797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1038887_1039514_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1039785_1040484_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1040510_1041365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1041483_1041708_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1041704_1042145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1042261_1043662_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1043772:1043831	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP010439	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4604543	1263260	1323598	4604543	protease,integrase,tRNA,transposase,terminase	Enterobacteria_phage(43.48%)	61	1308877:1308923	1327558:1327604
WP_001295836.1|1263260_1263884_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1263854_1264541_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1264537_1266952_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1267382_1271663_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1271702_1272071_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1272761_1273022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1274253_1275348_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1275416_1276343_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1276572_1277055_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1277132_1277948_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1278037_1279819_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1279831_1280608_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1280707_1281586_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1281754_1283209_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1283268_1284630_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1284686_1285988_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1286009_1287155_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_038432500.1|1287364_1288168_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1288178_1289414_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1289435_1290485_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1290801_1292469_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1292478_1293738_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1293748_1294564_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1294560_1295454_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1295648_1296716_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1296712_1297222_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1297339_1298062_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1298064_1298559_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1298732_1300118_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1300153_1300675_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1300782_1300995_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1300996_1301863_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1302333_1302876_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1303095_1303788_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1303818_1306422_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1306400_1307441_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1307451_1307967_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1307969_1308602_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1308877:1308923	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1308936_1310100_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1310219_1310483_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1310805_1310901_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1310963_1311263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1311259_1312126_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1312436_1312769_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1312816_1312966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1313023_1314550_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1315014_1315566_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1315575_1316373_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1316489_1316591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1316587_1317043_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1317042_1317213_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1317205_1317496_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1317492_1317855_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1317851_1317992_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1318077_1318461_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1318858_1319875_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000079503.1|1319907_1320318_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1320603_1320810_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1320974_1321169_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_071842869.1|1322478_1322880_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.7	7.8e-63
WP_001027248.1|1322854_1323598_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1327558:1327604	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP010439	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4604543	1934347	1955740	4604543	integrase,plate,tRNA,portal,tail	Shigella_phage(31.58%)	31	1926342:1926356	1962443:1962457
1926342:1926356	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1934347_1935454_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1935507_1935969_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1935978_1936632_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1936803_1938054_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1938547_1939213_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1939213_1939918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1940375_1941269_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1941359_1942487_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1942467_1942713_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1942749_1943061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1943177_1943519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1943456_1943765_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1943939_1944614_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1944704_1944905_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1944948_1945506_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1945681_1945861_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1945850_1947218_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1947229_1947412_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1947411_1947885_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1947811_1948603_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1948593_1949178_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554707.1|1949181_1949970_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000548498.1|1949969_1950572_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|1950543_1950957_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905001.1|1951365_1951920_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1952026_1952860_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1953093_1953258_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1953360_1953684_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1954220_1954331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1954383_1954788_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1955008_1955740_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1962443:1962457	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP010439	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4604543	2147044	2210990	4604543	integrase,tRNA,transposase,lysis,tail	Escherichia_phage(40.62%)	60	2137704:2137722	2168078:2168096
2137704:2137722	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000628058.1|2147044_2148277_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2148531_2149515_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2149992_2151366_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2151494_2152430_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2152481_2153717_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2153718_2153934_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2154012_2154222_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2154214_2154409_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2154465_2155275_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2155267_2157868_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2157969_2158245_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2158319_2158490_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2158489_2158711_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2159152_2159641_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2159637_2159793_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2160246_2160723_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2160846_2161143_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2161165_2161588_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2161600_2162458_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2162464_2163211_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2163233_2163794_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2163881_2164067_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2164263_2165721_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2165857_2166121_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2166101_2166461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2168226_2169207_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2168078:2168096	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_071842875.1|2169529_2172892_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	6.2e-12
WP_001698950.1|2172891_2173467_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2173564_2174155_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2174471_2174705_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2174773_2174887_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2175665_2176100_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2176240_2177374_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|2177740_2181265_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2181538_2181805_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|2181801_2182224_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|2182334_2183324_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_046377550.1|2183531_2186111_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|2186167_2186353_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|2186360_2186687_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|2186858_2187764_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|2187999_2189499_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|2189556_2191830_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|2192077_2194123_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|2194407_2195337_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2195348_2195636_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|2195644_2196391_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|2196405_2196903_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|2196910_2197981_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|2197977_2198745_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|2198744_2199533_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|2199534_2200962_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|2200951_2201374_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|2201373_2202579_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|2202605_2203919_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|2204019_2204970_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|2204951_2205542_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|2205645_2205711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|2208401_2209675_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|2209838_2210990_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 5
NZ_CP010439	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4604543	2369932	2389143	4604543	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2369932_2371393_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2371481_2372765_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2373369_2373483_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2373551_2373785_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|2374101_2374692_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2374789_2375365_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2375364_2376327_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2376277_2376847_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2377235_2377469_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2377526_2377937_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2378088_2378262_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2378433_2378589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2378667_2378733_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2378735_2378924_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2378934_2379147_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2379509_2380007_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2380003_2380537_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2380533_2380845_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2380849_2381065_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2381818_2382034_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2382334_2382547_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2382601_2382691_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2382968_2383721_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2383734_2384784_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2384785_2385064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2385130_2385382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2385598_2385754_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2385825_2386113_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2386112_2386352_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2386376_2386682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2386884_2387217_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2387653_2387803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2388099_2388330_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2388413_2388821_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2388987_2389143_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP010439	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4604543	3205740	3216951	4604543	integrase,tail	Enterobacteria_phage(50.0%)	17	3203715:3203731	3220626:3220642
3203715:3203731	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3205740_3206673_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3206984_3208142_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3208294_3208657_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3208653_3209574_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3209570_3210902_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3210936_3211218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3211516_3211957_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3211983_3212502_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3212551_3212827_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3212826_3213321_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3213317_3213686_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3214044_3214407_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3214472_3215297_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3215424_3215961_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3215951_3216314_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3216313_3216619_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3216750_3216951_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3220626:3220642	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP010439	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4604543	3591082	3598221	4604543		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3591082_3593644_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3593749_3594406_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|3594456_3595254_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|3595419_3596328_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3596324_3597491_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|3597582_3598221_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
