The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010429	Spirosoma radiotolerans strain DG5A chromosome, complete genome	7029352	5075512	5135848	7029352	tRNA,transposase,integrase	uncultured_Mediterranean_phage(25.0%)	42	5079259:5079311	5135997:5136049
WP_046576390.1|5075512_5076643_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.9	1.1e-77
WP_082111750.1|5076566_5078012_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_179945469.1|5078085_5078715_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_046576393.1|5078835_5079138_+	hypothetical protein	NA	NA	NA	NA	NA
5079259:5079311	attL	AGCATCTGACTGTTAATCAGAGGGTCGCTGGTTCGAGCCCAGCTTCGGGAGCA	NA	NA	NA	NA
WP_052731235.1|5079572_5080217_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046576396.1|5082658_5083183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562477.1|5083383_5083575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046576397.1|5084070_5084946_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_046576399.1|5084935_5086837_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_046576400.1|5086848_5087124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046576402.1|5087400_5088276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046576403.1|5088299_5088590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046576406.1|5089346_5090894_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_148562478.1|5091299_5092286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046576409.1|5092758_5093469_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_082111644.1|5093651_5093759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046576411.1|5094855_5095953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046576413.1|5095958_5097110_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.8	7.5e-26
WP_082111645.1|5097254_5098259_+	DUF4007 family protein	NA	NA	NA	NA	NA
WP_046576416.1|5098251_5101701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046576418.1|5101750_5104117_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_046576420.1|5104124_5106101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046576421.1|5106090_5106915_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	33.6	7.8e-25
WP_046579886.1|5106939_5108817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046576422.1|5108886_5110434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562563.1|5110957_5115772_+	DNA translocase FtsK	NA	A0A0A0RUH6	Bacillus_phage	32.7	2.4e-33
WP_046576425.1|5116092_5116524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158500580.1|5116871_5117042_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_148562479.1|5117697_5117802_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052731237.1|5117885_5118401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046576427.1|5118537_5120040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052731238.1|5120394_5120754_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158500581.1|5121392_5121569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562480.1|5121787_5122381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082111646.1|5122567_5124586_+	caspase family protein	NA	NA	NA	NA	NA
WP_082111647.1|5124910_5125174_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_052731239.1|5125137_5125413_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046576432.1|5125895_5126849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082111648.1|5126852_5128205_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_046576435.1|5128485_5131557_-	caspase family protein	NA	NA	NA	NA	NA
WP_046576436.1|5131562_5133164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046576438.1|5134594_5135848_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
5135997:5136049	attR	AGCATCTGACTGTTAATCAGAGGGTCGCTGGTTCGAGCCCAGCTTCGGGAGCA	NA	NA	NA	NA
